Detection of Porcine Circovirus 1/2/3 and Genetic Analysis of Porcine Circovirus 2 in Wild Boar from Jiangxi Province of China
by
,
Xifeng Hu
1,2, 
Zheng Chen
1,2,
Yu Li
1,2,
Zhen Ding
1,2,
Qinghua Zeng
1,2,
Tong Wan
3 and
Huansheng Wu
1,2,* 1
Department of Preventive Veterinary Medicine, College of Animal Science and Technology, Jiangxi Agricultural University, Zhimin Street, Qingshan Lake, Nanchang 330045, China
2
Jiangxi Provincial Key Laboratory for Animal Science and Technology, College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang 330045, China
3
College of Engineering, Jiangxi Agricultural University, Zhimin Street, Qingshan Lake, Nanchang 330045, China
*
Author to whom correspondence should be addressed.
Animals 2022, 12(16), 2021; https://doi.org/10.3390/ani12162021
Submission received: 17 June 2022
/
Revised: 24 July 2022
/
Accepted: 2 August 2022
/
Published: 10 August 2022
(This article belongs to the Special Issue Wildlife as a Source of Infectious Agents Involved in Zoonoses and Domestic Animal Infections)
Abstract
:Simple Summary
Since PCV2 is currently the primary viral agent in intensive pigs, the cost of immune suppression and preventative measures has resulted in severe economic losses. It has been claimed that PCVs infect wild pigs in a number of nations, including South Korea, Germany, and Italy. Jiangxi province in China is a heavily populated area with an extremely intensive pig production industry, but data on the transmission of PCVs in wild boar are poor. In order to ascertain the incidence of PCV1/2/3 and the genetic characteristics of PCV2 circulating in wild boar in Jiangxi province, an epidemiological investigation was conducted. We discovered a medium prevalence of PCVs, notably PCV2, which indicated that wild boar in Jiangxi province were exposed to PCVs. Our findings highlight the need for the pig sector to actively prevent the contact between livestock and wild boar, which have a high risk of PCVs infection.
Abstract
A number of disorders that harm pig production are linked to porcine circoviruses, including PCV2. PCV2 infection is a substantial contributor to porcine-circovirus-associated illnesses (PCAS) and the post-weaning multi-systemic wasting syndrome (PMWS), which have a significant negative economic impact on pig production. Additionally, PCV infection has been labeled as a global concern to cattle and wildlife. This study’s objectives were to examine the prevalence of PCV1/2/3 in Jiangxi Province, China, and to clarify the epidemiological significance of wild boar in PCV epidemiology. The 2020 hunting seasons resulted in the collection of 138 wild boar samples for PCV1/2/3 detection, which was followed by the genetic clarification of PCV2 strains. According to our data, 21.7% (30/138) of the population had PCV1 positivity, 22.5% (31/138) had PCV2 positivity, and 5.8% (8/138) had PCV3 positivity. Additionally, 10 out of 138 wild boar samples had PCV1 and PCV2 co-infections, while 5 out of 138 wild boar samples had PCV2 and PC3 co-infections. Nineteen full-length PCV2 genomes measuring 1767 nt were recovered from various animal tissues using conventional PCR. Eighteen out of nineteen PCV2 strains were identified as PCV2b by phylogenetic tree analysis, which was completed by the reference strain HLJ2015 obtained from domestic pigs in 2015. Additionally, one genotype of PCV2d JX11-2020 (MW889021) shared a sub-branch with the referenced strain TJ (AY181946), which was isolated in domestic pigs in 2002. This finding raises the possibility that domestic pigs could contract PCV2 strains from wild boar, posing a serious threat to the Jiangxi province of China’s pig production industry.
1. Introduction
According to the International Committee on Taxonomy of Viruses, porcine circoviruses (PCV) are categorized as members of the Circoviridae family of viruses [1]. The mature PCV virion has a tiny diameter of less than 20 nm, and is non-enveloped. The PCV genome is circular, single-stranded, and spherical, with a length of roughly 2000 nt [2]. There are currently four distinct PCV genotypes known: PCV1, PCV2, PCV3, and PCV4 [3]. PCV1, a cell-cultured virus with non-pathogenic effects, has been identified in both domestic and wild boar [4,5,6,7]. It is not yet apparent how PCV3 contributes to illness pathogenesis or whether disease-related damage can occur. Additionally, PCV3 has been found in a variety of animals, including wild boar and farmed pigs [8]. In both healthy and diarrheal pigs in 2019, the unique PCV genotype PCV4 was discovered for the first time [9,10,11,12,13]. But it is still unclear exactly how PCV4 causes disease [14]. Contrary to the other PCV genotypes, PCV2 harms domestic and wild pig alike through a number of syndromes such post-weaning multisystemic wasting syndrome (PMWS) and porcine-circovirus-associated disorders (PCV-associated diseases) [15,16,17]. Three main aspects make up the huge PCV2 flood. First, failure to vaccinate pigs with PCV2 leads to immune response suppression, which lowers overall production efficiency [18]. Second, it is extremely expensive to control and prevent PCV2 infection [19]. Third, compared to PCV2 negative pigs, the secondary infection rate was considerably greater in PCV2 positive pigs [20]. According to estimates, PCV2 has a 100 million yuan annual economic impact in China, which indicates that it may have a negative economic impact on intensive pig production [21]. Nine unique PCV2 genotypes have been identified to date (PCV2a, PCV2b, PCV2c, PCV2d, PCV2e, PCV2g, PCV2h, and PCV2i), indicating that the PCV2 genotype circulation has grown increasingly complicated and has likely replaced previously circulating strains with the new genotypes [22,23,24,25,26].
The circular genome of PCV2 and PCV3 is primarily composed of two open reading frames (ORF), with ORF1 encoding the rep protein involved in viral replication and ORF2 expressing the cap protein [20]. Infection with PCV2 or PCV3 is common in nations with a significant swine sector because of the high transmission potential of these viruses [27]. In numerous nations, including Spain, Germany, Italy, and South Korea, wild boar are susceptible to both PCV2 and PCV3 as well as other swine-associated viruses, according to previous literature [28,29,30,31].
Investigations into PCV2 epidemiology in China revealed that domestic pigs were infected with a variety of PCV2 genotypes. Additionally, it has been reported that wild boars in Italy are infected with PCV2 and PCV3, raising the possibility that wild boars may aid in the spread of these viruses to domestic pigs [10]. Additionally, Jiangxi province in China has never disclosed any information on virus transmission, specifically PCV circulation in wild boar. Therefore, 138 different organ samples were taken from wild boars to detect for PCV infection in order to better understand the role of wild boar in PCV transmission in the Jiangxi province. Further research was done on PCV2’s genetic diversity. This study primarily identified the PCV2b genotype of PCV2, which will give the swine sector crucial information to prevent PCV2 infection in the Jiangxi province of China.
2. Materials and Methods
2.1. Ethical Approval
Since no live animals were used in this study, our study did not require ethical approval. However, to avoid controversy, we still invited the Animal Ethics Committee of Jiangxi Agricultural University to supervise the collection of wild boar samples. All samples were provided by hunters with wild boar hunting licenses according to standard procedures. All wild boar samples were sent to primary processing for purification, and then transported to Jiangxi Provincial Key laboratory for Animal Science and Technology for storage in −80 °C.
2.2. Wild Boars Samples Collection Area
A total number of 138 samples from different wild boars, including 23 livers, 18 spleens, 35 kidneys, 10 brains, 36 lymphs, and 16 lungs, were collected from five different mountains in Ganzhou, Nanchang, Shangrao, Yichun, and JiAn in Jiangxi province between May and October 2020. In addition, to exclude the virus strain derived from the same positive animals, 138 tissue samples were collected from 138 different wild boars. The details of the number of samples showed in Figure 1 and Table 1.
2.3. Viral DNA Extraction
All collected samples were used for detection of porcine circovirus, including PCV1, PCV2, and PCV3, by using real-time PCR assays with Taqman probes. Samples of 25 mg each were used to extract viral DNA. Briefly, samples diluted with 5-fold phosphate-buffered saline (PBS; 0.1 M, pH = 7.4) and were freeze-thawed twice to release virus, then centrifuged at 12,000× g for 10 min at 4 °C. The supernatants were separated for the next virus DNA extraction using the TIANamp Virus DNA Isolation Kit (DP315, TIANGEN Biotechnology Co., Ltd., Nanjing, China) according to the manufacturer’s protocols. The extracted DNA was immediately stored until further experimentation.
2.4. Differential Detection of PCVs
Using TaqMan-based, real-time quantitative PCR to concurrently test and distinguish between porcine circovirus 1, 2, and 3. The probes from PCV1 and PCV2 were conjugated to FAM and VIC fluorescence signals, respectively, and the probe from PCV3 was conjugated to FAM. The sequence of primers and probes are shown in Table 2, and were synthesized by TSINGKE Biotech Beijing Co., Ltd. (Beijing, China). Each sample was searched with qPCR for the detection of PCV1/PCV2 and PCV3 in two separate wells in a plate. The 20 μL PCR reaction mix contained: 2 μL of viral DNA or control ddH2O, 10 μL of 2×T5 Fast qPCR Mix (TSINGKE Biotech Beijing Co., Ltd., Beijing, China), 0.3 μL of each probe (10 μM), and 0.5 μL of each primer (10 μM). The amplification procedure was 95 °C for 30 s, 40 cycles of 95 °C for 5 s, and 60 °C for 1 min. The fluorescence signal was registered at the end of each cycle of the 60 °C extension step. The cycle threshold (Ct) was determined based on the protocol phase of each reaction. A Ct value of less than 37 was positive.
2.5. Full Genome of PCV2 Amplification and Sequencing
Since PCV1 is non-pathogenic for pigs and the Ct value of PCV3 is too high with a weak positive result, we attempted to amplify the full length of PCV2 in this study. In order to obtain the complete genome sequence of PCV2, a pair of primers were first designed based on the referenced sequence (accession number: KY126314.1). The PCR protocol was performed in a 50 μL reaction volume: 25 μL 2× Rapid Taq Master Mix (Green Dye Plus, P222-01, Vazyme Biotechnology Co., Ltd., Nanjing, China), 3 μL template DNA, 1 μL each primer (10 mM), and 17 μL ddH2O up to a total of 50 μL. The PCR program was given as follows: pre-denaturation at 95 °C for 5 min and then amplified by 35 cycles of 95 °C for 30 s, annealing at 56 °C for 30 s and stretch at 72 °C for 90 s and a final stretch at 72 °C for 10 min. The purified PCR production was sub-cloned into pMD18T (TAKARA, Takara Biomedical Technology (Beijing) Co., Ltd. Beijing, China) and the positive clone was directly obtained from and sequenced by TSINGKE Biotech Beijing Co., Ltd.
2.6. Wild Boars PCV2 Sequence Alignment and Phylogenetic Analysis
In this study, 19 complete genomes of wild boar-derived PCV2 strains were successfully sequenced (Table 3). The complete genome sequences of PCV2 were edited and assembled using DNAstar software (DNAStar V7.1, Madison, WI, USA). MEGA 7.0 software was used to match PCV2 and reference strains entered into GenBank. Phylogenetic trees were also constructed using the neighbor joining method with bootstrap analysis of 1000 replicates in MEGA 7.0 software.
3. Results
3.1. Prevalence of PCVs in Wild Boars
All one hundred thirty-eight clinical samples from wild boars were examined for PCV1–PCV3 using a TaqMan-based qPCR test. According to findings in Table 4, the infection rates for PCV1, PCV2, and PCV3 were 30/138 (21.73%), 31/138 (22.46%), and 8/138 (5.79%), respectively. Ten samples had PCV1 and PCV2 co-infections (7.25%), while five samples had PCV2 and PC3 co-infections (3.62%), indicating that wild boar in Jiangxi province may have several PCVs co-infected.
We then looked at the PCV detection data in the various organs. According to findings in Table 5, 30 PCV1 positive specimens contained 16 lymph nodes, 7 lung nodes, 5 kidney nodes, and 2 spleen nodes; 31 PCV2 positive samples were 20 lymph nodes, 7 kidney nodes, 3 spleen nodes, and 1 lung; and 8 PCV3 positive specimens contained 5 lymph nodes and 3 kidney nodes. In the liver and brain tissue samples that were collected, we were unable to find any PCV.
3.2. Amplification of PCV2 Complete Genome
We tried to amplify the entire length of PCV2 in this investigation because PCV1 does not harm pigs and the Ct value of PCV3 was higher than 32. The samples (n = 22) with a Ct value less than 30 were chosen to amplify the PCV2 genome using conventional PCR in order to increase the amplification efficiency. A total of 19 out of 22 wild boar samples were effective in amplifying the PCV2 gene, as seen in Figure 2. The 19 PCV2 genomic segments were subsequently introduced into pMD18-T for further sequencing. The 1767 bp length sequences were all deposited in the NCBI gene repository. As indicated in Table 3, we obtained accession numbers MW889012–MW889030 for PCV2 strains JX2-2020–JX20–2020.
3.3. Genetic Analysis of PCV2
The genomes of all 19 strains were used to construct a phylogenetic tree, which also included 10 reference strains with genotypes (PCV2a–e) (Table 6). According to the findings, only one PCV2 strain belonged to PCV2d while 18 PCV2 strains belonged to PCV2b (Figure 3). The one genotype PCV2d JX11-2020 (MW889021) was in the same sub-branch as the cited strain TJ (AY181946), which was isolated in domestic pigs in 2002. The 18 genotype PCV2b strains were closed for the referenced strain HLJ20215 (MK347394), originating from domestic pigs isolated in 2015. A phylogenetic tree based on the ORF2 amino acids was further built to analyze the properties of PCV2 strains produced from wild boar in this study (Figure 4). A similar outcome to that of the entire genome based on the phylogenetic tree was seen in the phylogenetic tree based on the ORF2 amino acids, as shown in Figure 3. These findings reveal that PCV2-infected feral pigs are a significant potential danger to the pig production business in China since PCV2 strains recovered from feral pigs in this investigation were remarkably similar to PCV2 strains obtained from domestic pigs. Thus, limiting the population of feral pigs and avoiding direct contact between wild boar and domestic pigs should aid in limiting the spread of PCV2 among intensive pigs, thereby minimizing the financial loss of pig farms.
4. Discussion
This study looked at PCV1, PCV2, and PCV3 circulation in the Jiangxi wild boar population in China. The PCV infection in wild boar from Jiangxi province has never been described before. A number of studies have examined the prevalence of PCV2, PCV3, or PCV4 in China and shown that domestic pigs are carriers of PCVs [3]. Wild boar samples were gathered for the detection of medium prevalence PCV1/2/3. Our results, when compared to earlier research, revealed that the prevalence of PCV2 or PCV3 infection was far lower than in European nations like Italy or Sardinia [32]. The primary cause of PCVAD is PCV2. Numerous investigations have demonstrated that PCV2 was frequently clinically co-infected with other PCVs, such as PCV3 or PCV4, in domestic pigs [33,34]. Although 138 tissue samples from 138 animals with various organs were collected, this may not accurately represent the PCV infection rate. Our findings showed that lymph nodes had a greater rate of PCV infection detection than other organs. Previous research demonstrated that PCV infection seriously impairs the host’s immune system, including the lymphatic and renal systems. Additionally, finding PCV infection in discarded samples demonstrated that many domestic pig organs might be found to be contaminated with PCV [35,36].
The PCV2a genotype was initially discovered in Chinese pig herds. The PCV2a to PCV2d genotype switch occurred in 2003 [37]. Recently, PCV2d has emerged as the predominant genotype circulating in Chinese domestic pigs [38]. Following genetic analysis, we discovered that one PCV2 strain and 18 PCV2-infected strains belonged to the PCV2b and PCV2d genotypes, respectively. We are unable to amplify the PCV3 genome. Further research will be necessary to determine the prevalence and genotypes of PCV3 infection in wild boar. Identification of PCV2 strains with PCV2b and PCV2d genotypes using phylogenetic analysis. The frequency of PCV in wild boar in Jiangxi province as well as the genotypes of PCV2b and PCV2d in wild boar are thus described in this paper. Since the cap gene of PCV2 in this study’s cited two PCV2 strains from China was relatively stable, it is possible that the genotype of PCV2 infection in wild boars is related to that in domestic pigs. In addition, previous literature discovered that PCV2 strains could be transmitted between wild boars and domestic pigs in Italy [39]. MK347394 reference strain was taken from Heilongjiang province, which is although geographical distant from Jiangxi province. These results suggested that PCV2b might spread more widely between wild boars and domestic pigs. However, whether PCV2d will become the predominant strains in wild boars required further investigations. In addition, the more complex PCV2 genotypes in wild boar need to be studied next, since novel genotypes have so far been gradually discovered in farmed pigs in China.
Wild boar population is uncontrolled and can move freely. The wild boars to carry the new genotype PCV2d were first found in China. However, there has been no confirmed instance of wild boar to domestic pig PCV2d genotype transmission in China. Both pig agriculture and veterinarian public health may still be at risk from this possible spread. We are all aware that PCAD, or swine circovirus associated diseases, have been shown to significantly harm the swine production industry. China has the world’s largest pig producing business, which increases the economic cost of stopping PCV2 circulation there.
This study did have certain limits, though. First, because PCV2’s pathogenicity in wild boars is currently unclear, the samples were randomly collected, and the results showing PCV2 positivity cannot reflect PCV2’s pathogenicity. Second, the small number of samples from Jiangxi province limited the prevalence of PCVs in wild boars. Third, we are unable to collect wild boar PCV3 genotyping data. Therefore, additional extensive wild boar sample studies must be conducted in subsequent research.
5. Conclusions
Overall, this study demonstrates widespread PCV circulation, especially PCV2 in Jinagxi province’s wild boar population. According to our research, wild boars are very susceptible to contracting PCV2b and PCV2d, which poses a serious risk to domestic pigs. Since widespread PCV2 infection can substantially impair economic growth in the pig production business, the control of wild boar infected with PCV2 is vital for both the intensive pig farming industry and for public health in veterinary medicine.
Author Contributions
H.W. conceived this study. H.W. draft and edit the manuscript. X.H. and Y.L. performed PCVs detection and PCV2 amplification. Z.C. and Z.D. review and edit the manuscript. Q.Z. and T.W. prepared the wild samples and performed the viral DNA extraction. All authors have read and agreed to the published version of the manuscript.
Funding
This study was supported by grants from the Natural Science Foundation of Jiangxi Province (20202BABL215023), the Jiangxi Provincial Department of Education (GJJ190213) and the “Thousands of People Plan” talents in Jiangxi Province (jxsq2018102118).
Institutional Review Board Statement
All wild boars were hunted by professional hunters under the supervise of local laws. No animals were killed for the purpose of this study. This study was approved by the Committee on the Ethics of Animal Experiments of Jiangxi Agricultural University (JXAULL-202126).
Informed Consent Statement
Not applicable.
Data Availability Statement
All the data analyzed in this study are available from corresponding author.
Acknowledgments
All authors take great appreciate to all the licensed hunters for providing hunting wild boars.
Conflicts of Interest
All the authors declare no conflict of interest.
References
- Sibila, M.; Rocco, C.; Franzo, G.; Huerta, E.; Domingo, M.; Nunez, J.I.; Segales, J. Genotyping of Porcine Circovirus 2 (PCV-2) in Vaccinated Pigs Suffering from PCV-2-Systemic Disease between 2009 and 2020 in Spain. Pathogens 2021, 10, 1016. [Google Scholar] [CrossRef]
- Rakibuzzaman, A.; Pineyro, P.; Pillatzki, A.; Ramamoorthy, S. Harnessing the Genetic Plasticity of Porcine Circovirus Type 2 to Target Suicidal Replication. Viruses 2021, 13, 1676. [Google Scholar] [CrossRef]
- Chen, N.; Xiao, Y.; Li, X.; Li, S.; Xie, N.; Yan, X.; Li, X.; Zhu, J. Development and application of a quadruplex real-time PCR assay for differential detection of porcine circoviruses (PCV1 to PCV4) in Jiangsu province of China from 2016 to 2020. Transbound. Emerg. Dis. 2021, 68, 1615–1624. [Google Scholar] [CrossRef] [PubMed]
- Han, H.H.; Karkada, N.; Jayadeva, G.; Dubin, G. Serologic response to porcine circovirus type 1 (PCV1) in infants vaccinated with the human rotavirus vaccine, Rotarix: A retrospective laboratory analysis. Hum. Vaccines Immunother. 2017, 13, 237–244. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, H.; Shaheduzzaman, S.; Willliams, D.K.; Gao, Y.; Khan, A.S. Investigations of porcine circovirus type 1 (PCV1) in vaccine-related and other cell lines. Vaccine 2011, 29, 8429–8437. [Google Scholar] [CrossRef]
- An, D.J.; Song, D.S.; Park, J.Y.; Park, B.K. A DNA miniarray system for simultaneous visual detection of porcine circovirus type 1 (PCV1) and 2 (PCV2) in pigs. Vet. Res. Commun. 2009, 33, 139–147. [Google Scholar] [CrossRef] [PubMed]
- Csagola, A.; Kiss, I.; Tuboly, T. Detection and analysis of porcine circovirus type 1 in Hungarian wild boars: Short communication. Acta Vet. Hung. 2008, 56, 139–144. [Google Scholar] [CrossRef] [PubMed]
- Sirisereewan, C.; Thanawongnuwech, R.; Kedkovid, R. Current Understanding of the Pathogenesis of Porcine Circovirus 3. Pathogens 2022, 11, 64. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.H.; Hu, W.Q.; Li, J.Y.; Liu, T.N.; Zhou, J.Y.; Opriessnig, T.; Xiao, C.T. Novel circovirus species identified in farmed pigs designated as Porcine circovirus 4, Hunan province, China. Transbound. Emerg. Dis. 2020, 67, 1057–1061. [Google Scholar] [CrossRef]
- Sun, W.; Du, Q.; Han, Z.; Bi, J.; Lan, T.; Wang, W.; Zheng, M. Detection and genetic characterization of porcine circovirus 4 (PCV4) in Guangxi, China. Gene 2021, 773, 145384. [Google Scholar] [CrossRef]
- Nguyen, V.G.; Do, H.Q.; Huynh, T.M.; Park, Y.H.; Park, B.K.; Chung, H.C. Molecular-based detection, genetic characterization and phylogenetic analysis of porcine circovirus 4 from Korean domestic swine farms. Transbound. Emerg. Dis. 2022, 69, 538–548. [Google Scholar] [CrossRef]
- Franzo, G.; Ruiz, A.; Grassi, L.; Sibila, M.; Drigo, M.; Segales, J. Lack of Porcine circovirus 4 Genome Detection in Pig Samples from Italy and Spain. Pathogens 2020, 9, 433. [Google Scholar] [CrossRef]
- Tian, R.B.; Zhao, Y.; Cui, J.T.; Zheng, H.H.; Xu, T.; Hou, C.Y.; Wang, Z.Y.; Li, X.S.; Zheng, L.L.; Chen, H.Y. Molecular detection and phylogenetic analysis of Porcine circovirus 4 in Henan and Shanxi Provinces of China. Transbound. Emerg. Dis. 2021, 68, 276–282. [Google Scholar] [CrossRef]
- Niu, G.; Zhang, X.; Ji, W.; Chen, S.; Li, X.; Yang, L.; Zhang, L.; Ouyang, H.; Li, C.; Ren, L. Porcine circovirus 4 rescued from an infectious clone is replicable and pathogenic in vivo. Transbound. Emerg. Dis. 2022, 24, 1–10. [Google Scholar] [CrossRef]
- Molini, U.; Coetzee, L.M.; Hemberger, M.Y.; Khaiseb, S.; Cattoli, G.; Dundon, W.G.; Franzo, G. The Oryx Antelope (Oryx gazella): An Unexpected Host for Porcine Circovirus-2 (PCV-2). Pathogens 2021, 10, 1402. [Google Scholar] [CrossRef]
- Yu, W.; Sun, Y.; He, Q.; Sun, C.; Dong, T.; Zhang, L.; Zhan, Y.; Wang, N.; Yang, Y.; Sun, Y. Mitochondrial Localization Signal of Porcine Circovirus Type 2 Capsid Protein Plays a Critical Role in Cap-Induced Apoptosis. Vet. Sci. 2021, 8, 272. [Google Scholar] [CrossRef]
- Kang, S.J.; Bae, S.M.; Lee, H.J.; Jeong, Y.J.; Lee, M.A.; You, S.H.; Lee, H.S.; Hyun, B.H.; Lee, N.; Cha, S.H. Porcine Circovirus (PCV) Genotype 2d-Based Virus-like Particles (VLPs) Induced Broad Cross-Neutralizing Antibodies against Diverse Genotypes and Provided Protection in Dual-Challenge Infection of a PCV2d Virus and a Type 1 Porcine Reproductive and Respiratory Syndrome Virus (PRRSV). Pathogens 2021, 10, 1145. [Google Scholar]
- Um, H.; Yang, S.; Oh, T.; Cho, H.; Park, K.H.; Suh, J.; Chae, C. A field efficacy trial of a trivalent vaccine containing porcine circovirus type 2a and 2b, and Mycoplasma hyopneumoniae in three herds. Vet. Med. Sci. 2022, 8, 578–590. [Google Scholar] [CrossRef]
- Ariyama, N.; Aguero, B.; Valdes, V.; Berrios, F.; Bucarey, S.; Mor, S.; Brito, B.; Neira, V. Update of Genetic Diversity of Porcine Circovirus Type 2 in Chile Evidences the Emergence of PCV2d Genotype. Front. Vet. Sci. 2021, 8, 789491. [Google Scholar] [CrossRef]
- Feng, H.; Fu, J.; Zhang, B.; Xue, T.; Liu, C. A Novel Virus-Like Agent Originated From Genome Rearrangement of Porcine Circovirus Type 2 (PCV2) Enhances PCV2 Replication and Regulates Intracellular Redox Status In Vitro. Front. Cell. Infect. Microbiol. 2022, 12, 855920. [Google Scholar] [CrossRef]
- Jia, Y.; Zhu, Q.; Xu, T.; Chen, X.; Li, H.; Ma, M.; Zhang, Y.; He, Z.; Chen, H. Detection and genetic characteristics of porcine circovirus type 2 and 3 in Henan province of China. Mol. Cell. Probes 2022, 61, 101790. [Google Scholar] [CrossRef]
- Park, K.H.; Cho, H.; Oh, T.; Yang, S.; Chae, C. Multiplex polymerase chain reaction for the detection and differentiation of 4 porcine circovirus 2 genotypes (PCV-2a, -2b, -2d, and -2e) in clinical samples. Can. J. Vet. Res. 2022, 86, 153–156. [Google Scholar]
- Bao, F.; Mi, S.; Luo, Q.; Guo, H.; Tu, C.; Zhu, G.; Gong, W. Retrospective study of porcine circovirus type 2 infection reveals a novel genotype PCV2f. Transbound. Emerg. Dis. 2018, 65, 432–440. [Google Scholar] [CrossRef] [PubMed]
- Rajkhowa, T.K.; Lalnunthanga, P.; Rao, P.L.; Subbiah, M.; Lalrohlua, B. Emergence of porcine circovirus 2g (PCV2g) and evidence for recombination between genotypes 2g, 2b and 2d among field isolates from non-vaccinated pigs in Mizoram, India. Infect. Genet. Evol. 2021, 90, 104775. [Google Scholar] [CrossRef] [PubMed]
- Lv, Q.; Wang, T.; Deng, J.; Chen, Y.; Yan, Q.; Wang, D.; Zhu, Y. Genomic analysis of porcine circovirus type 2 from southern China. Vet. Med. Sci. 2020, 6, 875–889. [Google Scholar] [CrossRef]
- Wang, Y.; Noll, L.; Lu, N.; Porter, E.; Stoy, C.; Zheng, W.; Liu, X.; Peddireddi, L.; Niederwerder, M.; Bai, J. Genetic diversity and prevalence of porcine circovirus type 3 (PCV3) and type 2 (PCV2) in the Midwest of the USA during 2016–2018. Transbound. Emerg. Dis. 2020, 67, 1284–1294. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.; Lee, J.Y.; Oh, T.; Park, K.H.; Cho, H.; Suh, J.; Min, K.D.; Ham, H.J.; Chae, C. Comparative growth performance of 3 types of combination vaccines containing porcine circovirus 2 and Mycoplasma hyopneumoniae under field conditions. Can. J. Vet. Res. 2022, 86, 93–101. [Google Scholar]
- Park, K.H.; Oh, T.; Cho, H.; Yang, S.; Chae, C. The first isolation of porcine circovirus type 2e from a Korean pig. Arch. Virol. 2020, 165, 2927–2930. [Google Scholar] [CrossRef]
- Cho, H.; Kang, I.; Oh, T.; Yang, S.; Park, K.H.; Min, K.D.; Ham, H.J.; Chae, C. Comparative study of the virulence of 3 major Korean porcine circovirus type 2 genotypes (a, b, and d). Can. J. Vet. Re.s 2020, 84, 235–240. [Google Scholar]
- Klaumann, F.; Franzo, G.; Sohrmann, M.; Correa-Fiz, F.; Drigo, M.; Nunez, J.I.; Sibila, M.; Segales, J. Retrospective detection of Porcine circovirus 3 (PCV-3) in pig serum samples from Spain. Transbound. Emerg. Dis. 2018, 65, 1290–1296. [Google Scholar] [CrossRef] [Green Version]
- Reiner, G.; Bronnert, B.; Hohloch, C.; Reinacher, M.; Willems, H. Distribution of ORF2 and ORF3 genotypes of porcine circovirus type 2 (PCV-2) in wild boars and domestic pigs in Germany. Vet. Microbiol. 2011, 148, 372–376. [Google Scholar] [CrossRef] [Green Version]
- Dei Giudici, S.; Lo Presti, A.; Bonelli, P.; Angioi, P.P.; Sanna, G.; Zinellu, S.; Balzano, F.; Salis, F.; Ciccozzi, M.; Oggiano, A. Phylogenetic analysis of porcine circovirus type 2 in Sardinia, Italy, shows genotype 2d circulation among domestic pigs and wild boars. Infect. Genet. Evol. 2019, 71, 189–196. [Google Scholar] [CrossRef]
- Faccini, S.; Barbieri, I.; Gilioli, A.; Sala, G.; Gibelli, L.R.; Moreno, A.; Sacchi, C.; Rosignoli, C.; Franzini, G.; Nigrelli, A. Detection and genetic characterization of Porcine circovirus type 3 in Italy. Transbound. Emerg. Dis. 2017, 64, 1661–1664. [Google Scholar] [CrossRef]
- Feng, H.; Segales, J.; Wang, F.; Jin, Q.; Wang, A.; Zhang, G.; Franzo, G. Comprehensive Analysis of Codon Usage Patterns in Chinese Porcine Circoviruses Based on Their Major Protein-Coding Sequences. Viruses 2022, 14, 81. [Google Scholar] [CrossRef]
- Han, L.; Yuan, G.F.; Chen, S.J.; Dai, F.; Hou, L.S.; Fan, J.H.; Zuo, Y.Z. Porcine circovirus type 2 (PCV2) infection in Hebei Province from 2016 to 2019: A retrospective study. Arch. Virol. 2021, 166, 2159–2171. [Google Scholar] [CrossRef]
- Karuppannan, A.K.; Opriessnig, T. Porcine Circovirus Type 2 (PCV2) Vaccines in the Context of Current Molecular Epidemiology. Viruses 2017, 9, 99. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Noll, L.; Porter, E.; Stoy, C.; Dong, J.; Anderson, J.; Fu, J.; Pogranichniy, R.; Woodworth, J.; Peddireddi, L.; et al. Development of a differential multiplex real-time PCR assay for porcine circovirus type 2 (PCV2) genotypes PCV2a, PCV2b and PCV2d. J. Virol. Methods 2020, 286, 113971. [Google Scholar] [CrossRef]
- Qu, T.; Li, R.; Yan, M.; Luo, B.; Yang, T.; Yu, X. High prevalence of PCV2d in Hunan province, China: A retrospective analysis of samples collected from 2006 to 2016. Arch. Virol. 2018, 163, 1897–1906. [Google Scholar] [CrossRef]
- Fanelli, A.; Pellegrini, F.; Camero, M.; Catella, C.; Buonavoglia, D.; Fusco, G.; Martella, V.; Lanave, G. Genetic Diversity of Porcine Circovirus Types 2 and 3 inWild Boar in Italy. Animals 2022, 12, 953. [Google Scholar] [CrossRef]
Figure 1.
Regions with collected wild boar samples are marked with black dots in Jiangxi province of China.
Figure 1.
Regions with collected wild boar samples are marked with black dots in Jiangxi province of China.
Figure 2.
Partial PCV2 positive samples were used to amplify the complete genome of PCV2. The PCR products with about 2000 bp were separately by 1% agarose gel electrophoresis. M: DL2000 marker.
Figure 2.
Partial PCV2 positive samples were used to amplify the complete genome of PCV2. The PCR products with about 2000 bp were separately by 1% agarose gel electrophoresis. M: DL2000 marker.
Figure 3.
Phylogenetic tree based on the complete genome of all sequences (19 PCV2 sequences amplified in this study and 10 PCV2 reference sequences). The sequences obtained in this study were marked with black triangle. Phylogenetic tree was conducted by using the p-distance-based neighbor-joining (NJ) method with bootstrap analysis of 1000 replicates in MEGA 7.0 software.
Figure 3.
Phylogenetic tree based on the complete genome of all sequences (19 PCV2 sequences amplified in this study and 10 PCV2 reference sequences). The sequences obtained in this study were marked with black triangle. Phylogenetic tree was conducted by using the p-distance-based neighbor-joining (NJ) method with bootstrap analysis of 1000 replicates in MEGA 7.0 software.
Figure 4.
Phylogenetic tree based on the ORF2 amino acids of 19 PCV2 sequences amplified in this study and 10 PCV2 reference sequences). The sequences obtained in this study have been marked with a black square. The phylogenetic tree was performed using the p-distance-based neighbor joining (NJ) method with bootstrap analysis of 1000 replicates in MEGA 7.0 software.
Figure 4.
Phylogenetic tree based on the ORF2 amino acids of 19 PCV2 sequences amplified in this study and 10 PCV2 reference sequences). The sequences obtained in this study have been marked with a black square. The phylogenetic tree was performed using the p-distance-based neighbor joining (NJ) method with bootstrap analysis of 1000 replicates in MEGA 7.0 software.
Table 1.
Total number of harvesting wild boar samples in Jiangxi province.
| Shangrao | JiAn | Yichun | Ganzhou | Nanchang | Total |
|---|---|---|---|---|---|
| 12 | 65 | 32 | 12 | 17 | 138 |
Table 2.
Primers and probes the TaqMan detection assay used in this study.
| Assays | Primers /Probes | Sequences (5′-3′) | Genes | Amplicons |
|---|---|---|---|---|
| Duplex real-time PCR | PCV1F | AACCCCATAAGAGGTGGGTGTT | ORF1 | 129 bp |
| PCV1R | TTCTACCCTCTTCCAAACCTTCCT | |||
| PCV1-P | VIC-TCCGAGGAGGAGAAAAACAA AATACGGGA-BHQ1 | |||
| PCV2F | CTGAGTCTTTTTTATCACTTCGTAATGGT | ORF1-ORF2 | 146 bp | |
| PCV2R | ACTGCGTTCGAAAACAGTATATACGA | |||
| PCV2-P | FAM-TTAAGTGGGGGGTCTTTAAGATTA AATTC TCTGAATTGT-BHQ1 | |||
| Real-time PCR | PCV3F | ACTGCGTTCGAAAACAGTATATACGA | ORF2 | 111 bp |
| PCV3R | CATAAATGCTCCAAAGCAGTGCT | |||
| PCV3-P | VIC-ATATGTGTTGAGCCATGGGGTGGG TCT-BHQ1 | |||
| Traditional PCR | PCV2FF | TAATAAAAACCATTACGAAGTGATA | Full genome | 2000 bp |
| PCV2FR | GGTTTTTATTATTCATTAAGGGTTA |
Table 3.
The information of PCV2 strains obtained in this study.
| No. | Accession Number | Strains | Country | Year | Host | Length | Genotype | Organs |
|---|---|---|---|---|---|---|---|---|
| 1 | MW889012 | JX2-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | lymph node |
| 2 | MW889013 | JX3-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | lymph node |
| 3 | MW889014 | JX4-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | kidney |
| 4 | MW889015 | JX5-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | lymph node |
| 5 | MW889016 | JX6-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | lymph node |
| 6 | MW889017 | JX7-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | spleen |
| 7 | MW889018 | JX8-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | lymph node |
| 8 | MW889019 | JX9-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | lymph node |
| 9 | MW889020 | JX10-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | lymph node |
| 10 | MW889021 | JX11-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | lymph node |
| 11 | MW889022 | JX12-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | lymph node |
| 12 | MW889023 | JX13-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | lymph node |
| 13 | MW889024 | JX14-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | lymph node |
| 14 | MW889025 | JX15-2020 | China | 2020 | Wild boars | 1767 bp | PCV2d | lymph node |
| 15 | MW889026 | JX16-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | lymph node |
| 16 | MW889027 | JX17-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | lymph node |
| 17 | MW889028 | JX18-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | kidney |
| 18 | MW889029 | JX19-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | kidney |
| 19 | MW889030 | JX20-2020 | China | 2020 | Wild boars | 1767 bp | PCV2b | kidney |
Table 4.
Summary of PCVs detection in 138 wild boar samples.
| Porcine Circovirus Genotype | |||||
|---|---|---|---|---|---|
| PCV1 | PCV2 | PCV3 | PCV1 + PCV2 | PCV2 + PCV3 | |
| Positive (n) | 30 | 31 | 8 | 10 | 5 |
| Total (n) | 138 | 138 | 138 | 138 | 138 |
| Rate (%) | 21.73 | 22.46 | 5.79 | 7.25 | 3.62 |
Table 5.
Detection results of PCVs in different organs of wild boars.
| No. | Organ | 1 | 2 | 3 | No. | Organ | 1 | 2 | 3 | No. | Organ | 1 | 2 | 3 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | liver | − | − | − | 48 | lymph node | + | − | − | 94 | lung | + | − | − |
| 2 | kidney | − | + | + | 49 | kidney | − | + | − | 95 | kidney | − | − | − |
| 3 | spleen | − | + | − | 50 | lymph node | − | − | − | 96 | lung | − | − | − |
| 4 | brain | − | − | − | 51 | liver | − | − | − | 97 | kidney | − | − | − |
| 5 | lymph node | + | − | − | 52 | kidney | − | + | − | 98 | kidney | + | + | − |
| 6 | kidney | − | − | − | 53 | Liver | − | − | − | 99 | lung | − | − | − |
| 7 | kidney | − | − | − | 54 | lymph node | − | + | − | 100 | kidney | − | − | − |
| 8 | lung | + | − | − | 55 | kidney | − | − | − | 101 | brain | − | − | − |
| 9 | lung | − | − | − | 56 | liver | − | − | − | 102 | kidney | − | − | − |
| 10 | lung | + | − | − | 57 | liver | − | − | − | 103 | lung | + | − | − |
| 11 | spleen | − | − | − | 58 | brain | − | − | − | 104 | kidney | − | − | − |
| 12 | spleen | + | − | − | 59 | spleen | − | − | − | 105 | lymph node | + | − | − |
| 13 | spleen | − | − | − | 60 | lymph node | − | + | − | 106 | lung | − | − | − |
| 14 | kidney | − | − | − | 61 | spleen | − | − | − | 107 | lymph node | − | + | + |
| 15 | kidney | − | − | − | 62 | lymph node | + | + | − | 108 | lymph node | + | + | − |
| 17 | brain | − | − | − | 63 | spleen | − | − | − | 109 | lung | − | − | − |
| 18 | brain | − | − | − | 64 | kidney | − | − | − | 110 | lymph node | − | − | − |
| 19 | kidney | − | − | − | 65 | kidney | − | + | − | 111 | spleen | − | + | − |
| 20 | lymph node | − | + | − | 66 | brain | − | − | − | 112 | spleen node | − | − | − |
| 21 | lymph node | − | − | − | 67 | liver | − | − | − | 113 | lymph node | − | + | − |
| 22 | lymph node | − | − | − | 68 | lymph node | − | − | + | 114 | lymph node | − | − | − |
| 23 | kidney | + | − | − | 69 | lymph node | − | − | + | 115 | lung | − | − | − |
| 24 | kidney | − | − | − | 70 | liver | − | − | − | 116 | lymph node | + | − | − |
| 25 | spleen | − | − | − | 71 | kidney | − | − | − | 117 | spleen | − | − | − |
| 26 | brain | − | − | − | 72 | kidney | − | − | − | 118 | lung | − | − | − |
| 27 | spleen | + | − | − | 73 | lymph node | + | + | − | 119 | kidney | + | − | − |
| 28 | kidney | + | − | − | 74 | liver | − | − | − | 120 | spleen | + | − | − |
| 29 | spleen | − | − | − | 75 | kidney | − | − | + | 121 | liver | − | − | − |
| 30 | kidney | − | − | − | 76 | liver | − | − | − | 122 | brain | − | − | − |
| 31 | liver | − | − | − | 77 | lung | − | − | − | 123 | lymph node | − | + | − |
| 32 | liver | − | − | − | 78 | brain | − | − | − | 124 | liver | − | − | − |
| 33 | spleen | − | − | − | 79 | liver | − | − | − | 125 | lymph node | − | + | − |
| 34 | lymph node | + | − | − | 80 | kidney | − | − | − | 126 | liver | − | − | − |
| 35 | liver | − | − | − | 81 | kidney | + | − | − | 127 | liver | − | − | − |
| 36 | kidney | − | − | − | 82 | kidney | − | − | − | 128 | lymph node | − | + | − |
| 37 | lymph node | − | + | 83 | lymph node | + | + | − | 129 | liver | − | − | − | |
| 38 | lymph node | + | − | − | 84 | lung | − | − | − | 130 | spleen | − | − | − |
| 39 | kidney | − | − | − | 85 | lymph node | + | + | − | 131 | liver | − | − | − |
| 40 | lymph node | + | + | 86 | lung | − | − | − | 132 | spleen | − | + | − | |
| 41 | lymph node | + | − | − | 87 | lymph node | − | − | − | 133 | lymph node | − | − | − |
| 42 | kidney | − | − | − | 88 | lung | + | − | − | 134 | lymph node | − | + | + |
| 43 | lymph node | + | + | − | 89 | lymph node | + | + | − | 135 | liver | − | − | − |
| 44 | kidney | − | − | − | 90 | liver | − | − | − | 136 | spleen | − | − | − |
| 45 | lymph node | − | + | + | 91 | liver | − | − | − | 137 | kidney | − | + | − |
| 46 | kidney | − | − | − | 92 | kidney | − | + | + | 138 | liver | − | − | − |
| 47 | lymph node | + | + | − | 93 | lung | + | + | − |
1: PCV1; 2: PCV2; 3: PCV3.
Table 6.
The information of 22 referenced PCV2 strains.
| No. | Accession Number | Strains | Genotype | Country | Year | Host |
|---|---|---|---|---|---|---|
| 1 | GU049340 | 1010-Stoon | PCV2a | Cannada | 2007 | wild boar |
| 2 | MH663459 | HBBD1501 | PCV2a | China | 2015 | domestic pig |
| 3 | MK347400 | SD384F16 | PCV2a | China | 2016 | domestic pig |
| 4 | HQ713495 | 5-55004-7 | PCV2b | USA | 2005 | domestic pig |
| 5 | MK347394 | HLJ120215 | PCV2b | China | 2015 | domestic pig |
| 6 | EU148504 | DK1987PMWSfree | PCV2c | Denmark | 2007 | domestic pig |
| 7 | EF524517 | GS04 | PCV2d | China | 2007 | wild boar |
| 8 | AY181946 | TJ | PCV2d | China | 2002 | domestic pig |
| 9 | KT795287 | MEX-41238-2014 | PCV2e | Mexico | 2014 | wild boar |
| 10 | KT795290 | USA-45358-2015 | PCV2e | USA | 2015 | wild boar |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Hu, X.; Chen, Z.; Li, Y.; Ding, Z.; Zeng, Q.; Wan, T.; Wu, H. Detection of Porcine Circovirus 1/2/3 and Genetic Analysis of Porcine Circovirus 2 in Wild Boar from Jiangxi Province of China. Animals 2022, 12, 2021. https://doi.org/10.3390/ani12162021
AMA Style
Hu X, Chen Z, Li Y, Ding Z, Zeng Q, Wan T, Wu H. Detection of Porcine Circovirus 1/2/3 and Genetic Analysis of Porcine Circovirus 2 in Wild Boar from Jiangxi Province of China. Animals. 2022; 12(16):2021. https://doi.org/10.3390/ani12162021
Chicago/Turabian StyleHu, Xifeng, Zheng Chen, Yu Li, Zhen Ding, Qinghua Zeng, Tong Wan, and Huansheng Wu. 2022. "Detection of Porcine Circovirus 1/2/3 and Genetic Analysis of Porcine Circovirus 2 in Wild Boar from Jiangxi Province of China" Animals 12, no. 16: 2021. https://doi.org/10.3390/ani12162021
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
