Effects of Dietary Amylose—Amylopectin Ratio on Growth Performance and Intestinal Digestive and Absorptive Function in Weaned Piglet Response to Lipopolysaccharide
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design and Dietary Treatments
2.2. Sample Collection and Treatment
2.3. Intestinal Morphological Analysis
2.4. Intestinal Enzyme Activity Analysis
2.5. RNA Extraction and cDNA Synthesis
2.6. Real-Time PCR Quantification
2.7. Statistical Analyses
3. Results
3.1. Growth Performance
3.2. Intestinal Morphology
3.3. Jejunal Digestive Enzyme Activities
3.4. mRNA Relative Expression of Intestinal Nutrient Transporters
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Yin, F.; Yin, Y.; Zhang, Z.; Xie, M.; Huang, J.; Huang, R.; Li, T. Digestion rate of dietary starch affects the systemic circulation of lipid profiles and lipid metabolism-related gene expression in weaned pigs. Br. J. Nutr. 2011, 106, 369–377. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martens, B.M.; Gerrits, W.J.; Bruininx, E.M.; Schols, H.A. Amylopectin structure and crystallinity explains variation in digestion kinetics of starches across botanic sources in an in vitro pig model. J. Anim. Sci. Biotechnol. 2018, 9, 91. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, T.T.; Huang, Y.F.; Chiang, C.C.; Chung, T.K.; Chiou, P.W.-S.; Yu, B. Starch Characteristics and Their Influences on In Vitro and Pig Prececal Starch Digestion. J. Agric. Food Chem. 2011, 59, 7353–7359. [Google Scholar] [CrossRef] [PubMed]
- Saladrigas-García, M.; D’Angelo, M.; Ko, H.L.; Nolis, P.; Ramayo-Caldas, Y.; Folch, J.M.; Llonch, P.; Solà-Oriol, D.; Pérez, J.F.; Martín-Orúe, S.M. Understanding host-microbiota interactions in the commercial piglet around weaning. Sci. Rep. 2021, 11, 23488. [Google Scholar] [CrossRef]
- Gresse, R.; Chaucheyras-Durand, F.; Fleury, M.A.; Van de Wiele, T.; Forano, E.; Blanquet-Diot, S. Gut Microbiota Dysbiosis in Postweaning Piglets: Understanding the Keys to Health. Trends Microbiol. 2017, 25, 851–873. [Google Scholar] [CrossRef]
- Yang, H.; Xiong, X.; Wang, X.; Tan, B.; Li, T.; Yin, Y. Effects of Weaning on Intestinal Upper Villus Epithelial Cells of Piglets. PLoS ONE 2016, 11, e0150216. [Google Scholar] [CrossRef] [Green Version]
- Gao, X.; Yu, B.; Yu, J.; Mao, X.; Huang, Z.; Luo, Y.; Luo, J.; Zheng, P.; He, J.; Chen, D. Influences of dietary starch structure on intestinal morphology, barrier functions, and epithelium apoptosis in weaned pigs. Food Funct. 2020, 11, 4446–4455. [Google Scholar] [CrossRef]
- Lindberg, J.E.; Arvidsson, A.; Wang, J. Influence of naked barley cultivar with normal, amylose-rich or amylopectin-rich starch and enzyme supplementation on digestibility and piglet performance. Anim. Feed Sci. Tech. 2003, 104, 121–131. [Google Scholar] [CrossRef]
- Deng, J.; Wu, X.; Bin, S.; Li, T.J.; Huang, R.; Liu, Z.; Liu, Y.; Ruan, Z.; Deng, Z.; Hou, Y.; et al. Dietary amylose and amylopectin ratio and resistant starch content affects plasma glucose, lactic acid, hormone levels and protein synthesis in splanchnic tissues. J. Anim. Physiol. Anim. Nutr. 2010, 94, 220–226. [Google Scholar] [CrossRef]
- Yin, F.; Zhang, Z.; Huang, J.; Yin, Y. Digestion rate of dietary starch affects systemic circulation of amino acids in weaned pigs. Br. J. Nutr. 2010, 103, 1404–1412. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.H.; Ye, C.X.; Ye, J.D.; Shen, B.D.; Wang, C.Y.; Wang, A.L. Effects of dietary amylose/amylopectin ratio on growth performance, feed utilization, digestive enzymes, and postprandial metabolic responses in juvenile obscure puffer Takifugu obscurus. Fish Physiol. Biochem. 2014, 40, 1423–1436. [Google Scholar] [CrossRef] [PubMed]
- Pirgozliev, V.; Rose, S.; Bedford, M. The effect of amylose-amylopectin ratio in dietary starch on growth performance and gut morphology in broiler chickens. Arch. Geflugelkd. 2010, 74, S21–S29. [Google Scholar]
- Hedemann, M.S.; Knudsen, K.E.B. Resistant starch for weaning pigs—Effect on concentration of short chain fatty acids in digesta and intestinal morphology. Livest. Sci. 2007, 108, 175–177. [Google Scholar] [CrossRef]
- Woodward, A.D.; Regmi, P.R.; Gänzle, M.; van Kempen, T.A.T.G.; Zijlstra, R.T. Slowly digestible starch influences mRNA abundance of glucose and short-chain fatty acid transporters in the porcine distal intestinal tract. J. Anim. Sci. 2012, 90, 80–82. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jing, M.; Munyaka, P.M.; Tactacan, G.B.; Rodriguez-Lecompte, J.C.; House, J.D. Performance, serum biochemical responses, and gene expression of intestinal folate transporters of young and older laying hens in response to dietary folic acid supplementation and challenge with Escherichia coli lipopolysaccharide. Poult. Sci. 2014, 93, 122–131. [Google Scholar] [CrossRef] [PubMed]
- Heo, J.M.; Agyekum, A.K.; Yin, Y.L.; Rideout, T.C.; Nyachoti, C.M. Feeding a diet containing resistant potato starch influences gastrointestinal tract traits and growth performance of weaned pigs. J. Anim. Sci. 2014, 92, 3906–3913. [Google Scholar] [CrossRef]
- Klingbeil, E.A.; Cawthon, C.; Kirkland, R.; de La Serre, C.B. Potato-Resistant Starch Supplementation Improves Microbiota Dysbiosis, Inflammation, and Gut–Brain Signaling in High Fat-Fed Rats. Nutrients 2019, 11, 2710. [Google Scholar] [CrossRef] [Green Version]
- Council, N.R. Nutrient Requirements of Swine; National Academies Press: Washington, DC, USA, 2012. [Google Scholar]
- Yang, C.; Wang, M.; Tang, X.; Yang, H.; Li, F.; Wang, Y.; Li, J.; Yin, Y. Effect of Dietary Amylose/Amylopectin Ratio on Intestinal Health and Cecal Microbes’ Profiles of Weaned Pigs Undergoing Feed Transition or Challenged With Escherichia coli Lipopolysaccharide. Front. Microbiol. 2021, 12, 693839. [Google Scholar] [CrossRef]
- Zong, E.; Huang, P.; Zhang, W.; Li, J.; Li, Y.; Ding, X.; Xiong, X.; Yin, Y.; Yang, H. The effects of dietary sulfur amino acids on growth performance, intestinal morphology, enzyme activity, and nutrient transporters in weaning piglets. J. Anim. Sci. 2018, 96, 1130–1139. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.; Wang, Z.; Li, J.; Li, Y.; Huang, P.; Ding, X.; Yin, J.; He, S.; Yang, H.; Yin, Y. Dietary vitamin E affects small intestinal histomorphology, digestive enzyme activity, and the expression of nutrient transporters by inhibiting proliferation of intestinal epithelial cells within jejunum in weaned piglets. J. Anim. Sci. 2019, 97, 1212–1221. [Google Scholar] [CrossRef]
- Wang, L.; Zhu, F.; Yang, H.; Li, J.; Li, Y.; Ding, X.; Xiong, X.; Yin, Y. Effects of dietary supplementation with epidermal growth factor on nutrient digestibility, intestinal development and expression of nutrient transporters in early-weaned piglets. J. Anim. Physiol. Anim. Nutr. 2019, 103, 618–625. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.S.; Fu, D.Z.; Kong, X.F.; Wang, W.C.; Yang, X.J.; Nyachoti, C.M.; Yin, Y.L. Dietary supplementation with N-carbamylglutamate increases the expression of intestinal amino acid transporters in weaned Huanjiang mini-pig piglets. J. Anim. Sci. 2013, 91, 2740–2748. [Google Scholar] [CrossRef] [PubMed]
- Pirgozliev, V.; Rose, S.; Kettlewell, P.; Bedford, M. Relationship between chemical composition of wheat and broiler chicken growth performance. Brit. Poultry Sci. 2000, 41, S697–S698. [Google Scholar]
- van Erp, R.J.J.; de Vries, S.; van Kempen, T.A.T.G.; Gerrits, W.J.J. Pigs Ferment Enzymatically Digestible Starch when it Is Substituted for Resistant Starch. J. Nutr. 2019, 149, 1346–1353. [Google Scholar] [CrossRef]
- Li, Y.J.; Li, J.L.; Zhang, L.; Gao, F.; Zhou, G.H. Effects of dietary starch types on growth performance, meat quality and myofibre type of finishing pigs. Meat Sci. 2017, 131, 60–67. [Google Scholar] [CrossRef] [PubMed]
- Pluske, J.R.; Hampson, D.J.; Williams, I.H. Factors influencing the structure and function of the small intestine in the weaned pig: A review. Livest. Prod. Sci. 1997, 51, 215–236. [Google Scholar] [CrossRef]
- Fouhse, J.M.; Zijlstra, R.T. Impact of resistant vs. digested starch on starch energy value in the pig gut. Bioact. Carbohydr. Diet. Fibre 2018, 15, 12–20. [Google Scholar] [CrossRef]
- Adeola, O.; King, D.E. Developmental changes in morphometry of the small intestine and jejunal sucrase activity during the first nine weeks of postnatal growth in pigs. J. Anim. Sci. 2006, 84, 112–118. [Google Scholar] [CrossRef]
- Pluske, J.R.; Thompson, M.J.; Atwood, C.S.; Bird, P.H.; Williams, I.H.; Hartmann, P.E. Maintenance of villus height and crypt depth, and enhancement of disaccharide digestion and monosaccharide absorption, in piglets fed on cows’ whole milk after weaning. Br. J. Nutr. 1996, 76, 409–422. [Google Scholar] [CrossRef] [Green Version]
- Pluske, J.R.; Williams, I.H.; Aherne, F.X. Maintenance of villous height and crypt depth in piglets by providing continuous nutrition after weaning. Anim. Sci. 1996, 62, 131–144. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.; Yin, Y.; Tu, Q.; Yang, H. Glucose and amino acid in enterocyte: Absorption, metabolism and maturation. Front. Biosci. 2018, 23, 1721–1739. [Google Scholar]
- van Kempen, T.A.T.G.; Regmi, P.R.; Matte, J.J.; Zijlstra, R.T. In vitro starch digestion kinetics, corrected for estimated gastric emptying, predict portal glucose appearance in pigs. J. Nutr. 2010, 140, 1227–1233. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- van den Borne, J.J.G.C.; Schrama, J.W.; Heetkamp, M.J.W.; Verstegen, M.W.A.; Gerrits, W.J.J. Synchronising the availability of amino acids and glucose increases protein retention in pigs. Animal 2007, 1, 666–674. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van Der Meulen, J.; Bakker, J.G.M.; Smits, B.; De Visser, H. Effects of source of starch on net portal flux of glucose, lactate, volatile fatty acids and amino acids in the pig. Br. J. Nutr. 1997, 78, 533–544. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Genes | Primers | Sequences (5’-3’) | Size bp | GeneBank Accession No. |
---|---|---|---|---|
Slc2a2 | Forward | AAGTCGAGGCCTATGATCTGACTAA | 161 | NM_001097417.1 |
Reverse | GGAAGAGGCATATCAGGACTCTACT | |||
Slc5a1 | Forward | ATCTCTGTCATCGTCATCTAC | 121 | NM_001164021.1 |
Reverse | GCCACCACACCATACTTC | |||
Slc1a1 | Forward | GCTGTGCTGAAGAGAAGAA | 181 | NM_001164649.1 |
Reverse | GTGGCGGTGATACTGATAG | |||
Slc6a19 | Forward | CACAACAACTGCGAGAAG | 152 | XM_003359855.4 |
Reverse | TTGATAAGCGTCAGGATGT | |||
Slc7a1 | Forward | CCCCTGTGGTAGCGATGCAGTCA | 229 | NM_001012613.1 |
Reverse | CTGGGCTTCATAATGGTGTCAGGAT | |||
Slc7a9 | Forward | GAAGAAGCCTCCTAGAAGTG | 268 | NM_001110171.1 |
Reverse | CCAGTGTCGCAAGAATCC | |||
β-actin | Forward | AGTTGAAGGTGGTCTCGTGG | 216 | XM_003357928.4 |
Reverse | TGCGGGACATCAAGGAGAAG |
Item 2 | AAR | SEM | p-Value | ||||||
---|---|---|---|---|---|---|---|---|---|
0.00 | 0.20 | 0.40 | 0.60 | 0.80 | Total | Linear | Quadratic | ||
ADFI, g | |||||||||
WK1 | 273.53 | 305.70 | 273.08 | 254.95 | 278.23 | 8.87 | 0.52 | 0.47 | 0.77 |
WK2 | 354.31 | 384.30 | 357.45 | 378.60 | 412.95 | 16.76 | 0.82 | 0.36 | 0.60 |
WK3 | 484.41 | 420.11 | 474.97 | 472.03 | 496.07 | 18.29 | 0.76 | 0.72 | 0.68 |
WK4 | 675.84 | 705.67 | 630.80 | 620.64 | 653.11 | 20.01 | 0.68 | 0.20 | 0.30 |
Total | 502.34 | 475.50 | 464.63 | 453.39 | 480.58 | 15.01 | 0.90 | 0.44 | 0.41 |
ADG, g | |||||||||
WK1 | 117.86 | 143.45 | 92.21 | 105.36 | 96.10 | 6.27 | 0.05 | 0.09 | 0.24 |
WK2 | 148.75 | 122.22 | 161.00 | 186.36 | 233.00 | 13.18 | 0.08 | 0.02 | 0.03 |
WK3 | 239.38 | 197.92 | 247.40 | 198.75 | 180.73 | 13.33 | 0.44 | 0.32 | 0.85 |
WK4 | 445.71 a | 374.40 ab | 286.36 b | 420.13 a | 366.67 ab | 15.54 | 0.01 | 0.34 | 0.10 |
Total | 236.48 | 206.79 | 203.24 | 223.57 | 210.96 | 8.80 | 0.78 | 0.35 | 0.30 |
F/G | |||||||||
WK1 | 2.44 ab | 1.95 b | 3.00 a | 2.43 ab | 2.79 a | 0.11 | 0.02 | 0.09 | 0.25 |
WK2 | 2.70 a | 2.71 a | 2.71 a | 2.01 b | 1.92 b | 0.12 | 0.01 | 0.01 | 0.02 |
WK3 | 2.21 | 2.21 | 1.96 | 2.51 | 2.54 | 0.10 | 0.30 | 0.09 | 0.09 |
WK4 | 1.84 b | 2.07 b | 2.45 a | 1.92 b | 2.04 b | 0.06 | 0.03 | 0.82 | 0.20 |
Total | 2.11 | 2.36 | 2.36 | 2.16 | 2.37 | 0.05 | 0.24 | 0.45 | 0.63 |
Initial BW, g | 6.63 | 6.46 | 6.56 | 6.42 | 6.45 | 0.08 | 0.92 | 0.88 | 0.44 |
Final BW, g | 12.50 | 12.05 | 12.05 | 12.04 | 12.15 | 0.28 | 0.99 | 0.74 | 0.85 |
Item 2 | 0.00 | 0.20 | 0.40 | 0.60 | 0.80 | SEM | p-Value | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
LPS | SAL | LPS | SAL | LPS | SAL | LPS | SAL | LPS | SAL | AAR | LPS | AAR × LPS | L | Q | ||
Duodenum | ||||||||||||||||
VH, μm | 314.4 | 375 | 374.2 | 337.2 | 295.7 | 312.7 | 327.3 | 311.9 | 291.4 | 330.6 | 7.05 | 0.11 | 0.34 | 0.17 | 0.09 | 0.23 |
VW, μm | 117.3 b | 117.5 | 124.8 ab | 132.2 | 131 a | 124.3 | 125.5 ab | 135.6 | 116.3 b | 119.2 | 1.65 | 0.02 | 0.54 | 0.53 | 0.81 | <0.01 |
CD, μm | 412.7 | 424.1 | 360.1 | 431.3 | 421.1 | 357.2 | 419.9 | 428 | 382.7 | 356.5 | 8.96 | 0.16 | 0.79 | 0.12 | 0.12 | 0.28 |
VH/CD | 0.79 | 0.9 | 1.07 | 0.79 | 0.71 | 0.9 | 0.8 | 0.75 | 0.78 | 1.00 | 0.03 | 0.41 | 0.41 | 0.04 | 0.77 | 0.76 |
VSA, mm2 | 0.12 | 0.14 | 0.15 | 0.14 | 0.12 | 0.12 | 0.13 | 0.13 | 0.11 | 0.13 | <0.01 | 0.06 | 0.23 | 0.68 | 0.14 | 0.13 |
Jejunum | ||||||||||||||||
VH, μm | 295.3 | 341.3 | 321.6 | 344.5 | 299.6 | 315.8 | 344 | 344.6 | 318 | 310.2 | 5.11 | 0.17 | 0.14 | 0.48 | 0.78 | 0.63 |
VW, μm | 108.4 | 123.5 | 119.1 | 124.9 | 117.2 | 116.2 | 119.4 | 114.7 | 110.1 | 109.1 | 1.64 | 0.28 | 0.4 | 0.31 | 0.12 | 0.06 |
CD, μm | 250.3 | 315.9 | 264 | 279.3 | 276.6 | 283.3 | 281.4 | 293.5 | 277.3 | 282.1 | 5.61 | 0.94 | 0.07 | 0.35 | 0.68 | 0.91 |
VH/CD | 1.2 | 1.12 | 1.22 | 1.24 | 1.11 | 1.13 | 1.24 | 1.19 | 1.15 | 1.12 | 0.03 | 0.2 | 0.12 | 0.15 | 0.52 | 0.21 |
VSA, mm2 | 0.1 | 0.13 | 0.12 | 0.14 | 0.11 | 0.12 | 0.13 | 0.12 | 0.11 | 0.11 | <0.01 | 0.77 | 0.68 | 0.98 | 0.53 | 0.36 |
Ileum | ||||||||||||||||
VH, μm | 264.6 | 250.3 | 256.7 | 290.5 | 238.2 | 275.9 | 265.9 | 262.7 | 225 | 252.9 | 5.76 | 0.43 | 0.16 | 0.51 | 0.23 | 0.25 |
VW, μm | 108.7 b | 116.2 | 113.2 ab | 126.3 | 106.1 b | 115.5 | 116.2 a | 141.8 | 113 ab | 116.6 | 1.6 | 0.01 | <0.01 | 0.26 | 0.3 | 0.36 |
CD, μm | 252.2 | 260.6 | 264.3 | 252 | 256.9 | 252 | 255.1 | 233.8 | 247.8 | 253.8 | 5.04 | 0.92 | 0.64 | 0.87 | 0.49 | 0.79 |
VH/CD | 1.05 | 0.96 | 0.98 | 1.16 | 0.93 | 1.12 | 1.06 | 1.14 | 0.9 | 1 | 0.02 | 0.17 | <0.01 | 0.82 | 0.56 | 0.28 |
VSA, mm2 | 0.09 | 0.1 | 0.09 | 0.11 | 0.08 | 0.1 | 0.1 | 0.12 | 0.08 | 0.09 | <0.01 | 0.29 | 0.05 | 0.34 | 0.65 | 0.47 |
Item 2 | 0.00 | 0.20 | 0.40 | 0.60 | 0.80 | SEM | p-Value | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
LPS | SAL | LPS | SAL | LPS | SAL | LPS | SAL | LPS | SAL | AAR | LPS | AAR × LPS | L | Q | ||
Maltase, U/mgprot | 144.3 bc | 236.9 | 88.7 c | 166.4 | 217.4 b | 199.1 | 281.6 a | 289.9 | 141.0 bc | 312.4 | 9.7 | <0.01 | <0.01 | 0.03 | <0.01 | 0.02 |
Sucrase, U/mgprot | 16.3 ab | 30.2 | 11.4 b | 25.9 | 11.7 b | 20.2 | 25.8 a | 33.9 | 13.4 b | 19.2 | 1.3 | 0.01 | <0.01 | 0.81 | 0.83 | 0.88 |
Lactase, U/gprot | 9.9 | 15.7 | 6.1 | 5.1 | 6.4 | 6.0 | 10.4 | 10.9 | 10.9 | 11.9 | 0.9 | 0.07 | 0.11 | 0.59 | 0.51 | 0.04 |
ALP, U/mgprot | 108.7 | 151.7 | 56.5 | 143.8 | 74.1 | 117.3 | 62.7 | 99.2 | 70.6 | 170.3 | 6.3 | 0.14 | <0.01 | 0.39 | 0.56 | 0.53 |
Item 2 | 0.00 | 0.20 | 0.40 | 0.60 | 0.80 | SEM | p-Value | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
LPS | SAL | LPS | SAL | LPS | SAL | LPS | SAL | LPS | SAL | AAR | LPS | AAR × LPS | L | Q | ||
Jejunum | ||||||||||||||||
Slc5a1 | 1.00 | 1.09 | 0.96 | 1.09 | 0.81 | 0.69 | 0.69 | 0.78 | 0.49 | 1.13 | 0.08 | 0.52 | 0.27 | 0.61 | 0.10 | 0.20 |
Slc2a2 | 0.93 | 1.05 | 1.11 | 1.11 | 0.98 | 0.59 | 0.58 | 0.94 | 0.70 | 0.96 | 0.04 | 0.07 | 0.42 | 0.04 | 0.04 | 0.10 |
Slc1a1 | 0.87 | 1.13 | 1.28 | 1.24 | 0.96 | 1.19 | 1.39 | 0.82 | 0.85 | 1.41 | 0.07 | 0.83 | 0.54 | 0.14 | 0.95 | 0.89 |
Slc6a19 | 0.92 a | 1.04 | 1.21 a | 0.75 | 1.11 a | 0.85 | 0.59 b | 0.52 | 0.79 a,b | 0.80 | 0.04 | <0.01 | 0.13 | 0.25 | 0.02 | 0.05 |
Slc7a1 | 0.95 a,b | 1.05 | 1.18 a | 0.29 | 0.96 a,b | 0.77 | 0.55 b | 0.42 | 0.62 b | 0.70 | 0.05 | 0.02 | 0.04 | 0.03 | 0.01 | 0.04 |
Slc7a9 | 0.88 | 1.08 | 0.89 | 0.85 | 0.98 | 0.98 | 0.85 | 0.73 | 0.62 | 0.90 | 0.05 | 0.43 | 0.51 | 0.66 | 0.08 | 0.18 |
Ileum | ||||||||||||||||
Slc5a1 | 1.03 a | 0.93 | 0.80 a | 1.57 | 0.69 b | 0.53 | 0.53 b | 0.72 | 0.36 c | 0.56 | 0.04 | <0.01 | 0.02 | <0.01 | 0.12 | 0.08 |
Slc2a2 | 1.09 a | 1.75 | 0.63 a,b | 0.99 | 0.37 b | 0.92 | 0.54 a,b | 0.98 | 0.86 a,b | 1.00 | 0.07 | 0.01 | <0.01 | 0.81 | 0.07 | 0.17 |
Slc1a1 | 1.03 | 0.88 | 0.86 | 1.63 | 0.79 | 0.74 | 0.76 | 1.06 | 0.78 | 0.88 | 0.06 | 0.15 | 0.10 | 0.16 | <0.01 | <0.01 |
Slc6a19 | 1.01 | 0.96 | 0.90 | 1.38 | 1.70 | 1.35 | 1.28 | 1.57 | 1.05 | 1.52 | 0.08 | 0.27 | 0.33 | 0.46 | <0.01 | <0.01 |
Slc7a1 | 1.10 b | 1.10 | 1.39 b | 0.91 | 2.26 a | 1.82 | 2.52 a | 1.99 | 1.88 a,b | 2.22 | 0.12 | <0.01 | 0.34 | 0.68 | 0.26 | 0.53 |
Slc7a9 | 1.05 a,b | 0.88 | 1.50 a | 1.55 | 0.89 b | 0.96 | 0.60 b | 0.91 | 0.80 b | 0.94 | 0.07 | 0.02 | 0.54 | 0.84 | 0.12 | <0.01 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, M.; Yang, C.; Wang, Q.; Li, J.; Li, Y.; Ding, X.; Huang, P.; Yang, H.; Yin, Y. Effects of Dietary Amylose—Amylopectin Ratio on Growth Performance and Intestinal Digestive and Absorptive Function in Weaned Piglet Response to Lipopolysaccharide. Animals 2022, 12, 1833. https://doi.org/10.3390/ani12141833
Wang M, Yang C, Wang Q, Li J, Li Y, Ding X, Huang P, Yang H, Yin Y. Effects of Dietary Amylose—Amylopectin Ratio on Growth Performance and Intestinal Digestive and Absorptive Function in Weaned Piglet Response to Lipopolysaccharide. Animals. 2022; 12(14):1833. https://doi.org/10.3390/ani12141833
Chicago/Turabian StyleWang, Min, Can Yang, Qiye Wang, Jianzhong Li, Yali Li, Xueqin Ding, Pengfei Huang, Huansheng Yang, and Yulong Yin. 2022. "Effects of Dietary Amylose—Amylopectin Ratio on Growth Performance and Intestinal Digestive and Absorptive Function in Weaned Piglet Response to Lipopolysaccharide" Animals 12, no. 14: 1833. https://doi.org/10.3390/ani12141833