The Impact of Whole Sesame Seeds on the Expression of Key-Genes Involved in the Innate Immunity of Dairy Goats
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Diets
2.2. Feed Sample Analyses
2.3. Blood Samples
2.3.1. Blood Sample Collection for Neutrophil Isolation
2.3.2. Cell Isolation
2.3.3. RNA Extraction
2.3.4. cDNA Synthesis
2.3.5. Primers
2.3.6. Real-Time Quantitative PCR
2.3.7. Normalization
2.3.8. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Calder, P.C.; Bosco, N.; Bourdet-Sicard, R.; Capuron, L.; Delzenne, N.; Doré, J.; Franceschi, C.; Lehtinen, M.J.; Recker, T.; Salvioli, S.; et al. Health relevance of the modification of low grade inflammation in ageing (inflammageing) and the role of nutrition. Ageing Res. Rev. 2017, 40, 95–119. [Google Scholar] [CrossRef] [PubMed]
- Bannenberg, G.; Serhan, C.N. Specialized pro-resolving lipid mediators in the inflammatory response: An update. Biochim. Biophys. Acta. 2010, 1801, 1260–1273. [Google Scholar] [CrossRef] [Green Version]
- Senftleber, N.K.; Nielsen, S.M.; Andersen, J.R.; Bliddal, H.; Tarp, S.; Lauritzen, L.; Furst, D.E.; Suarez-Almazor, M.E.; Lyddiatt, A.; Christensen, R. Marine Oil Supplements for Arthritis Pain: A Systematic Review and Meta-Analysis of Randomized Trials. Nutrients 2017, 9, 42. [Google Scholar] [CrossRef] [PubMed]
- Ramsden, C.E.; Ringel, A.; Feldstein, A.E.; Taha, A.Y.; MacIntosh, B.A.; Hibbeln, J.R.; Majchrzak-Hong, S.F.; Faurot, K.R.; Rapoport, S.I.; Cheon, Y.; et al. Lowering dietary linoleic acid reduces bioactive oxidized linoleic acid metabolites in humans. Prostaglandins Leukot. Essent Fatty Acids 2012, 87, 135–141. [Google Scholar] [CrossRef] [Green Version]
- Ilich, J.Z.; Kelly, O.J.; Kim, Y.; Spicer, M.T. Low-grade chronic inflammation perpetuated by modern diet as a promoter of obesity and osteoporosis. Arh. Hig. Rada Toksikol. 2014, 65, 139–148. [Google Scholar] [CrossRef] [Green Version]
- Shrestha, N.; Cuffe, J.S.; Holland, O.J.; Bulmer, A.C.; Hill, M.; Perkins, A.V.; Muhlhausler, B.S.; McAinch, A.J.; Hryciw, D.H. Elevated maternal linoleic acid reduces circulating leptin concentrations, cholesterol levels and male fetal survival in rat model. J. Physiol. 2019, 597, 3349–3361. [Google Scholar] [CrossRef] [PubMed]
- Marchix, J.; Choque, B.; Kouba, M.; Fautrel, A.; Catheline, D.; Legrand, P. Excessive dietary linoleic acid induces proinflammatory markers in rats. J. Nutr. Biochem. 2015, 12, 1434–1441. [Google Scholar] [CrossRef] [PubMed]
- Froyen, E.; Burns-Whitmore, B. The Effects of Linoleic Acid Consumption on Lipid Risk Markers for Cardiovascular Disease in Healthy Individuals: A Review of Human Intervention Trials. Nutrients 2020, 12, 2329. [Google Scholar] [CrossRef]
- Chowdhury, R.; Warnakula, S.; Kunutsor, S.; Crowe, F.; Ward, H.A.; Johnson, L.; Franco, O.H.; Butterworth, A.S.; Forouhi, N.G.; Thompson, S.G.; et al. Association of dietary, circulating, and supplement fatty acids with coronary risk: A systematic review and meta-analysis. Ann. Intern. Med. 2014, 160, 398–406. [Google Scholar] [CrossRef]
- Hooper, L.; Al-Khudairy, L.; Abdelhamid, A.S.; Rees, K.; Brainard, J.S.; Brown, T.J.; Ajabnoor, S.M.; O’Brien, A.T.; Winstanley, L.E.; Donaldson, D.H.; et al. Omega-6 fats for the primary and secondary prevention of cardiovascular disease. Cochrane Database Syst. Rev. 2018, 7. [Google Scholar] [CrossRef]
- Hansen, R. Sesame Profile. Available online: http://www.agmrc.org/commodities__products/grains__oilseeds/sesame_profile (accessed on 19 August 2011).
- Khorrami, S.; Daneshmandi, S.; Mosayeb, G. Sesame seeds essential oil and Sesamol modulate the pro-inflammatory function of macrophages and dendritic cells and promote Th2 response. Med. J. Islam Repub. Iran. 2018, 32, 566–573. [Google Scholar] [CrossRef]
- Wu, M.S.; Aquino, L.; Barbaza, M.; Hsieh, C.L.; Castro-Cruz, K.A.; Yang, L.L.; Tsai, P.W. Anti-Inflammatory and Anticancer Properties of Bioactive Compounds from Sesamum indicum L.-A Review. Molecules 2019, 24, 4426. [Google Scholar] [CrossRef] [Green Version]
- Udomruk, S.; Kaewmool, C.; Pothacharoen, P.; Phitak, T.; Kongtawelert, P. Sesamin suppresses LPS-induced microglial activation via regulation of TLR4 expression. J. Funct. Foods 2018, 49, 32–43. [Google Scholar] [CrossRef]
- Jeng, K.C.; Hou, R.C.; Wang, J.C.; Ping, L.I. Sesamin inhibits lipopolysaccharide-induced cytokine production by suppression of p38 mitogen-activated protein kinase and nuclear factor-κB. Immunol. Lett. 2005, 97, 101–106. [Google Scholar] [CrossRef] [PubMed]
- Katayama, S.; Sugiyama, H.; Kushimoto, S.; Uchiyama, Y.; Hirano, M.; Nakamura, S. Effects of Sesaminol Feeding on Brain Aβ Accumulation in a Senescence-Accelerated Mouse-Prone 8. J. Agric. Food Chem. 2016, 64, 4908–4913. [Google Scholar] [CrossRef] [PubMed]
- Messaoudi, I.; Estep, R.; Robinson, B.; Wong, S.W. Nonhuman Primate Models of Human Immunology. Antioxid. Redox Signal. 2011, 14, 261–273. [Google Scholar] [CrossRef] [Green Version]
- Rosales, C.; Demaurex, N.; Lowell, C.A.; Uribe-Querol, E. Neutrophils: Their Role in Innate and Adaptive Immunity. J. Immunol. Res. 2016, 2016, 1469780. [Google Scholar] [CrossRef]
- Kawasaki, T.; Kawai, T. Toll-Like Receptor Signaling Pathways. Front. Immunol. 2014, 5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Majewska, M.; Szczepanik, M. The role of Toll-like receptors (TLR) in innate and adaptive immune responses and their function in immune response regulation. Postepy. Hig. Med. Dosw. 2006, 60, 52–63. [Google Scholar]
- Huang, W.; Hung, M. Beyond NF-κB activation: Nuclear functions of IκB kinase α. J. Biomed. Sci. 2013, 20. [Google Scholar] [CrossRef] [Green Version]
- Roman-Blas, J.A.; Jimenez, S.A. NF-kappaB as a potential therapeutic target in osteoarthritis and rheumatoid arthritis. Osteoarthr. Cartil. 2006, 14, 839–848. [Google Scholar] [CrossRef] [Green Version]
- Cho, J.W.; Lee, K.S.; Kim, C.W. Curcumin attenuates the expression of IL-1beta, IL-6, and TNF-alpha as well as cyclin E in TNF-alpha-treated HaCaT cells; NF-κB and MAPKs as potential upstream targets. Int. J. Mol. Med. 2007, 19, 469–474. [Google Scholar] [CrossRef]
- Wong, S.W.; Kwon, M.J.; Choi, A.M.; Kim, H.P.; Nakahira, K.; Hwang, D.H. Fatty acids modulate toll-like receptor 4 activation through regulation of receptor dimerization and recruitment into lipid rafts in a reactive oxygen species-dependent manner. J. Biol. Chem. 2009, 284, 27384–27392. [Google Scholar] [CrossRef] [Green Version]
- Johnson, D.E.; O’Keefe, R.A.; Grandis, J.R. Targeting the IL-6/JAK/STAT3 signalling axis in cancer. Nat. Rev. Clin. Oncol. 2018, 15, 234–248. [Google Scholar] [CrossRef]
- Medzhitov, R. Toll-like receptors and innate immunity. Nat. Rev. Immunol. 2001, 1, 135–145. [Google Scholar] [CrossRef]
- Takeda, K.; Akira, S. Toll-like receptors in innate immunity. Int. Immunol. 2005, 17, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Takaoka, A.; Yanai, H.; Kondo, S.; Duncan, G.; Negishi, H.; Mizutani, T.; Kano, S.-I.; Honda, K.; Ohba, Y.; Mak, T.W.; et al. Integral role of IRF-5 in the gene induction programme activated by Toll-like receptors. Nature 2005, 434, 243–249. [Google Scholar] [CrossRef] [PubMed]
- Barton, G.M.; Kagan, J.C. A cell biological view of Toll-like receptor function: Regulation through compartmentalization. Nat. Rev. Immunol. 2009, 9, 535–542. [Google Scholar] [CrossRef]
- Xie, X.; Jin, J.; Zhu, L.; Jie, Z.; Li, Y.; Zhao, B.; Cheng, X.; Li, P.; Sun, S.-C. Cell type-specific function of TRAF2 and TRAF3 in regulating type I IFN induction. Cell Biosci. 2019, 9. [Google Scholar] [CrossRef] [PubMed]
- Hernandez, J.M.; Floyd, D.H.; Weilbaecher, K.N.; Green, P.L.; Boris-Lawrie, K. Multiple facets of junD gene expression are atypical among AP-1 family members. Oncogene 2008, 27, 4757–4767. [Google Scholar] [CrossRef] [Green Version]
- Schumacher, A.; Zenclussen, A.C. Effects of heme oxygenase-1 on innate and adaptive immune responses promoting pregnancy success and allograft tolerance. Front. Pharmacol. 2015, 5, 288. [Google Scholar] [CrossRef] [Green Version]
- National Research Council. Nutrient Requirements of Small Ruminants: Sheep, Goats, Cervids, and New World Camelids; The National Academies Press: Washington, DC, USA, 2007. [Google Scholar] [CrossRef]
- Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef]
- Tsiplakou, E.; Mavrommatis, A.; Skliros, D.; Sotirakoglou, K.; Flemetakis, E.; Zervas, G. The effects of dietary supplementation with rumen-protected amino acids on the expression of several genes involved in the immune system of dairy sheep. J. Anim. Physiol. Anim. Nutr. 2018, 102, 1437–1449. [Google Scholar] [CrossRef]
- Tsiplakou, E.; Mavrommatis, A.; Skliros, D.; Righi, F.; Flemetakis, E. The impact of rumen-protected amino acids on the expression of key- genes involved in the innate immunity of dairy sheep. PLoS ONE 2020, 15, e0233192. [Google Scholar] [CrossRef] [PubMed]
- Ramakers, C.; Ruijter, J.M.; Deprez, R.H.; Moorman, A.F. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 2003, 339, 62–66. [Google Scholar] [CrossRef]
- Vorachek, W.; Hugejiletu Bobe, G.; Hall, J. Reference gene selection for quantitative PCR studies in sheep neutrophils. Int. J. Mol. Sci. 2013, 14, 11484–11495. [Google Scholar] [CrossRef] [Green Version]
- Rosales, C.; Lowell, C.A.; Schnoor, M.; Uribe-Querol, E. Neutrophils: Their Role in Innate and Adaptive Immunity. J. Immunol. Res. 2017, 2017. [Google Scholar] [CrossRef]
- Wu, B.; Peisley, A.; Tetrault, D. Molecular imprinting as a signal activation mechanism of the viral RNA sensor RIG-I. Mol. Cell 2014, 55, 511–523. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, H.; Sun, S.C. Ubiquitin signaling immune responses. Cell Res. 2016, 26, 457–483. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Li, X.; Zhang, H.; Zhao, Z.; Peng, Z.; Wang, Z.; Liu, G.; Li, X. Non-Esterified Fatty Acids Over-Activate the TLR2/4-NF-Κb Signaling Pathway to Increase Inflammatory Cytokine Synthesis in Neutrophils from Ketotic Cows. Cell Physiol. Biochem. 2018, 48, 827–837. [Google Scholar] [CrossRef]
- Roldan-Montes, V.; Cardoso, D.F.; Hurtado-Lugo, N.A.; do Nascimento, A.V.; Santos, D.; Scalez, D.; de Freitas, A.C.; Herrera, A.C.; Albuquerque, L.G.; de Camargo, G.; et al. Polymorphisms in TLR4 Gene Associated with Somatic Cell Score in Water Buffaloes (Bubalus bubalis). Front. Vet. Sci. 2020, 7, 568249. [Google Scholar] [CrossRef] [PubMed]
- Calder, P.C. Fatty acids Long-chain fatty acids and inflammation. Proc. Nutr. Soc. 2012, 71, 274–289. [Google Scholar] [CrossRef] [Green Version]
- Akira, S.; Uematsu, S.; Takeuchi, O. Pathogen recognition and innate immunity. Cell 2006, 124, 783–801. [Google Scholar] [CrossRef] [Green Version]
- Ma, L.; Gong, X.; Kuang, G.; Jiang, R.; Chen, R.; Wan, J. Sesamin ameliorates lipopolysaccharide/d-galactosamine-induced fulminant hepatic failure by suppression of Toll-like receptor 4 signaling in mice. Biochem. Biophys. Res. Commun. 2015, 461, 230–236. [Google Scholar] [CrossRef]
- Harikumar, K.B.; Sung, B.; Tharakan, S.T.; Pandey, M.K.; Joy, B.; Guha, S.; Krishnan, S.; Aggarwal, B.B. Sesamin manifests chemopreventive effects through the suppression of NF-kappa B-regulated cell survival, proliferation, invasion, and angiogenic gene products. Mol. Cancer Res. 2010, 8, 751–761. [Google Scholar] [CrossRef] [Green Version]
- Selvarajan, K.; Narasimhulu, C.A.; Bapputty, R.; Parthasarathy, S. Anti-inflammatory and antioxidant activities of the nonlipid (aqueous) components of sesame oil: Potential use in atherosclerosis. J. Med. Food 2015, 18, 393–402. [Google Scholar] [CrossRef] [Green Version]
- Bulgari, O.; Dong, X.; Roca, A.L.; Caroli, A.M.; Loor, J.J. Innate immune responses induced by lipopolysaccharide and lipoteichoic acid in primary goat mammary epithelial cells. J. Anim. Sci. Biotechnol. 2017, 8, 29–38. [Google Scholar] [CrossRef]
- Rashidi, N.; Mirahmadian, M.; Jeddi-Tehrani, M.; Rezania, S.; Ghasemi, J.; Kazemnejad, S. Lipopolysaccharide and lipoteichoic acid-mediated pro-inflammatory cytokine production and modulation of TLR2, TLR4 and MyD88 expression in human endometrial cells. J. Reprod. Infertil. 2005, 16, 72–81. [Google Scholar]
- Wu, Z.; Li, F.; Liu, D.; Xue, H.; Zhao, X. Novel Type XII Staphylococcal cassette chromosome mec harboring a new cassette chromosome recombinase CcrC2. Antimicrob. Agents Chemother. 2015, 59, 7597–7601. [Google Scholar] [CrossRef] [Green Version]
- Qian, C.; Cao, X. Regulation of Toll-like receptor signaling pathways in innate immune responses. Ann. N. Y. Acad. Sci. 2012, 1283, 67–74. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.L.; Dong, C. MAP kinases in immune responses. Cell Mol. Immunol. 2005, 2, 20–27. [Google Scholar]
- Lim, M.X.; Png, C.W.; Tay, C.Y.; Teo, J.D.; Jiao, H.; Lehming, N.; Tan, K.S.; Zhang, Y. Differential regulation of proinflammatory cytokine expression by mitogen-activated protein kinases in macrophages in response to intestinal parasite infection. Infect. Immun. 2014, 82, 4789–4801. [Google Scholar] [CrossRef] [Green Version]
- Bachmann, M.F.; Wolint, P.; Walton, S.; Schwarz, K.; Oxenius, A. Differential role of IL-2R signaling for CD8+ T cell responses in acute and chronic viral infections. Eur. J. Immunol. 2007, 37, 1502–1512. [Google Scholar] [CrossRef]
- Scheller, J.; Chalaris, A.; Schmidt-Arras, D.; Rose-John, S. The pro-and anti-inflammatory properties of the cytokine inteleukin-6. Biochim. Biophys. Acta 2011, 1813, 878–888. [Google Scholar] [CrossRef] [Green Version]
- Deng, P.; Wang, C.; Chen, L.; Wang, C.; Du, Y.; Yan, X.; Chen, M.; Yang, G.; He, G. Sesamin induces cell cycle arrest and apoptosis through the inhibition of signal transducer and activator of transcription 3 signalling in human hepatocellular carcinoma cell line HepG2. Biol. Pharm. Bull. 2013, 36, 1540–1548. [Google Scholar] [CrossRef] [Green Version]
- Kong, X.; Ma, M.Z.; Zhang, Y.; Weng, M.Z.; Gong, W.; Guo, L.Q.; Zhang, J.X.; Wang, G.D.; Su, Q.; Quan, Z.W.; et al. Differentiation therapy: Sesamin as an effective agent in targeting cancer stem-like side population cells of human gallbladder carcinoma. BMC Complement. Altern Med. 2014, 14, 254. [Google Scholar] [CrossRef] [Green Version]
- Fanhchaksai, K.; Kodchakorn, K.; Pothacharoen, P.; Kongtawelert, P. Effect of sesamin against cytokine production from influenza type A H1N1-induced peripheral blood mononuclear cells: Computational and experimental studies. In Vitro Cell Dev. Biol. Anim. 2015, 52, 107–119. [Google Scholar] [CrossRef]
- Meier-Trummer, C.S.; Rehrauer, H.; Franchini, M.; Patrignani, A.; Wagner, U.; Ackermann, M. Malignant catarrhal fever of cattle is associated with low abundance of IL-2 transcript and a predominantly latent profile of ovine Herpesvirus 2 gene expression. PLoS ONE 2009, 4, 6265. [Google Scholar] [CrossRef] [PubMed]
- Russell, G.C.; Benavides, J.; Grant, D.M.; Todd, H.; Thomson, J.; Puri, V.; Nath, M.; Haig, D.M. Host gene expression changes in cattle infected with Alcelaphine herpesvirus 1. Virus Res. 2012, 169, 246–254. [Google Scholar] [CrossRef] [PubMed]
- Narasimhulu, C.A.; Selvarajan, K.; Litvinov, D.; Parthasarathy, S. Anti-atherosclerotic and anti-inflammatory actions of sesame oil. J. Med. Food 2015, 18, 11–20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, R.; Yu, Y.; Hu, S.; Zhang, J.; Yang, H.; Han, B.; Cheng, Y.; Luo, X. Sesamin ameliorates hepatic steatosis and inflammation in rats on a high-fat diet via LXRα and PPARα. Nutr. Res. 2016, 36, 1022–1030. [Google Scholar] [CrossRef] [PubMed]
- Cao, D.; Luo, J.; Chen, D.; Xu, H.; Shi, H.; Jing, X.; Zang, W. CD36 regulates lipopolysaccharide-induced signalling pathways and mediates the internalization of Escherichia coli in cooperation with TLR4 in goat mammary gland epithelial cells. Sci. Rep. 2016, 6, 23132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hacker, H.; Tseng, P.H.; Karin, M. Expanding TRAF function: TRAF3 as a tri-faced immune regulator. Nat. Rev. Immunol. 2011, 7, 457–468. [Google Scholar] [CrossRef]
- Yang, X.D.; Sun, S.C. Targeting signaling factors for degradation an emerging mechanism for TRAF functions. Immunol. Rev. 2015, 266, 56–71. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Javan, M.R.; Zamani, M.R.; Aslani, S.; Dargahi Abbasabad, G.; Beirami Khalaj, M.; Serati-Nouri, H. Cytokine Modulatory Effects of Sesamum Indicum Seeds Oil Ameliorate Mice with Experimental Autoimmune Encephalomyelitis. Arch. Asthma Allergy Immunol. 2017, 1, 86–93. [Google Scholar] [CrossRef] [Green Version]
- Faraji, F.; Hashemi, M.; Ghiasabadi, A.; Davoudian, S.; Talaie, A.; Ganji, A.; Mosayebi, G. Combination therapy with interferon beta-1a and sesame oil in multiple sclerosis. Complement. Ther. Med. 2019, 45, 275–279. [Google Scholar] [CrossRef]
- Gilbert, F.B.; Cunha, P.; Jensen, K.; Glass, E.J.; Foucras, G.; Robert-Granie, C.; Rupp, R.; Rainard, P. Differential response of bovine mammary epithelial cells to Staphylococcus aureus or Escherichia coli agonists of the innate immune system. Vet. Res. 2013, 44, 40. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, A.; Urban, J.F.; Anthony, R.M.; Sun, R.; Stiltz, J.; van Rooijen, N.; Wynn, T.A.; Gause, W.C.; Shea-Donohue, T. Th2 Cytokine-Induced Alterations in Intestinal Smooth Muscle Function Depend on Alternatively Activated Macrophages. Gastroenterology 2008, 135, 217–225. [Google Scholar] [CrossRef] [Green Version]
- Alhussien, M.; Manjari, P.; Sheikh, A.A.; Mohammed Seman, M.; Reddi, S.; Mohanty, A.K.; Dang, A.K. Immunological attributes of blood and milk neutrophils isolated from crossbred cows during different physiological conditions. Czech J. Anim. Sci. 2016, 61, 223–231. [Google Scholar] [CrossRef] [Green Version]
- Jarczak, J.; Kaba, J.; Reczyńska, D.; Bagnicka, E. Impaired expression of cytokines as a result of viral infections with an emphasis on small ruminant lentivirus infection in goats. Viruses 2016, 8, 186. [Google Scholar] [CrossRef] [PubMed]
- Machugh, D.E.; Taraktsoglou, M.; Killick, K.E.; Nalpas, N.C.; Browne, J.A.; De Park, S.; Magee, D.A. Pan-genomic analysis of bovine monocyte-derived macrophage gene expression in response to in vitro infection with Mycobacterium avium subspecies paratuberculosis. Vet. Res. 2012, 43, 25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Galvao, K.N.; Pighetti, G.M.; Cheong, S.H.; Nydam, D.V.; Gilbert, R.O. Association between interleukin-8 receptor-α (CXCR1) polymorphism and disease incidence, production, reproduction, and survival in Holstein cows. J. Dairy Sci. 2011, 94, 2083–2091. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- DeForge, L.E.; Preston, A.M.; Takeuchi, E.; Kenney, J.; Boxer, L.A.; Remick, D.G. Regulation of interleukin 8 gene expression by oxidant stress. J. Biol. Res. 1993, 268, 25568–25576. [Google Scholar]
- Lehrke, M.; Millington, S.C.; Lefterova, M.; Cumaranatunge, R.G.; Szapary, P.; Wilensky, R.; Rader, D.J.; Lazar, M.A.; Reilly, M.P. CXCL16 Is a Marker of Inflammation, Atherosclerosis, and Acute Coronary Syndromes in Humans. J. Am. Coll. Cardiol. 2007, 49, 442–449. [Google Scholar] [CrossRef] [Green Version]
- Shariat, S.Z.A.S.; Mostafavi, S.A.; Khakpour, F. Antioxidant effects of vitamins c and e on the low-density lipoprotein oxidation mediated by myeloperoxidase. Iran. Biomed. J. 2013, 17, 22–28. [Google Scholar] [CrossRef]
- Paine, A.; Eiz-Vesper, B.; Blasczyk, R.; Immenschuh, S. Signaling to heme oxygenase-1 and its anti-inflammatory therapeutic potential. Biochem. Pharmacol. 2010, 80, 1895–1903. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fukunaga, M.; Ohnishi, M.; Shiratsuchi, A.; Kawakami, T.; Takahashi, M.; Motomura, M.; Egusa, K.; Urasaki, T.; Inoue, A. Sesamin increases heme oxygenase-1 protein in RAW 264.7 macrophages through inhibiting its ubiquitination process. Eur. J. Pharmacol. 2014, 741, 214–221. [Google Scholar] [CrossRef]
- Carasi, P.; Racedo, S.M.; Jacquot, C.; Elie, A.M.; Serradell, M.L.; Urdaci, M.C. Enterococcus durans EP1 a Promising Anti-inflammatory Probiotic Able to Stimulate sIgA and to Increase Faecalibacterium prausnitzii Abundance. Front. Immunol. 2017, 8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, T.-S.; Chau, L.-Y. Heme oxygenase-1 mediates the anti-inflammatory effect of interleukin-10 in mice. Nat. Med. 2002, 8, 240–246. [Google Scholar] [CrossRef]
- Hock, T.D.; Liby, K.; Wright, M.M.; McConnell, S.; Schorpp-Kistner, M.; Ryan, T.M.; Agarwal, A. JunB and JunD regulate human heme oxygenase-1 gene expression in renal epithelial cells. J. Biol. Chem. 2007, 282, 6875–6886. [Google Scholar] [CrossRef] [Green Version]
- Raghunath, A.; Nagarajan, R.; Sundarraj, K.; Panneerselvam, L.; Perumal, E. Genome-wide identification and analysis of Nrf2 binding sites—Antioxidant response elements in zebrafish. Toxicol. Appl. Pharmacol. 2018, 360, 236–248. [Google Scholar] [CrossRef] [PubMed]
- Lawrence, T. The Nuclear Factor NF- B Pathway in Inflammation. Cold Spring Harbor. Perspect. Biol. 2009, 1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, B.; Yang, Y.; Chernishof, V.; Loo, R.R.O.; Jang, H.; Tahk, S.; Yang, R.; Mink, S.; Shultz, D.; Bellone, C.J.; et al. Proinflammatory Stimuli Induce IKKα-Mediated Phosphorylation of PIAS1 to Restrict Inflammation and Immunity. Cell 2007, 129, 903–914. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Daily Nutrients Intake (g/goat) | Diets (Forages and Concentrates) | ||
---|---|---|---|
CON 1 | WSS5 2 | WSS10 3 | |
Dry matter | 2028.4 | 2027.6 | 2035.6 |
Ash | 143.4 | 147.6 | 153.3 |
Ether extract | 44.7 | 72.7 | 100.9 |
Crude protein | 323.6 | 323.2 | 334.6 |
NDF 4 | 766.1 | 795.1 | 782.7 |
ADF 5 | 504.1 | 518.9 | 513.5 |
Daily Fatty Acids Intake (g/goat) | |||
C14:0 | 0.34 | 0.34 | 0.33 |
C15:0 | 0.13 | 0.14 | 0.14 |
C16:0 | 7.96 | 10.27 | 14.06 |
C16:1(n-7) | 0.25 | 0.29 | 0.34 |
C17:0 | 0.26 | 0.27 | 0.21 |
C18:0 | 1.70 | 2.52 | 4.48 |
C18:1(n-9) | 8.70 | 20.18 | 31.19 |
C18:2(n-6)c | 20.28 | 33.42 | 44.58 |
C20:0 | 0.15 | 0.22 | 0.34 |
C18:3(n-3) | 3.77 | 3.87 | 3.94 |
C20:2 | 0.10 | 0.09 | 0.10 |
C22:0 | 0.31 | 0.34 | 0.39 |
C23:0 | 0.10 | 0.10 | 0.10 |
C22:2 | 0.01 | 0.01 | 0.01 |
C20:5(n-3) | 0.04 | 0.04 | 0.04 |
C24:0 | 0.46 | 0.48 | 0.50 |
C24:1(n-9) | 0.14 | 0.14 | 0.14 |
Concentrates | |||
Total Antioxidant Capacity | CON 1 | WSS5 2 | WSS10 3 |
FRAP 6 (μM ascorbic acid/g DM) | 9.19 | 13.88 | 17.69 |
DPPH(% Inhibition) | 41.89 | 51.24 | 49.91 |
Total phenolic content | |||
Folin-Ciocalteu (mg GAE/g DM) | 63.12 | 94.30 | 126.03 |
Gene | Forward Primer 5′-3′ | Reverse Primer 5′-3′ | Ensemble |
---|---|---|---|
NLRC3 | CAACCTACTCCACGACCAGG | TGGATGAAGTTCCACTGCA | ENSG00000167984 |
TLR4 | ATGAACCACTCCACTCGCTC | TCTTGCTCCTTAGAGGCCGT | ENSG00000136869 |
NF-KB | AAGCTGTGGTGGAGGACTTG | ACAGAGTTACCCAAGCGGTC | ENSG00000109320 |
MYD88 | ACAGACAAACTATCGGCTGA | CACCTCTTCTCAATGAGTTCA | ENSG00000172936 |
MAPK1 | GCAACGACCACATCTGCTAC | AGGTTGGAAGGCTTGAGGTC | ENSG00000100030 |
IL1A | TCAAGCCCAGATCAGCACAT | TGATTGAGGGCGTCGTTCAG | ENSG00000115008 |
IL1B | TGGATAGCCCATGTGTGCTG | CAGAACACCACTTCTCGGCT | ENSG00000125538 |
TNFA | GGGAGACACAAACTAAGGGCT | AACCTGCAGTTCAGCTCCG | ENSG00000232810 |
TNFB | ACTCCCGAAGCCCTTCACCCG | GGCGGAGGAAGGCGCGGTCCG | ENSG00000226979 |
IL2 | AAATCCCGAGAACCTCAAGCT | TGTAGCGTTAACCTTGGGCA | ENSG00000109471 |
IL6 | CAGCAAGGAGACACTGGCAGA | TCCATCTTTTTCCTCCATTTTTGG | ENSG00000136244 |
STAT3 | CGCAATTAGGCAGAGCAACTG | CCCTGTATCAGAGACCATCCCA | ENSG00000168610 |
TRIF | GCACGTCTAGCCTGCTTAC | TTGCGGGCCCGCAGCATCT | ENSG00000127666 |
IRF3 | CCAGAGGCTGGGGCACTGCC | CCTTCGGGACCTCGCCGTCA | ENSG00000126456 |
IFNG | AAATTCCGGTGGATGATCTG | ACCATTACATTGATGCTCTCC | ENSG00000111537 |
TRAF3 | TAACTGCTGCATTCGCTCCA | GGAACACAAAGCTGGGGTTG | ENSG00000131323 |
IRF5 | ACATCCCCAGTGAGAAGCAG | ATGGCATACAGATCCTGGCC | ENSG00000128604 |
CCL5 | CAAGTGCTCCATGGCAGCAG | GTTGGCGCACACCTGACG | ENSG00000271503 |
IL8 | CCTGCTCTCTGCAGCTCTGTG | TGCATTGGCATCGAAGTTCTG | ENSG00000169429 |
CXCL16 | GTGCCTGTGTTGTCCCTCTT | GCTTGCACACCACGTAGAGT | ENSG00000161921 |
HO1 | GAGCTGACCCGAGAAGGTTT | AGACGGGGTTCTCCTTGTTG | ENSG00000100292 |
IL10 | CTGGGGGAGAAGCTGAAGAC | CTCTCTTCACCTGCTCCACC | ENSG00000136634 |
JUND | ACGCAGTTCCTCTTTCCCAA | CCAGCTGGTTTTGCTTGTGT | ENSG00000130522 |
CHUK | TGCAGGGAAAGAGGCAGAAA | GACCGAGCAGAACTCTGTGT | ENSG00000213341 |
GAPDH | AAAGCCATCACCATCTTCCA | ACCACGTACTCAGCACCTCAT | ENSG00000111640 |
YWHAZ | TGTTCTATTGTGCCTAGTACACTGT | CATCAAGACTCACTGCCTCCC | ENSG00000164924 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mitsiopoulou, C.; Sotirakoglou, K.; Skliros, D.; Flemetakis, E.; Tsiplakou, E. The Impact of Whole Sesame Seeds on the Expression of Key-Genes Involved in the Innate Immunity of Dairy Goats. Animals 2021, 11, 468. https://doi.org/10.3390/ani11020468
Mitsiopoulou C, Sotirakoglou K, Skliros D, Flemetakis E, Tsiplakou E. The Impact of Whole Sesame Seeds on the Expression of Key-Genes Involved in the Innate Immunity of Dairy Goats. Animals. 2021; 11(2):468. https://doi.org/10.3390/ani11020468
Chicago/Turabian StyleMitsiopoulou, Christina, Kyriaki Sotirakoglou, Dimitrios Skliros, Emmanouil Flemetakis, and Eleni Tsiplakou. 2021. "The Impact of Whole Sesame Seeds on the Expression of Key-Genes Involved in the Innate Immunity of Dairy Goats" Animals 11, no. 2: 468. https://doi.org/10.3390/ani11020468
APA StyleMitsiopoulou, C., Sotirakoglou, K., Skliros, D., Flemetakis, E., & Tsiplakou, E. (2021). The Impact of Whole Sesame Seeds on the Expression of Key-Genes Involved in the Innate Immunity of Dairy Goats. Animals, 11(2), 468. https://doi.org/10.3390/ani11020468