Next Article in Journal
Prenatal and Postnatal Nutrition Influence Pancreatic and Intestinal Carbohydrase Activities of Ruminants
Next Article in Special Issue
High-Fat Diet-Induced Trefoil Factor Family Member 2 (TFF2) to Counteract the Immune-Mediated Damage in Mice
Previous Article in Journal
Anti-Coccidial Effect of Rumex Nervosus Leaf Powder on Broiler Chickens Infected with Eimeria Tenella Oocyst
Previous Article in Special Issue
Molecular Evidence of Hemolivia mauritanica, Ehrlichia spp. and the Endosymbiont Candidatus Midichloria Mitochondrii in Hyalomma aegyptium Infesting Testudo graeca Tortoises from Doha, Qatar
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

Haemogregarines and Criteria for Identification

by
Saleh Al-Quraishy
1,
Fathy Abdel-Ghaffar
2,
Mohamed A. Dkhil
1,3 and
Rewaida Abdel-Gaber
1,2,*
1
Department of Zoology, College of Science, King Saud University, Riyadh 11451, Saudi Arabia
2
Zoology Department, Faculty of Science, Cairo University, Cairo 12613, Egypt
3
Department of Zoology and Entomology, Faculty of Science, Helwan University, Cairo 11795, Egypt
*
Author to whom correspondence should be addressed.
Animals 2021, 11(1), 170; https://doi.org/10.3390/ani11010170
Submission received: 27 November 2020 / Revised: 30 December 2020 / Accepted: 7 January 2021 / Published: 12 January 2021

Simple Summary

Taxonomic classification of haemogregarines belonging to Apicomplexa can become difficult when the information about the life cycle stages is not available. Using a self-reporting, we record different haemogregarine species infecting various animal categories and exploring the most systematic features for each life cycle stage. The keystone in the classification of any species of haemogregarines is related to the sporogonic cycle more than other stages of schizogony and gamogony. Molecular approaches are excellent tools that enabled the identification of apicomplexan parasites by clarifying their evolutionary relationships.

Abstract

Apicomplexa is a phylum that includes all parasitic protozoa sharing unique ultrastructural features. Haemogregarines are sophisticated apicomplexan blood parasites with an obligatory heteroxenous life cycle and haplohomophasic alternation of generations. Haemogregarines are common blood parasites of fish, amphibians, lizards, snakes, turtles, tortoises, crocodilians, birds, and mammals. Haemogregarine ultrastructure has been so far examined only for stages from the vertebrate host. PCR-based assays and the sequencing of the 18S rRNA gene are helpful methods to further characterize this parasite group. The proper classification for the haemogregarine complex is available with the criteria of generic and unique diagnosis of these parasites.

1. Introduction

Phylum Apicomplexa was described by Levine [1] to include parasitic protozoa sharing unique ultrastructural features known as the “apical complex” (Figure 1). Haemogregarines (Figure 2) are ubiquitous adeleorine apicomplexan protists inhabiting the blood cells of a variety of ectothermic and some endothermic vertebrates [2,3,4]. They have also an obligatory heteroxenous life cycle (Figure 3), where asexual multiplication occurs in the vertebrate host; while sexual reproduction occurs in the hematophagous invertebrate vector [5]. This family contains four genera, according to Levine [6]: Haemogregarina Danilewsky [7], Karyolysus Labbé [8], Hepatozoon Miller [9], and Cyrilia Lainson [10]. Barta [11] conducted a phylogenetic analysis of representative genera in phylum Apicomplexa using biological and morphological features to infer evolutionary relationships in this phylum among the widely recognized groups. The data showed that the biologically diverse Haemogregarinidae family should be divided into at least three families (as suggested by Mohammed and Mansour [12]), were family Haemogregarinidae, containing the genera Haemogregarina and Cyrilia; family Karyolysidae Wenyon [13], of the genus Karyolysus; and family Hepatozoidae Wenyon [13], of the genus Hepatozoon, since the four genera currently in the family do not constitute a monophyletic group. The picture is further complicated by evidence from a study by Petit et al. [14] of a new Brazilian toad haemogregarine parasite Haemolivia stellata.
It undergoes sporogonic development in its tick host’s gut wall and has a complex life cycle that resembles Karyolysus species much more than Hepatozoon, Haemogregarina, and Cyrilia species. Haemogregarines can be morphologically classified based on the developmental details of sporogonic phases of the parasite in the vector, which provide the main characters for classification, the morphology of gametocytes in the red blood cells, and an evaluation of the stages of development [15,16]. Although useful, this methodology is not sufficient for a taxonomic diagnosis [17,18] also the classical systematics has been problematic because of the variability to which morphological details are subjected [19]. Therefore, the use of molecular methods from blood or tissue samples [20,21,22], with appropriate molecular phylogeny study, became an essential adjunct to existing morphological and biological characters for use in the inference of evolutionary history relationships among haemoprotozoan parasites [23,24,25]. Molecular data has been carried out based using PCR assays targeting the nuclear 18s ribosomal RNA gene, which have been extensively applied to characterize hemoparasites DNA more fully in the absence of complete life cycles [26,27,28,29,30,31,32].
In the present critical review of the haemogregarines complex, the proper classification, the criteria of generic and unique diagnosis, and the cosmopolitan distribution of haemogregarines among the vertebrate and invertebrate hosts are examined because of their relevant characteristic and taxonomic revisions.

2. Materials and Methods

This review included all related published scientific articles from January 1901 to December 2020. This article was conducted by searching the electronic databases NCBI, ScienceDirect, Saudi digital library, and GenBank database, to check scientific articles and M.Sc./Ph.D. Thesis related to the research topic of this review. Studies published in the English language were only included and otherwise are excluded.
Relevant studies were reviewed through numerous steps. In the first step, target published articles were identified by using general related terms related to the morphological features, such as “Haemogregarines” and “Apicomplex”. The second step involved screening the resulting articles by using highly specific keywords of the generic features for stages in the life cycle of haemogregarines species, including “Merogony”, “Gamogony”, “Sporogony”, “Infective stages”, “Motile stage”, “Infection sites”, and “sporozoites”. The last step of the review focused on selected studies involving the use of molecular analysis for accurate taxonomic identification by using highly specific keywords, including “PCR”, “Genetic markers”, “Variable regions”, “18S rRNA”, and “Phylogenetic analysis”.
The obtained data were presented in tables and figures and were: Table 1 representing the characteristic features for the haemogregarines genera, Table 2, Table 3, Table 4, Table 5 and Table 6 showing haemogregarines species, the vertebrate host, site of the merogonic stage, the invertebrate vectors, site of gamogony and sporogonic stages, geographical locality for hosts, and the authors for publishing data, Table 7 with the primer sets used for the amplification and sequencing for the appropriate gene of 18S rRNA for haemogregarines, and Table 8 representing all the sequenced and deposited haemogregarines in the GenBank database until now.

3. Results and Discussion

In this review, the different stages of the apicomplexan life cycle were used to identify haemogregarines. However, in most cases, their assignment to one or another genus cannot be considered more than provisional. Accordingly, about 82 haemogregarines in 155 research articles were identified previously. Osimani [33] stated that the differences between the haemogregarines relied more on the host’s identity than the parasite’s characteristics. Mohammed and Mansour [12] reported that haemogregarines gamonts morphology does not provide generic identification with a reliable key. However, Telford et al. [34], and Herbert et al. [35] stated that the determination of generic haemogregarines should not be based exclusively on the gamonts’ form, the type of parasitized host cells, and their effect on the host and site merogony in host cells. While the most characteristic feature for the basic identification via the sporogonic stage.
The reviewed species belonged to the four genera within Hemogregarinidae (Table 1). Following the parsimony analysis in the phylogenetic study of the representative genera in phylum Apicomplexa performed by Siddall and Desser [36] primarily based on ultrastructural observations, it was concluded that the variations between the different haemogregarines genera are mainly reflected by the sporogony features. Besides, Dvořáková et al. [37] added that the host specificity, together with the haemogregarine’s careful morphological and biological analysis, is a sound criterion for accurate identification. These species are common in different animals as fish (Table 2), amphibians (Table 3), reptiles (Table 4, Table 5, Table 6 and Table 7), birds (Table 8), and mammals (Table 9).
In the schizogony (merogony) stage, haemogregarines are characterized by their considerable ability to invade and develop within different organs and cell types inside the vertebrate host (Table 2, Table 3, Table 4, Table 5, Table 6, Table 7, Table 8 and Table 9). Bray [127] proposed that haemogregarines with schizonts in the liver should be placed in the genus Hepatozoon. In contrast, those species that precede schizogony in other organs should belong to another genus as Haemogregarina or Karyolysus. However, only in the lung of the river turtle, Trionyx gangeticus infected with Haemogregarina gangetica, was described by Misra [87]. In addition to the usual location of merogonic development in the liver, lung, and spleen, Ball et al. [71] have found certain merogonic stages in the highly infected snakes’ brain and heart. Siddall and Desser [84] described merogonic stages in the lacunar endothelial cells of the circulatory system of the leech and its proboscis, besides the liver, lung, and spleen in the turtle. Yanai et al. [128] also described nodular lesions containing schizonts and merozoites of Hepatozoon sp. of the heart’s martens, perisplenic, and perirenal adipose tissues, the diaphragm, mesentery, and tongue. Úngari et al. [102] reported that the genus Haemogregarina underwent schizogony in the circulating blood cells as in turtles and fish, and the genus Hepatozoon underwent schizogony in the liver. Additionally, there are two morphologically different meronts were the micro- and macromeronts. The presence of these two forms of meronts was mentioned to be a fundamental feature of the whole haemogregarine [74,129,130].
Gametocytes are usually the only stages of the parasite detected by scientists. Their morphology, unfortunately, does not provide a reliable clue to the generic differentiation. Together with other relevant data, their morphological characteristics offer a reliable basis for specific identification [35,67]. The haemogregarines gametocytes appeared as sausage-shaped and generally lie singly within erythrocytes (Table 2, Table 3, Table 4, Table 5, Table 6, Table 7, Table 8 and Table 9), but sometimes free in extracellular space, which is consistent with Telford et al. [34], Sloboda et al. [79] as the presence of free extracellular gametocytes. They are also observed in the leucocytes of fish (Table 2), birds (Table 8), and mammals (Table 9).
The shape, size, and structure of infected blood-corpuscles often undergo considerable changes. Hypertrophy may result directly from the gametocyte’s added intraerythrocytic volume or represent an erythrocyte adaptation to the gametocyte’s presence [53,82,131,132]. An entirely different cell response occurred when the gametocytes of Hemogregarina sp. invaded erythrocytes of Rana berlandieri. The erythrocytes undergo hypertrophy, and the plasmalemma of the infected erythrocyte demonstrated numerous microvilli-like out-growings. Hussein [133] also described the hypertrophy of Karyolysus-infected erythrocytes. Most haemogregarine gametocytes do not invade the host cell’s nucleus but instead move it to the opposite side or the other host cell’s other pole. This is contrary to the effect of the genus Karyolysus on the infected erythrocytes. Karyolysus has a karyolytic impact on the host cell’s nucleus and is therefore identified Karyolysus Reichenow [134].
Little work had been done to identify the actual arthropod vectors of haemogregarines, as the transmission by inoculation of blood was rarely successful. In general, the invertebrate vectors of haemogregarines were the most challenging problem facing this group’s research progress [49]. The haemogregarines displayed a wide distribution of vertebrate host infections, and a large number of invertebrate vectors (Table 2, Table 3, Table 4, Table 5, Table 6, Table 7, Table 8 and Table 9). In all haemogregarines, fertilization is of Adelea type; both micro- and macrogamonts lie in syzygy within the same parasitophorous vacuole. Syzygy can stimulate the production of the associated gamonts in haemogregarines, since only the parasites found in pairs were mostly differentiated, which is consistent with Davies and Smit [42]. Regarding the number of microgametes produced by each microgamont, the members of the suborder Adeleidea were characterized by the production of only a few (four or less) microgametes [135]. Simultaneously, the formation of multiple microgametes has been identified in most haemogregarines species [52]. However, there are some suggestions that multiple microgamete formation does not occur in the entire genus Hepatozoon [111]. Regarding the number of flagella in microgametes in haemogregarines, contradictions were recorded. While monoflagellated microgametes have been described for haemogregarines species [74], biflagellated microgametes were also recorded for other haemogregarines [52]. On the other hand, Michel [85] reported non-flagellated microgametes in Hepatozoon mauritanicum.
Fertilization follows, leading to the formation of a zygote that becomes an oocyst. The oocyst is surrounded by a flexible membrane rather than a wall, and it produces sporozoites that may undergo further merogony. Sporogony is elucidated for just a few known haemogregarines species, the vast majority of which is supposed to investigate this aspect of their life-cycle, as reported by Forlano et al. [113]. There is also another potential criterion for distinguishing between Hepatozoon and Haemogregarina based on the presence or absence of oocysts containing sporocysts in the invertebrate vector, which is consistent with Levine [6]. When the developing mite reaches the nymphal stage, the sporozoites attain their maturity. The sporozoites eventually get the nymph’s stomach and pass out with their faeces, which are considered infection sources of the vertebrate host (lizard). The morphological characteristics of the gamonts and meronts found in the blood cells sometimes provide inadequate information for differential diagnoses [37], meaning that assigning species of haemogregarines to one of these genera must be based on the characteristics of its sporogony in the invertebrate vectors [6,64]. However, data on invertebrate vectors and sporogony are missing for the majority of species [23].
Until now, the current taxonomy of haemogregarines is facing a great challenge due to the high variation in gamont morphology, low host specificity, unknown invertebrate hosts in many cases, and fewer details of sporogony. Therefore, molecular approaches are now available to distinguish populations of morphologically identical but genetically different parasites, including DNA and polymerase chain reaction (PCR) based approaches [22,136,137,138,139,140,141]. Some studies based on PCR-based assays as the reference diagnostic test for epidemiological studies, which given their greater sensitivity, particularly for testing different hosts with intermittent levels of parasitemia via a low infection rate by gamonts, as Otranto et al. [114], Haklová-Kočíková et al. [18], Jòzsef et al. [24], Ramos et al. [116], and Mitkova et al. [120]. Notably, all the molecular evidence comes from the complete and partial sequences of the small subunit (SSU) ribosomal DNA (rDNA) 18S gene is a sufficient phylogenetic marker to approximate ordinal level relationships and those within orders [68,98,119,142,143,144,145]. Previous molecular studies of Harris et al. [22] and Barta et al. [19] demonstrated that the haemogregarine species are clustered in sister clades with interspecies linked more with the host geographic distribution, rather than host species. There are universal primer sets that were able to molecularly characterize haemogregarines, as mentioned in Table 10. However, many species with sequences deposited in the GenBank database are not identified correctly at the generic level. Table 11 expressed only haemogregarines identified at the species level and others identified at the generic level are excluded.

4. Conclusions

Few haemogregarine characteristics provide a reliable basis for the related parasite to recognized genera. Details of the sporogonic cycle seem to be the only reliable criterion as they are the “Key-stone” in the classification system. Morphological characteristics of the gametocytes do not help in this respect. Features of the schizogonic stages, when these are known, are not much better as criteria of generic value. Molecular phylogenetic studies using the appropriate genetic markers are helpful tools for the accurate taxonomic identification for haemogregarines. Further studies are recommended to include other nuclear and mitochondrial genes to provide more information about the genetic variability among haemogregarines.

Author Contributions

Conceptualization, S.A.-Q., F.A.-G. and M.A.D.; methodology, F.A.-G. and R.A.-G.; validation, M.A.D.; formal analysis, R.A.-G. and M.A.D.; investigation, S.A.-Q. and F.A.-G.; resources, R.A.-G. and M.A.D.; data curation, R.A.-G. and M.A.D.; writing—original draft preparation, S.A.-Q., F.A.-G., R.A.-G. and M.A.D.; writing—review and editing, S.A.-Q., F.A.-G., R.A.-G. and M.A.D.; visualization, R.A.-G. and M.A.D.; supervision, S.A.-Q., F.A.-G. and M.A.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Deanship for Research and Innovation, “Ministry of Education” in Saudi Arabia, grant number IFKSURP-131.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated or analysed during this study are included in this published article.

Acknowledgments

The authors extend their appreciation to the Deanship for Research and Innovation, “Ministry of Education” in Saudi Arabia for funding this research work through the project number IFKSURP-131”.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Levine, N.D. Taxonomy of the Sporozoa. J. Parasitol. 1970, 56, 208–209. [Google Scholar]
  2. Davies, A.J.; Johnston, M.R.L. The biology of some intraerythrocytic parasites of fishes, amphibian and reptiles. Adv. Parasitol. 2000, 45, 1–107. [Google Scholar] [PubMed]
  3. Adl, S.M.; Simpson, A.G.B.; Lane, C.E.; Lukeš, J.; Bass, D.; Bowser, S.S.; Brown, M.W.; Burki, F.; Dunthorn, M.; Hampl, V.; et al. The revised classification of eukaryotes. J. Eukaryot. Microbiol. 2012, 59, 429–514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Hossen, M.S.; Bandyopadhyay, P.K.; Gürelli, G. On the occurrence of a Haemogregarinae (Apicomplexa) parasite from freshwater turtles of South 24 Parganas, West Bengal, India. Tutkiye Parazitol. Derg. 2013, 37, 118–122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Telford, S.R. Hemoparasites of the Reptilia: Color Atlas and Text; CRC Press, Taylor and Francis Group: Boca Raton, FL, USA, 2009. [Google Scholar]
  6. Levine, N.D. Some corrections in Haemogregarine (Apicomplexa: Protozoa) Nomenclature. J. Protozool. 1982, 29, 601–603. [Google Scholar] [CrossRef] [PubMed]
  7. Danilewsky, B. Die Hematozoen der Kaltblüter. Arch. Mikr. Anat. 1885, 24, 588–598. [Google Scholar] [CrossRef] [Scilit]
  8. Labbé, A. Recherches zoologiques et biologiques sur les parasites endoglobulaires du sang des Vertébrés. Arch. Zool. Exp. Gen. 1894, 2, 55–258. [Google Scholar]
  9. Miller, W.W. Hepatozoon perniciosum n. g. n. sp., a haemogregarines pathogenic for white rats: With a brief description of the sexual cycle in the intermediate host a mite (Laelaps echidninus Berlese). Hyg. Lab. Bull. (Washington) 1908, 46, 51–123. [Google Scholar]
  10. Lainson, R. On Cyrilia gomesi (Neiva and Pinto, 1926) gen. nov. (Haemogregarinidae) and Trypanosoma bourouli Neiva and Pinto. In the fish Synbranchus marmoratus: Simultaneous transmission by the leech Haementeria lutzi. In Parasitological Topics; Special Publication; Canning, E.U., Ed.; Society of Protozoologists, Inc.: Lawrence, KS, USA, 1981; Volume 1, pp. 150–158. [Google Scholar]
  11. Barta, J.R. Phylogenetic analysis of the Class Sporozoa (Phylum Apicomplexa Levine 1970): Evidence for the independent evaluation of heteroxenous life cycles. J. Parasitol. 1989, 75, 195–206. [Google Scholar] [CrossRef] [Scilit]
  12. Mohammed, A.H.H.; Mansour, N.S. The haemogregarines complex (an analytical systematic review). Bull. Fac. Pharm. Cairo Univ. (BFPC) 1959, 35, 39–52. [Google Scholar]
  13. Wenyon, C.M. Protozoology; Bailliere, Tindall and Cox: London, UK, 1926; Volume 2. [Google Scholar]
  14. Petit, G.; Landau, I.; Baccam, D.; Lainson, R. Description et cycle biologique d’Hemolivia stellate n. g., n. sp., hémogregarine de crapauds Brésiliens. [Desription and life cycle of Hemolivia stellate n.g., n. sp., a haemogregarines of Brazilian toads]. Ann. Parasitol. Hum. Comp. 1990, 65, 3–15. [Google Scholar] [CrossRef] [Scilit]
  15. Široký, P.; Kamler, M.; Modrý, D. Long-term occurrence of Hemolivia cf. mauritanica (Apicomplexa: Adeleina: Haemogregarinidae) in the captive Testudo marginata (Reptilia: Testudinidae): Evidence for cyclic merogony? J. Parasitol. 2004, 90, 1391–1393. [Google Scholar]
  16. Jacobson, E.R. Parasites and parasitic diseases of reptiles. In Infectious Diseases and Pathology of Reptiles: Color Atlas and Text; Jacobson, E.R., Ed.; CRC Press, Taylor & Francis Group: Boca Raton, FL, USA, 2007; pp. 579–580. [Google Scholar]
  17. Pineda-Catalan, O.; Perkins, S.L.; Peirce, M.A.; Engstrand, R.; Garcia-Davila, C.; Pinedo-Vasquez, M.; Aguirre, A.A. Revision of hemoproteid genera and description and redescription of two species of chelonian hemoproteid parasites. J. Parasitol. 2013, 99, 1089–1098. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Haklová-Kočíková, B.; Hižňanová, A.; Majláth, I.; Račka, K.; Harris, D.G.; Földvári, G. Molecular characterization of Karyolysus– a neglected but common parasite infecting some European lizards. Parasite. Vector. 2014, 7, 555. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Barta, J.R.; Ogedengbe, J.D.; Martin, D.S.; Smith, T.G. Phylogenetic position of the adeleorinid coccidia (Myzozoa, Apicomplexa, Coccidia, Eucoccidiorida, Adeleorina) inferred using 18S rDNA sequences. J. Eukaryot. Microbiol. 2012, 59, 171–180. [Google Scholar] [CrossRef] [Scilit]
  20. Ujvari, B.; Madsen, T.; Olsson, M. High prevalence of Hepatozoon spp. (Apicomplexa, Hepatozoidae) infection in water pythons (Liasis fuscus) from tropical Australia. J. Parasitol. 2004, 90, 670–672. [Google Scholar] [CrossRef] [Scilit]
  21. Johnson, A.J.; Origgi, F.C.; Wellehan, J.F.X., Jr. Molecular diagnostics. In Infectious Diseases and Pathology of Reptiles: Color Atlas and Text; Jacobson, E.R., Ed.; CRC Press, Taylor & Francis Group: Boca Raton, FL, USA, 2007; pp. 351–380. [Google Scholar]
  22. Harris, D.J.; Maia, J.P.M.C.; Perera, A. Molecular characterization of Hepatozoon species in reptiles from the Seychelles. J. Parasitol. 2011, 97, 106–110. [Google Scholar] [CrossRef] [Scilit]
  23. Dvořáková, N.; Kvičerova, J.; Papousek, I.; Javanbakht, H.; Tiar, G.; Kami, H.G. Haemogregarines from western Palaearctic freshwater turtles (genera Emys, Mauremys) are conspecifi c with Haemogregarina stepanowi Danilewsky, 1885. Parasitology 2014, 141, 522–530. [Google Scholar]
  24. Jòzsef, Ö.; Darko, M.; Milos, V.; Bojan, G.; Jevrosima, S.; Dejan, K.; Sanja, A.-K. Cytological and molecular identification of Haemogregarina stepanowi in blood samples of the European pond turtle (Emys orbicularis) from quarantine at Belgrade Zoo. Acta Vet.-Beograd 2015, 65, 443–453. [Google Scholar]
  25. O’Donoghue, P. Haemoprotozoa: Making biological sense of molecular. Int. J. Parasitol. Parasites Wildl. 2017, 6, 241–256. [Google Scholar]
  26. Kvičerová, J.; Hypša, V.; Pakandl, M. Phylogenetic relationships among Eimeria spp. (Apicomplexa, Eimeriidae) infecting rabbits: Evolutionary significance of biological and morphological features. Parasitology 2008, 135, 443–452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Kubo, M.; Jeong, A.; Kim, S.I.; Kim, Y.J.; Lee, H.; Kimura, J.; Agatsuma, T.; Sakai, H.; Yanai, T. The first report of Hepatozoon species infection in leopard cats (Prionailurus bengalensis) in Korea. J. Parasitol. 2010, 96, 437–439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Pawar, R.M.; Poornachandar, A.; Srinivas, P.; Rao, K.R.; Lakshmikantan, U.; Shivaji, S. Molecular characterization of Hepatozoon spp. infection in endangered Indian wild felids and canids. Vet. Parasitol. 2012, 186, 475–479. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Abdel-Baki, A.S.; Al-Quraishy, S.; Zhang, J.Y. Redescription of Haemogregarina garnhami (Apicomplexa: Adeleorina) from the blood of Psammophis schokari (Serpentes: Colubridae) as Hepatozoon garnhami n. comb. based on molecular, morphometric and morphologic characters. Acta Parasitol. 2014, 59, 294–300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Cook, C.A.; Lawton, S.P.; Davies, A.J.; Smit, N.J. Reassignment of the land tortoise haemogregarine Haemogregarina fitzimonsi Dias 1953 (Adeleorina: Haemogregarinidae) to the genus Hepatozoon Miller 1908 (Adeleorina: Hepatozoidae) based on parasite morphology, life cycle and phylogenetic analysis of 18S rDNA sequence fragments. Parasitology 2014, 141, 1611–1620. [Google Scholar]
  31. Cook, C.A.; Netherlands, E.C.; Smit, N.J. Redescription, molecular characterisation and taxonomic re-evaluation of a unique African monitor lizard haemogregarine Karyolysus paradoxa (Dias, 1954) n. comb. (Karyolysidae). Parasit. Vectors. 2016, 9, 347. [Google Scholar] [CrossRef] [Scilit]
  32. Cook, C.A.; Netherlands, E.C.; Van As, J.; Smit, N.J. Two new species of Hepatozoon (Apicomplexa: Hepatozoidae) parasitizing species of Philothamnus (Ophidia: Colubridae) from South Africa. Folia Parasitol. 2018, 65, 004. [Google Scholar] [CrossRef] [Scilit]
  33. Osimani, J.J. Haemogregarina triatomae n. sp. from a South American lizard, Tupinambis teguixin transmitted by the Reduviid Triatoma rebrovaria. J. Parasite. 1942, 28, 147–154. [Google Scholar] [CrossRef] [Scilit]
  34. Telford, S.R., Jr.; Ernst, J.A.; Clark, A.M.; Butler, J.F. Hepatozoon sauritus: A polytopic haemogregarine of three genera and four species of snakes in North Florida, with specific identity verified from genome analysis. J. Parasitol. 2004, 90, 352–358. [Google Scholar] [CrossRef] [Scilit]
  35. Herbert, J.D.K.; Godfrey, S.; Bull, C.M.; Menz, I. Developmental stages and molecular phylogeny of Hepatozoon tuatarae, a parasite infecting the New Zealand tuatara, Sphenodon punctatus and the tick, Amblyomma sphenodonti. Int. J. Parasitol. 2010, 40, 1311–1315. [Google Scholar] [CrossRef] [Scilit]
  36. Siddall, M.E.; Desser, S.S. Merogonic development of Haemogregarina balli (Apicomplexa: Adeleina: Haemogregarinidae) in the leech Placobdella ornate (Glossiphoniidae), its transmission to a chelonian intermediate host and phylogenetic implications. J. Parasitol. 1991, 77, 426–436. [Google Scholar] [CrossRef] [Scilit]
  37. Dvořáková, N.; Kvičerová, J.; Hostovský, M.; Široký, P. Haemogregarines of freshwater turtles from Southeast Asia with a description of Haemogregarina sacaliae sp. n. and a redescription of Haemogregarina pellegrini Laveran and Pettit, 1910. Parasitology 2015, 142, 816–826. [Google Scholar]
  38. Nakamoto, W.; Silva, A.J.; Machado, P.E.; Padovani, C.R.; Januario, S.A.; De Abreu, M.E. Leukocytes and Cyrilia gomesi (blood parasite) in Synbranchus marmoratus Bloch, 1975 (Pisces, Synbranchidae) from the Biriqui region of Sao Paulo (Brazil). Rev. Bras. Biol. 1991, 51, 755–761. [Google Scholar]
  39. Davies, A.J.; Eiras, J.C.; Austin, R.T.E. Investigations into the transmission of Haemogregarina bigemina Laveran and Mesnil, 1901 (Apicomplexa: Adeleorina) between intertidal fishes in Portugal. J. Fish. Dis. 1994, 17, 283–289. [Google Scholar] [CrossRef] [Scilit]
  40. Lom, J.; Tomas, K.; Dykova, I. Haemogregarina vltavensis, new species from perch (Perca fluviatilis) in Czechoslovakia. Syst. Parasitol. 1989, 13, 193–196. [Google Scholar] [CrossRef] [Scilit]
  41. Hill, J.P.; Hendrickson, G.L. Haematozoa of fishes in Humboldt Bay, California. J. Wildl. Dis. 1991, 27, 701–705. [Google Scholar] [CrossRef] [Scilit]
  42. Davies, A.J.; Smit, N.J. The life cycle of Haemogregarina bigemina (Adeleina: Haemogregarinidae) in South African hosts. Folia Parasit. 2001, 48, 169–177. [Google Scholar] [CrossRef] [Scilit]
  43. MacLean, S.A.; Davies, A.J. Prevalence and development of intraleucocytic haemogregarines from northwest and northeast Atlantic mackerel, Scomber scombrus L. J. Fish. Dis. 1990, 13, 59–68. [Google Scholar] [CrossRef] [Scilit]
  44. Hayes, P.M.; Smit, N.J.; Seddon, A.M.; Wertheim, D.F.; Davies, A.J. A new fish haemogregarine from South Africa and its suspected dual transmission with trypanosomes by a marine leech. Folia Parasit. 2006, 53, 241–248. [Google Scholar] [CrossRef] [Scilit]
  45. Curtis, L.M.; Grutter, A.S.; Smit, N.J.; Davies, A.J. Gnathia aureamaculosa, a likely definitive host of Haemogregarina balistapi and potential vector for Haemogregarina bigemina between fishes of the Great Barrier Reef, Australia. Int. J. Parasitol. 2013, 43, 361–370. [Google Scholar] [CrossRef] [Scilit]
  46. Oliveira, A.; Araújo, M.L.G.; Pantoja-Lima, J.; Aride, P.; Tavares-Dias, M.; Brinn, R.P.; Marcon, J.L. Cyrilia sp. (Apicomplexa: Haemogregarinidae) in the Amazonian freshwater stingray Potamotrygon wallacei (cururu stingray) in different hydrological phases of the Rio Negro. Rev. Bras. Biol. 2016, 77, 1–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Esteves-Silva, P.H.; da Silva, M.R.L.; O’Dwyer, L.H.; Tavares-Dias, M.; Viana, L.A. Haemogregarina daviesensis sp. nov. (Apicomplexa: Haemogregarinidae) from South American lungfish Lepidosiren paradoxa (Sarcopterygii: Lepidosirenidae) in the eastern Amazon region. Parasitol. Res. 2019, 118, 2773–2779. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Awerenzew, S. Parasiten aus dem Blute von Rana nuti. Arch. Protistenk. 1941, 95, 15–21. [Google Scholar]
  49. Ball, G.H. Some blood sporozoans from East African reptiles. J. Protozool. 1967, 14, 198–210. [Google Scholar] [CrossRef] [Scilit]
  50. Ray, R. Studies on the anuran blood parasites of sub-Himalayan West Bengal, India. J. Beng. Nat. Hist. Soc. 1992, 11, 4–8. [Google Scholar]
  51. Smith, T.G.; Desser, S.S.; Martin, D.S. The development of Hepatozoon sipedon n. sp. (Apicomplexa: Adeleina: Hepatozoidae) in its natural host, the northern water snake (Nerodia sipedon sipedon), its culicine vectors (Culex pipiens and Culex territans) and its intermediate host, the northern leopard frog (Rana pipiens). Parasitol. Res. 1994, 80, 559–568. [Google Scholar]
  52. Desser, S.S.; Hong, H.; Martin, D.S. The life history, ultrastructure and experimental transmission of Hepatozoon catesbiana n. comb., an apicomplexan parasite of the bullfrog, Rana catesbeiana and the mosquito, Culex territans in Algonquin Park, Ontario. J. Parasitol. 1995, 81, 212–222. [Google Scholar] [CrossRef] [Scilit]
  53. Lainson, R.; Paperna, I.; Naiff, R.D. Development of Hepatozoon caimani (Carini, 1909) Pessôa, de Biasi & de Souza, 1972 in the Caiman c. Crocodilus, the frog Rana catesbeiana and the mosquito Culex fatigans. Mem. Inst. Oswaldo. Cruz. 2003, 98, 103–113. [Google Scholar]
  54. Conradie, R.; Cook, C.A.; Preez, L.H.; Jordaan, A.; Netherlands, E.C. Ultrastructural comparison of Hepatozoon ixoxo and Hepatozoon theileri (Adeleorina: Hepatozoidae), parasitising South African anurans. J. Eukaryot. Microbiol. 2017, 64, 193–203. [Google Scholar] [CrossRef] [Scilit]
  55. Netherlands, E.C.; Cook, C.A.; Du Preez, L.H.; Vanhove, M.P.M.; Brendonck, L.; Smit, N.J. Monophyly of the species of Hepatozoon (Adeleorina: Hepatozoidae) parasitizing (African) anurans, with the description of three new species from hyperoliid frogs in South Africa. Parasitology 2018, 145, 1039–1050. [Google Scholar] [CrossRef] [Scilit]
  56. Robin, L.A. Cycle évolutif d’un Hepatozoon de Greko verticillatus. Ann. Inst. Pasteur. 1936, 56, 376–394. [Google Scholar]
  57. Garnham, P.C.C.C. A haemogregarines in Argas brumpti. Riv. Parasitol. 1954, 15, 425–435. [Google Scholar]
  58. Lewis, J.E.; Wagner, E.D. Hepatozoon sauromali sp. n., a haemogregarines from the Chuckwalla (Sauromalus spp.) with notes on the life history. J. Parasitol. 1964, 50, 11–14. [Google Scholar] [CrossRef] [Scilit]
  59. Elwasila, M. Haemogregarina sp. (Apicomplexa: Adeleorina) from the gecko Tarentola annularis in the Sudan: Fine structure and life-cycle trials. Parasitol. Res. 1989, 75, 444–448. [Google Scholar] [CrossRef] [Scilit]
  60. Allison, B.; Desser, S.S. Developmental stages of Hepatozoon lygosomarum (Dore 1919) comb. N. (Protozoa, Haemogregarinidae), a parasite of a new Zealand skink, Leiolopisma nigriplamtare. J. Parasitol. 1981, 67, 852–858. [Google Scholar] [CrossRef] [Scilit]
  61. Saratchandra, B. Two new haemogregarines, Haemogregarina waltairensis n. sp. from Calotes versicolor (Daudin) and H. ganapatii n. sp. from Lissemys punctata granosa (Shoepff). Proc. Indian Acad. Sci. (Anim. Sci.) 1981, 90, 365–371. [Google Scholar] [CrossRef] [Scilit]
  62. Bashtar, A.-R.; Abdel-Ghaffar, F.; Shazly, M.A. Developmental stages of Hepatozoon gracilis (Wenyon, 1909) comb. Nov., a parasite of the Egyptian Skink, Mabuya quinquetaeniata. Parasitol. Res. 1987, 73, 507–514. [Google Scholar] [CrossRef] [Scilit]
  63. Roca, V.; Galdón, M.A. Haemogregarine blood parasites in the lizards Podarcis bocagei (Seoane) and P. carbonelli (Pérez-Mellado) (Sauria: Lacertidae) from NW Portugal. Syst. Parasitol. 2010, 75, 75–79. [Google Scholar] [CrossRef] [Scilit]
  64. Abdel-Baki, A.S.; Al-Quraishy, S. Morphological characteristics of a new species of Haemogregarina Danilewsky, 1885 (Apicomplexa: Adeleorina) in naturally infected Acanthodactylus boskianus (Daudin) (Sauria: Lacertidae) in Egypt. Syst. Parasitol. 2012, 82, 65–69. [Google Scholar] [CrossRef] [Scilit]
  65. Moreira, I.D.; Harris, D.J.; Rosado, D.; Tavares, I.; Maia, J.P.; Salvi, D.; Perera, A. Consequences of haemogregarine infection on the escape distance in the lacertid lizard, Podarcis vaucheri. Acta Herpetol. 2014, 9, 119–123. [Google Scholar]
  66. Rabie, S.A.H.; Hussein, A.-N.A. A description of Haemogregarina species naturally infecting white-spotted gecko (Tarentola annularis) in Qena, Egypt. J. Egypt Soc. Parasitol. 2014, 44, 351–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  67. Abou Shafeey, H.; Mohamadain, H.S.; Abdel-Gaber, R.; Emara, N.M. Haemogregarines infecting reptiles in Egypt: 1- Blood and Merogenic stages of Haemogregarine sp. infecting the skink Scincus scincus. Egypt J. Exp. Biol. (Zool.) 2019, 15, 127–133. [Google Scholar]
  68. Zechmeisterová, K.; De Bellocq, J.G.; Široký, P. Diversity of Karyolysus and Schellackia from the Iberian lizard Lacerta schreiberi with sequence data from engorged ticks. Parasitology 2019, 146, 1690–1698. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  69. Ball, G.H.; Oda, S.N. Sexual stages in the life history of the haemogregarines Hepatozoon rarefaciens (Sambon and Seligmann 1907). J. Protozool. 1971, 18, 697–700. [Google Scholar] [CrossRef] [Scilit]
  70. Ramadan, N.F. Morphological, experimental and taxonomic studies on protozoan blood parasite of Egyptian reptiles. Ph.D. Thesis, Ain Shams University, Cairo, Egypt, 1974; 220p. [Google Scholar]
  71. Ball, G.H.; Chao, J.; Telford, S.R. Hepatozoon fusifex sp. n. a haemogregarine from the Boa constrictor producing marked morphological changes in the infected erythrocytes. J. Parasitol. 1969, 55, 800–813. [Google Scholar] [CrossRef] [Scilit]
  72. Bashtar, A.R.; Boules, R.; Mehlhorn, H. Hepatozoon aegypti nov. sp. 1- Life cycle. Z. Parasitenkd. 1984, 70, 29–41. [Google Scholar] [CrossRef] [Scilit]
  73. Lowichik, A.; Lanners, H.N.; Lowrie, R.C.; Meiners, N.E. Gametogenesis and sporogony of Hepatozoon mocassinin (Apicomplexa: Adeleina: Hepatozoidae) in an experimental mosquito host, Aedes aegypti. J. Eukaryot. Microbiol. 1993, 40, 287–297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  74. Abdel-Ghaffar, F.A.; Bashtar, A.R.; Shazly, M.A. Life cycle of Hepatozoon seurati comb. Nov. 1- Gamogony and sporogony inside the vector, Culex pipiens molestus. J. Egypt Ger. Soc. Zool. 1991, 3, 211–226. [Google Scholar]
  75. Bashtar, A.R.; Abdel-Ghaffar, F.A.; Shazly, M.A. Life cycle of Hepatozoon mehlhorni sp. nov. in the viper Echis carinatus and the mosquito Culex pipiens. Parasitol. Res. 1991, 77, 402–410. [Google Scholar] [CrossRef] [Scilit]
  76. Bashtar, A.R.; Shazly, M.A.; Ahmed, A.K.; Fayed, H.M. Life cycle of Hepatozoon matruhensis comb. nov. 1- Blood stages and merogony inside the snake Psammophis schokari. J. Egypt Ger. Soc. Zool. 1994, 14, 117–131. [Google Scholar]
  77. Shazly, M.A.; Ahmed, A.K.; Bashtar, A.R.; Fayed, H.M. Life cycle of Hepatozoon matruhensis comb. nov. 2. Gamogony and sporogony inside the vector Culex pipiens molestus. J. Egypt Ger. Soc. Zool. 1994, 14, 323–340. [Google Scholar]
  78. Saoud, M.; Ramadan, N.; Mohammed, S.; Fawzi, S. On two new haemogregarines (Protozoa: Apicomplexa) from Colubrid and Elapidae snakes in Egypt. Qatar Univ. Sci. J. 1996, 16, 127–139. [Google Scholar]
  79. Sloboda, M.; Kamler, M.; Bulantová, J.; Votýpka, J.; Modrý, D. A new species of Hepatozoon (Apicomplexa: Adeleorina) from Python regius (Serpentes:Pythonidae) and its experimental transmission by a mosquito vector. J. Parasitol. 2007, 93, 1189–1198. [Google Scholar] [CrossRef] [Scilit]
  80. Al-Farraj, S. Light and electron microscopic study on a haemogregarine species infecting the viper Cerastes cerastes gasperitti from Saudi Arabia. Pak. J. Biol. Sci. 2008, 11, 1414–1421. [Google Scholar] [CrossRef] [Scilit]
  81. Sajjadi, S.S.; Javanbakht, H. Study of blood parasites of the three snake species in Iran: Natrix natrix, Natrix tessellate and Zamenis longissimus (Colubridae). J. Genet. Resour. 2017, 3, 1–6. [Google Scholar]
  82. Abdel-Haleem, H.M.; Mansour, L.; Holal, M.; Qasem, M.A.; Al-Quraishy, S.; Abdel-Baki, A.S. Molecular characterisation of Hepatozoon aegypti Bashtar, Boulos & Mehlhorn, 1984 parasitising the blood of Spalerosophis diadema (Serpentes: Colubridae). Parasitol. Res. 2018, 117, 3119–3125. [Google Scholar] [PubMed]
  83. Robertson, M. Studies on Ceylon haematozoa. II- Notes on the life cycle of Haemogregarina nicoriae. Q. J. Microsc. Sci. 1910, 55, 741–762. [Google Scholar]
  84. Siddall, M.E.; Desser, S.S. Ultrastructure of gametogenesis and sporogony of Haemogregarina (sensu lato) myoxoxephali (Apicomplexa: Adeleina) in the Marine Leech Malmianta scorpii. J. Protozool. 1992, 39, 545–554. [Google Scholar] [CrossRef] [Scilit]
  85. Michel, J.C. Hepatozoon mauritanicum (Et. Et Ed. Sergent, 1904) n. comb., parasite de Testudo graeca: Redescription de la sporogone chez Hyalomma aegyptium et de la schizogonie tissularie d’apres le material d’E. Brump. Ann. Parasitol. Hum. Comp. 1973, 48, 11–21. [Google Scholar] [CrossRef] [Scilit]
  86. Acholonu, A.D. Haemogregarina pseudemydis n sp (Apicomplexa: Haemogregarinidae) and Pirhemocyton chelonarum n. sp. in turtles from Louisiana. J. Protozool. 1947, 21, 659–664. [Google Scholar] [CrossRef] [Scilit]
  87. Misra, K.K. Erythrocytic Schizogony in Haemogregarina gangetica of a River Turtle, Trionyx gangeticus Cuvier. Proc. Zool. Soc. (Calcutta) 1981, 32, 141–143. [Google Scholar]
  88. Chai, J.Y.; Chen, C.H. Six new species of Haemogregarina from chinese turtles. Acta Hydrobiol. Sin. 1990, 14, 129–137. [Google Scholar]
  89. Mihalca, A.D.; Achelăriţei, D.; Popescu, P. Haemoparasites of the genus Haemogregarina in a population of european pond turtles (Emys orbicularis) from Drăgăşani, Vâlcea county, Romania. Rev. Sci. Parasitol. 2002, 3, 22–27. [Google Scholar]
  90. Paperna, I. Hemolivia mauritanica (Haemogregarindae: Apicomplex) infection in the tortoise Testudo graeca in the Near East with data on sporogonous development in the tick vector Hyalomna aegyptium. Parasite 2006, 13, 267–273. [Google Scholar] [CrossRef] [Scilit]
  91. Široký, P.; Mikulíček, P.; Jandzik, D.; Kami, H.; Mihalca, A.; Rouag, R.; Kamler, M.; Schneider, C.; Zaruba, M.; Modrý, D. Co-distribution pattern of a haemogregarine Hemolivia mauritanica (Apicomplexa: Haemogregarinidae) and its vector Hyalomma aegyptium (Metastigmata: Ixodidae). J. Parasitol. 2009, 95, 728–733. [Google Scholar]
  92. Telford, S.R., Jr.; Norton, T.M.; Moler, P.E.; Jensen, J.B. A new Haemogregarina species of the alligator snapping turtle, Macrochelys temminckii (Testudines: Chelydridae), in Georgia and Florida that produces macromeronts in circulating erythrocytes. J. Parasitol. 2009, 95, 208–214. [Google Scholar] [CrossRef] [Scilit]
  93. Harris, D.J.; Graciá, E.; Jorge, F.; Maia, J.P.M.C.; Perera, A.; Carretero, M.A.; Giménez, A. Molecular detection of Hemolivia (Apicomplexa: Haemogregarinidae) from ticks of North African Testudo graeca (Testudines: Testudinidae) and an estimation of their phylogenetic relationships using 18S rRNA sequences. Comp. Parasitol. 2013, 80, 292–296. [Google Scholar] [CrossRef] [Scilit]
  94. Rossow, J.A.; Hernandez, S.M.; Sumner, S.M.; Altman, B.R.; Crider, C.G.; Gammage, M.B.; Segal, K.M.; Yabsley, M.J. Haemogregarine infections of three species of aquatic freshwater turtles from two sites in Costa Rica. Int. J. Parasitol. Parasites Wildl. 2013, 2, 131–135. [Google Scholar] [CrossRef] [Scilit]
  95. Soares, P.; de Brito, E.S.; Paiva, F.; Pavan, D.; Viana, L.A. Haemogregarina spp. in a wild population from Podocnemis unifilis Troschel, 1848 in the Brazilian Amazonia. Parasitol. Res. 2014, 113, 4499–4503. [Google Scholar] [CrossRef] [Scilit]
  96. Molla, S.H.; Bandyopadhyay, P.K.; Gürelli, G. Description of a new Haemogregarine, Haemogregarina sundarbanensis n. sp. (Apicomplexa: Haemogregarinidae) from Mud Turtle of Sundarban Regions, West Bengal, India. Turkiye. Parazitol. Derg. 2015, 39, 131–134. [Google Scholar] [CrossRef] [Scilit]
  97. Picelli, A.M.; Carvalho, A.V.; Viana, L.A.; Malvasio, A. Prevalence and parasitemia of Haemogregarina sp. in Podocnemis expansa (Testudines: Podocnemididae) from the Brazilian Amazon. Rev. Bras. Parasitol. Vet. 2015, 24, 191–197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  98. Arizza, V.; Sacco, F.; Russo, D.; Scardino, R.; Arculeo, M.; Vamberger, M.; Marrone, F. The good, the bad, and the ugly: Emys trinacris, Placobdella costata and Haemogregarina stepanowi in Sicily (Testudines, Annelida and Apicomplexa). Folia Parasit. 2016, 63, 029. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  99. Rakhshandehroo, E.; Sharifiyazdi, H.; Ahmadi, A. Morphological and molecular characterisation of Haemogregarina sp. (Apicomplexa: Adeleina: Haemogregarinidae) from the blood of the Caspian freshwater turtle Mauremys caspica (Gmelin) (Geoemydidae) in Iran. Syst. Parasitol. 2016, 93, 517–524. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  100. Alhaboubi, A.R.; Pollard, D.A.; Holman, P.J. Molecular and morphological characterization of a haemogregarine in the alligator snapping turtle, Macrochelys temminckii (Testudines: Chelydridae). J. Parasitol. 2017, 116, 207–215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  101. Goes, V.C.; Brito, E.S.; Valadao, R.M.; Gutierrez, C.O.; Picelli, A.M.; Viana, L.A. Haemogregarine (Apicomplexa: Adeleorina) infection in Vanderhaege’s toadheaded turtle, Mesoclemmys vanderhaegei (Chelidae), from a Brazilian Neotropical savanna region. Folia Parasitol. 2018, 65, 012. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  102. Úngari, L.P.; Santos, A.L.Q.; O’Dwyer, L.H.; da Silva, M.R.L.; Santos, T.C.R.; da Cunha, M.J.R.; de Melo Costa Pinto, R.; Cury, M.C. Molecular characterization and identification of Hepatozoon species Miller, 1908 (Apicomplexa: Adeleina: Hepatozoidae) in captive snakes from Brazil. Parasitol. Res. 2018, 117, 3857–3865. [Google Scholar]
  103. Börner, C. Untersuchungen über Hämospridien. I-Ein Beitrag zur kenntnis des genus Haemogregarina Danilewsky. Z. Wiss. Zool. Abt. A 1901, 69, 398–416. [Google Scholar]
  104. Pessôa, S.B.; De Biasi, P. Nota taxonomica sobre cistos esporôgônicos de algumas espécies de Hepatozoon (Sporozoa, Haemogregarinidae) parasites de serpents brasileiras. Mem. Inst. Butantan (Sâo Paulo) 1973, 37, 299–307. [Google Scholar]
  105. Hoare, C.A. On protozoal blood parasites collected in Uganda with an account of the life cycle of the croccdile haemogregarines. Parasitology 1932, 24, 210–224. [Google Scholar] [CrossRef] [Scilit]
  106. Viana, L.A.; Marques, E.J. Haemogregarine parasites (Apicomplexa: Hepatozoidae) in Caiman crocodilus yacare (Crocodilia: Alligatoridae) from Pantanal, Corumba, MS, Brazil. Rev. Bras. Parasitol. Vet. 2005, 14, 173–175. [Google Scholar]
  107. Viana, L.A.; Paiva, F.; Coutinho, M.E.; Lourenço-de-Oliveira, R. Hepatozoon caimani (Apicomplexa: Hepatozoidae) in Wild Caiman, Caiman yacare, from the Pantanal region, Brazil. J. Parasitol. 2010, 96, 83–88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  108. Bennett, G.F.; Earle, R.A.; Penzhorn, B. Ornithodoros peringueyi (Argasidae) and Xenopsylla trispinis (Siphonaptera), probable intermediate hosts of Hepatozzon atticoare of the South African Cliff swallow, Hirundo spilodera. Can. J. Zool. 1992, 70, 188–190. [Google Scholar] [CrossRef] [Scilit]
  109. Bennett, G.F.; Earle, R.A. New species of Haemoproteus, Hepatozoon and Leucocytozoon from South African birds. S. Afr. J. Wildl. Res. 1992, 22, 114–118. [Google Scholar]
  110. Desser, S.S. Tissue “Cyst” of Hepatozoon griseisciuri in the Grey Squirrel, Sciurus carolinensis: The significance of these cysts in species of Hepatozoon. J. Parasitol. 1990, 76, 257–259. [Google Scholar] [CrossRef] [Scilit]
  111. Göbel, E.; Krampitz, H.E. Histologische Untersuchungean zur Gamogonie und Sporogonie von Hepatozoon erhardovae in experimental infizierten rattenflohen (Xenopsylla cheopis). Z. Parasitenkd. 1982, 67, 261–271. [Google Scholar] [CrossRef] [Scilit]
  112. Frank, C. Über die Bedeutung von Laelaps agilis CL Koch 1836 (Mosostigmata: Parasitiformae) fur die Ubertragung von Hepatozoon sylvatici Coles 1914 (Sporozoa: Haemogregarinidae). Z. Parasitenkd. 1977, 53, 307–310. [Google Scholar] [CrossRef] [Scilit]
  113. Forlano, M.D.; Teixeira, K.R.S.; Scolfield, A.; Elisei, C.; Yotoko, K.S.C.; Fernandes, K.R.; Linhares, G.F.C.; Ewing, S.A.; Massard, C.L. Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp. Vet. Parasitol. 2007, 145, 21–30. [Google Scholar] [CrossRef] [Scilit]
  114. Otranto, D.; Dantas-Torres, F.; Weigl, S.; Latrofa, M.S.; Stanneck, D.; Decaprariis, D.; Capelli, G.; Baneth, G. Diagnosis of Hepatozoon canis in young dogs by cytology and PCR. Parasite. Vector. 2011, 4, 55. [Google Scholar] [CrossRef] [Scilit]
  115. Baneth, G.; Sheiner, A.; Eyal, O.; Hahn, S.; Beaufils, J.P.; Anug, Y.; Talmi-Frank, D. Redescription of Hepatozoon felis (Apicomplexa: Hepatozoidae) based on phylogenetic analysis, tissue and blood form morphology, and possible transplacental transmission. Parasite. Vector. 2013, 6, 102. [Google Scholar] [CrossRef] [Scilit]
  116. Ramos, C.A.N.; Babo-Terra, V.J.; Pedroso, T.C.; Filho, A.F.S.; Araújo, F.R.; Cleveland, H.P.K. Molecular identification of Hepatozoon canis in dogs from Campo Grande, Mato Grosso do Sul, Brazil. Braz. J. Vet. Parasitol. Jaboticabal 2015, 24, 247–250. [Google Scholar] [CrossRef] [Scilit]
  117. Paiz, L.M.; Silva, R.C.; Satake, F.; Fraga, T.L. Hematological disorders detected in dogs infected by Hepatozoon canis in a municipality in Mato Grosso do Sul State, Brazil. Arq. Bras. Med. Vet. Zootec. 2016, 68, 1187–1194. [Google Scholar] [CrossRef] [Scilit]
  118. De Sousa, K.C.M.; Fernandes, M.P.; Herrera, H.M.; Benevenute, J.L.; Santos, F.M.; Rocha, F.L.; Barreto, W.T.G.; Macedo, G.C.; Campos, J.B.; Martins, T.F.; et al. Molecular detection of Hepatozoon spp. in domestic dogs and wild mammals in southern Pantanal, Brazil with implications in the transmission route. Vet. Parasitol. 2017, 237, 37–46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  119. Bhusri, B.; Sariya, L.; Mongkolphan, C.; Suksai, P.; Kaewchot, S.; Changbunjong, T. Molecular characterization of Hepatozoon felis in Rhipicephalus sanguineus ticks infested on captive lions (Panthera leo). J. Parasit. Dis. 2017, 41, 903–907. [Google Scholar] [CrossRef] [Scilit]
  120. Mitkova, B.; Hrazdilova, K.; Novotna, M.; Jurankova, J.; Hofmannova, L.; Forejtek, P.; Modry, D. Autochthonous Babesia canis, Hepatozoon canis and imported Babesia gibsoni infection in dogs in the Czech Republic. Vet. Med. 2017, 62, 138–146. [Google Scholar] [CrossRef] [Scilit]
  121. Barati, A.; Razmi, G.R. A parasitologic and molecular survey of Hepatozoon canis infection in stray dogs in northeastern Iran. J. Parasitol. 2018, 104, 413–417. [Google Scholar] [CrossRef] [Scilit]
  122. Tuna, G.E.; Bakırcı, S.; Dinler, C.; Battal, G.; Ulutaş, B. Molecular Identification and Clinicopathological Findings of Hepatozoon sp. Infection in a Cat: First Report from Turkey. Turkiye Parazitol. Derg. 2018, 42, 286–289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  123. Attipa, C.; Maguire, D.; Solano-Gallego, L.; Szladovits, B.; Barker, E.N.; Farr, A.; Baneth, G.; Tasker, S. Hepatozoon canis in three imported dogs: A new tickborne disease reaching the United Kingdom. Vet. Rec. 2018, 183, 716. [Google Scholar] [CrossRef] [Scilit]
  124. Harris, D.J.; Sergiadou, D.; Halajian, A.; Swanepoel, L.; Roux, F. Molecular screening indictes high prevalence and mixed infections of Hepatozoon parasites in wild felines from South Africa. J. S. Afr. Vet. Assoc. 2020, 91, a2055. [Google Scholar] [CrossRef] [Scilit]
  125. Van As, M.; Netherlands, E.C.; Smit, N.J. Molecular characterization and morphological description of two new species of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina: Hepatozoidae) infecting leukocytes of African leopards Panthera pardus pardus (L.). Parasite. Vector. 2020, 13, 222. [Google Scholar] [CrossRef] [Scilit]
  126. Baticados, A.M.; Baticados, W.N.; Carlos, E.T.; Carlos, S.M.; Villarba, L.A.; Subiaga, S.G.; Magcalas, J.M. Parasitological detection and molecular evidence of Hepatozoon canis from canines in Manila, Philippines. Vet. Med. Res. Rep. 2011, 1, 7–10. [Google Scholar] [CrossRef] [Scilit]
  127. Bray, R.S. A check-list of the parasitic protozoa of West Africa with some notes on their classification. Bull. Inst. Fr. Afr. Noire. 1964, 26, 238–315. [Google Scholar]
  128. Yanai, T.; Tomita, A.; Masegi, T.; Ishikawa, K.; Iwasaki, T.; Yamazoe, K.; Ueda, K. Histopathologic features of naturally occurring hepatozoonosis in wild martens (Martes melampus) in Japan. J. Wildl. Dis. 1996, 31, 233–237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  129. Saoud, M.F.A.; Ramadan, N.F.; Mohammed, S.H.; Fawzi, S.M. Haemogregarines of geckos in Egypt, together with a description of Haemogregarina helmymohammedi n. sp. Qatar Univ. Sci. J. 1995, 15, 131–146. [Google Scholar]
  130. Smith, T.G.; Desser, S.S. Ultrastructural features of cystic and merogonic stages of Hepatozoon sipedon (Apicomplexa: Adeleorina) in northern leopard frogs (Rana pipiens) and northern water snakes (Narodia sipedon) from Ontario, Canada. J. Eukaryot. Microbiol. 1998, 45, 419–425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  131. Nadler, S.A.; Miller, J.H. A redescription of Hepatozoon mocassini (Laveran, 1902) n. comb. from Agkistrodon piscivorus leucostoma Troost 1836. J. Protozool. 1984, 31, 321–324. [Google Scholar] [CrossRef] [Scilit]
  132. Abdel-Baki, A.S.; Mansour, L.; Al-Malki, E.S.; Al-Quraishy, S.; Abdel-Halim, H.M. Morphometric and molecular characterisation of Hepatozoon bashtari n. sp. in painted saw-scaled viper, Echis coloratus (Ophidia, Viperidae). Parasitol. Res. 2020, 119, 3793–3801. [Google Scholar] [CrossRef] [Scilit]
  133. Hussein, A.N.A. Light and transmission electron microscopic studies of a haemogregarine in naturally infected fan-footed gecko (Ptyodactylus hasselquistii ). Parasitol. Res. 2006, 98, 468–471. [Google Scholar] [CrossRef] [Scilit]
  134. Reichenow, E. Karyolysus lacerate, ein wirtwechselndes Coccidium der Eidechse Laverta muralis und der Milbe Liponyssus saurarum. Arb. Gesundh. Amt. Berl. 1913, 45, 317–363. [Google Scholar]
  135. Honigberg, B.M.; Chairman of Committee. A revised classification of the phylum Protozoa. J. Protozool. 1964, 11, 7–20. [Google Scholar] [CrossRef] [Scilit]
  136. Rubini, D.S.; Paduan, K.S.; Perez, R.R.; Ribolla, P.E.M.; O’Dwyer, L.H. Molecular characterization of feline Hepatozoon species from Brazil. Vet. Parasitol. 2006, 137, 168–171. [Google Scholar] [CrossRef] [Scilit]
  137. Ortuño, A.; Castella, J.; Criado-Fornelio, A.; Buling, A.; Barba-Carretero, J.C. Molecular detection of a Hepatozoon species in stray cats from a feline colony in North-eastern Spain. Vet. J. 2008, 177, 134–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  138. Vilcins, I.E.; Ujvari, B.; Old, J.M.; Deane, E. Molecular and morphological description of a Hepatozoon species in reptiles and their ticks in the Northern Territory, Australia. J. Parasitol. 2009, 95, 434–442. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  139. Maia, J.P.M.C.; Perera, A.; Harris, D.J. Molecular survey and microscopic examination of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina) in lacertid lizards from the western Mediterranean. Folia Parasitol. 2012, 59, 241–248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  140. Tomé, B.M.; Maia, J.P.M.C.; Harris, D.J. Molecular assessment of apicomplexan parasites in the snake Psammophis from north Africa: Do multiple parasite lineages reflect the final vertebrate host diet? J. Parasitol. 2013, 99, 883–887. [Google Scholar] [CrossRef] [Scilit]
  141. Xavier, R.; Severino, R.; Pérez-Losada, M.; Gestal, C.; Freitas, R.; Harris, D.J.; Verissino, A.; Rosado, D.; Cable, J. Phylogenetic analysis of apicomplexan parasites infecting commercially valuable species from the North-East Atlantic reveals high levels of diversity and insights into the evolution of the group. Parasite. Vector. 2018, 11, 63. [Google Scholar] [CrossRef] [Scilit]
  142. Waeschenbach, A.; Webster, B.L.; Bray, R.A.; Littlewood, D.T.J. Added resolution among ordinal level relationships of tapeworms (Platyhelminthes: Cestoda) with complete small and large subunit nuclear ribosomal RNA genes. Mol. Phylogenet. Evol. 2007, 45, 311–325. [Google Scholar] [CrossRef] [Scilit]
  143. Ahmad, A.S.; Saeed, M.A.; Rashid, I.; Ashraf, K.; Shehzad, W.; Traub, R.J.; Baneth, G.; Jabbar, A. Molecular characterization of Hepatozoon canis from farm dogs in Pakistan. Parasitol. Res. 2018, 117, 1131–1138. [Google Scholar] [CrossRef] [Scilit]
  144. Hayes, P.M.; Smit, N.J. Molecular insights into the identification and phylogenetics of the cosmopolitan marine fish blood parasite, Haemogregarina bigemina (Adeleorina: Haemogregarinidae). Int. J. Parasitol. Parasites. Wildl. 2019, 8, 216–220. [Google Scholar] [CrossRef] [Scilit]
  145. Nordmeyer, S.C.; Henry, G.; Guerra, T.; Rodriquez, D.; Forstner, M.R.J.; Hahn, D. Identification of blood parasites in individuals fromsix families of freshwater turtles. Chelonian Conserv. Biol. 2020, 19, 85–94. [Google Scholar] [CrossRef] [Scilit]
  146. Mathew, J.S.; Van Den Bussche, R.A.; Ewing, S.A. Phylogenetic relationships of Hepatozoon (Apicomplexa Adeleorina) based on molecular, morphologic, and life-cycle characters. J. Parasitol. 2000, 86, 366–372. [Google Scholar] [CrossRef] [Scilit]
  147. Perkins, S.L.; Keller, A.K. Phylogeny of nuclear small subunit rRNA genes of haemogregarines amplified with specific primers. J. Parasitol. 2001, 87, 870–876. [Google Scholar] [CrossRef] [Scilit]
  148. Inokuma, H.; Okuda, M.; Ohno, K.; Shimoda, K.; Onishi, T. Analysis of the 18S rRNA gene sequence of a Hepatozoon detected in two Japanese dogs. Vet. Parasitol. 2002, 106, 265–271. [Google Scholar] [CrossRef] [Scilit]
  149. Criado-Fornelio, A.; Buling, A.; Cunha-Filho, N.A.; Ruas, J.L.; Farias, N.A.; Rey-Valeiron, C.; Pingret, J.L.; Etievant, M.; Barba-Carretero, M.J.C. Development and evaluation of a quantitative PCR assay for detection of Hepatozoon sp. Vet. Parasitol. 2007, 150, 352–356. [Google Scholar] [CrossRef] [Scilit]
  150. Tabar, M.D.; Altet, L.; Francino, O.; Sánchez, A.; Ferrer, L.; Roura, X. Vector-borne infections in cats: Molecular study in Barcelona area (Spain). Vet. Parasitol. 2008, 151, 332–336. [Google Scholar] [CrossRef] [Scilit]
  151. Kledmanee, K.; Suwanpakdee, S.; Krajangwong, S.; Chatsiriwech, J.; Suksai, P.; Suwannachat, P.; Sariya, L.; Buddhirongawatr, R.; Charoonrut, P.; Chaichoun, K. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp. and Hepatozoon canis in canine blood. Southeast Asian J. Trop. Med. Public Health 2009, 40, 35–39. [Google Scholar]
  152. Zintl, A.; Finnerty, E.J.; Murphy, T.M.; De Waal, T.; Gray, J.S. Babesias of red deer (Cervus elaphus) in Ireland. Vet. Res. 2011, 42, 7. [Google Scholar] [CrossRef] [Scilit]
  153. Hodžić, A.; Alić, A.; Fuehrer, H.P.; Harl, J.; Wille-Piazzai, W.; Duscher, G.G. A molecular survey of vector-borne pathogens in red foxes (Vulpes vulpes) from Bosnia and Herzegovina. Parasite. Vector. 2015, 8, 88. [Google Scholar] [CrossRef] [Scilit]
Figure 1. The general structure for the apical complex for Apicomplexa.
Figure 1. The general structure for the apical complex for Apicomplexa.
Animals 11 00170 g001
Figure 2. Haemogregarines as a part of phylum Apicomplexa.
Figure 2. Haemogregarines as a part of phylum Apicomplexa.
Animals 11 00170 g002
Figure 3. The life cycle of the apicomplexan parasites.
Figure 3. The life cycle of the apicomplexan parasites.
Animals 11 00170 g003
Table 1. Characters of different groups of haemogregarines used in the parsimony analysis carried out by Barta [19] and Siddall and Desser [36].
Table 1. Characters of different groups of haemogregarines used in the parsimony analysis carried out by Barta [19] and Siddall and Desser [36].
Comparable FeaturesKaryolysisHaemogregarinaCryiliaHepatozoonHaemolivia
Conoid presentIn all non-gametesIn all non-gametesIn all non-gametesIn all non-gametesIn all non-gametes
Crystalloid bodies +/-?+?++ (fragmented)
Merogeny +/-+ Intra-cellular+ Intra-cellular+ Intra-cellular+ Intra-cellular+ Intra-cellular
Micropores +/-+++++
Mitochondria.CristateCristateCristateCristateCristate
MitosisCentriolarCentriolar?CentriolarCentriolar
Amylopectin granules +/-+--++
Polar ring complex +/-+++++
GametogenesisExtra-cellularExtra-cellularExtra-cellularExtra-cellularIntra-cellular
No. of microgametes/each microgamont24442–4
GamontsAnisogamousAnisogamousAnisogamousAnisogamousAnisogamous
Syzygy+++++
ZygoteNon-motileNon-motileNon-motileNon-motileNon-motile
SporogonyExtra-cellularExtra-cellularExtra-cellularExtra-cellularIntra-cellular
Persistent cysts +/----++
No. of flagella/microgametes11Absent1?
Arrangement of flagella in microgametesTerminalTerminal?TerminalTerminal
No. of sporozoites/oocyst20–30 8 >204–16 10–25
Note: (+) presence, (-) absence, (?) not detected.
Table 2. Haemogregarines of fish.
Table 2. Haemogregarines of fish.
Species of HaemogregarinesThe Vertebrate HostSite of MerogonyInvertebrate VectorSite of Gamogony and SporogonyLocalityAuthors
Cyrilia gomesiSynbranchus marmoratusLeucocytesHaementeria lutziStomachSao Paulo, BrazilNakamoto et al. [38]
Haemogregarina bigeminaLipophrys folis and Coryphoblrnnius galeritaBlood cellsGnathia maxillarisHindgutPortugal Atlantic west coastDavies et al. [39]
Haemogregarina vltavensisPerca fluviatilisIntra-erythrocytic gamonts are only described----CzechoslovakiaLom et al. [40]
Haemogregarina leptocottiLeptocottus armatusBlood cells----California USAHill and Hendrickson [41]
Haemogregarina roelofsiSebastes melanopsBlood cells----California USAHill and Hendrickson [41]
Haemogregarina bigeminaClinus superciliosus and Clinus cottoidesIntra-erythrocyticGnathia africana--South AfricaDavies and Smit [42]
Haemogregarine sp.Scomber scombrus L.Leucocytes----Northwest and Northeast Atlantic oceanMaclean and Davies [43]
Haemogregarina curvataClinus cottoides, Parablennius cornutusIntra-erythrocyticZeylanicobdella arugamensisHost gut tissueSouth AfricaHayes et al. [44]
Haemogregarina balistapiRhinecanthus aculeatusIntra-erythrocyticGnathia aureamaculosaHost gut tissueGreat Barrier Reef, AustraliaCurtis et al. [45]
Cyrilia sp.Potamotrygon wallaceiIntra-erythrocytic----Rio NegriOliveira et al. [46]
Haemogregarina daviesensisLepidosiren paradoxaIntra-erythrocytic----Eastern Amazon regionEsteves-Silva et al. [47]
Table 3. Haemogregarines of amphibians.
Table 3. Haemogregarines of amphibians.
Species of HaemogregarinesThe Vertebrate HostSite of MerogonyInvertebrate VectorSite of Gamogony and SporogonyLocalityAuthors
Pseudohaemogregarina nuttiRana nuttiErythrocytes and liver----GermanyAwerenzew [48]
Haemogregarina theileriRana angloensisErythrocytes and liver----Njoro, KenyaBall [49]
Haemolivia stellateBrazilian toadsLiverTicksGut wallBrazilPetit et al. [14]
Haemogregarina nucleobisecansBufo himalayanusErythrocytes and liver----IndiaRay [50]
Hepatozoon sipedonNerodia sipedon and Rana pipiensVarious internal organsCulex pipiens and Culex territansHemocoelOntario, CanadaSmith et al. [51]
Hepatozoon catesbianaeRana catesbeianaErythrocytes and liverCulex territansMalpighian tubulesOntario, CanadaDesser et al. [52]
Hepatozoon caimaniRana catesbeianaIntra-erythrocyticCulex fatigansExtra-erythrocytic gametocytesState of Mato GrossoLainson et al. [53]
Hepatozoon theileriAmietia queckettiIntra-erythrocytic gamonts are only described----South AfricaConradie et al. [54]
Hepatozoon involucrumHyperolius marmoratusIntra-erythrocytic----KwaZulu-Natal, South AfricaNetherlands et al. [55]
Hepatozoon tenuisAfrixalus fornasiniiIntra-erythrocytic----KwaZulu-Natal, South AfricaNetherlands et al. [55]
Hepatozoon thoriHyperolius marmoratusIntra-erythrocytic----KwaZulu-Natal, South AfricaNetherlands et al. [55]
Table 4. Haemogregarines of lizards.
Table 4. Haemogregarines of lizards.
Species of HaemogregarinesThe Vertebrate HostSite of MerogonyInvertebrate VectorSite of Gamogony and SporogonyLocalityAuthors
Hepatozoon mesniliGecko verticillatusEndothelial cells of all host organsCulex fatigans and Aedes albopictusStomachSaigonRobin [56]
Haemogregarina triatomaeTupinambis teguixinLiver and lungTriatoma subrovariaIntestineSouth AmericaOsimani [33]
Hepatozoon argantisAgama mossambicaLiverArgas brumptiGut and homocoelomic cavityEast Africa, MossambicGarnham [57]
Hepatozoon sauromaliSauromalus sp.LiverOphionyssus sp.Hemocoel--Lewis and Wagner [58]
Haemogregarina sp.Tarentola annularisLung----SudanElwasila [59]
Hepatozoon lygosomarumLeiolopisma nigriplantareLiver and spleenOphionissus saurarumWall of the gut caecaCanterbury, New ZealandAllison and Desser [60]
Haemogregarina waltairensisCalotes versicolorPeripheral blood, liver, lung, and bone marrow----IndiaSaratchandra [61]
Hepatozoon gracilisMabuya quinquetaeniataLiverCulex pipienis molesusHemocoelGiza, EgyptBashtar et al. [62]
Haemogregarina sp.Podarcis bocagei and Podarcis carbonelliIntra-erythrocytic----NW PortugalRoca and Galdón [63]
Haemogregarina ramadaniAcanthodactylus boskianusIntra-erythrocytic----Giza, EgyptAbdel-Baki and Al-Quraishy [64]
Hepatozoon sp.Podarcis vaucheriIntra-erythrocytic----OukaimedenMoreira et al. [65]
Haemogregarina sp.Tarentola annularisIntra-erythrocytic----Qena, EgyptRabie and Hussein [66]
Karyolysus lacazei
Karyolysus sp.
Karyolysus latus
Lacerta agilis
Zootoca vivipara
Podarcis muralis
Intra-erythrocyticOphionyssus saurarum and Ixodes ricinus Poland, Slovakia
Haklová-Kočíková et al. [18]
Karyolysus paradoxaVaranus albigularis, Varanus niloticusIntra-erythrocytic----Ndumo Game Reserve, South AfricaCook et al. [31]
Haemogregarina daviesensisLepidosiren paradoxaIntra-erythrocytic----Eastern Amazon
region
Esteves-Silva et al. [47]
Haemogregarina sp.Scincus scincusIntra-erythrocytic----South Sinai, EgyptAbou Shafeey et al. [67]
Karyolysus lacazeiLacerta schreiberiIntra-erythrocyticIxodes ricinus--Czech RepublicZechmeisterová et al. [68]
Table 5. Haemogregarines of snakes.
Table 5. Haemogregarines of snakes.
Species of HaemogregarinesThe Vertebrate HostSite of MerogonyInvertebrate VectorSite of Gamogony and SporogonyLocalityAuthors
Hepatozoon rarefaciensDrymachon coraisLungCulex tarsalis, Anopheles albintarus, Aedes sierrensisHemocoelCalifornia, USABall and Oda [69]
Haemogregarnia
matruhensis
Psammophis schokariIntra-erythrocytic----EgyptRamadan [70]
Hepatozoon fusifexBoa constrictorLungCulex tarsalisHemocoelUSABall et al. [71]
Hepatozoon aegyptiSpalerosophis diademaLungCulex pipiens molestusHemocoelEgyptBashtar et al. [72]
Hepatozoon mocassiniAgkistrodon piscivorus leucostomaLiver parenchyma cellsAedes aegyptiHemocoelLouisiana, USALowichik et al. [73]
Hepatozoon seuratiCerastes cerastesLiver, lung, and spleenCulex pipiens molestusHemocoelAswan, EgyptAbdel-Ghaffar et al. [74]
Hepatozoon mehlhorniEchis carinatusLiver, lung, and spleenCulex pipiens molestusHemocoelSiwah and Baharia Oasis, EgyptBashtar et al. [75]
Hepatozoon matruhensisPsammophis schokariLiver and lungCulex pipiens molestusHemocoelFaiyum, Ismailia, EgyptBashtar et al. [76]
Hepatozoon ghaffariCerastes viperaLiver, lung, and spleenCulex pipiens molestusHemocoelAswan, EgyptShazly et al. [77]
Hepatozoon sipedonNerodia sipedon and Rana pipiensLiver and internal organsCulex pipiens, and Culex territansHemocoelOntario, CanadaSmith et al. [51]
Haemogregarnia garnhamiPsammophis schokariIntra-erythrocytic----EgyptSaoud et al. [78]
Hepatozoon ayorgborPython regiusIntra-erythrocytic----GhanaSloboda et al. [79]
Haemogregarnia sp.Cerastes cerastes gasperettiIntra-erythrocytic----Jizan, Saudi ArabiaAl-Farraj [80]
Hepatozoon garnhamiPsammophis schokariIntra-erythrocytic----Riyadh, Saudi ArabiaAbdel-Baki et al. [29]
Hepatozoon sp.Zamenis longissimusIntra-erythrocytic----IranSajjadi and Javanbakht [81]
Hepatozoon aegyptiSpalerosophis diademaIntra-erythrocytic----Riyadh, Saudi ArabiaAbdel-Haleem et al. [82]
Table 6. Haemogregarines of turtles and tortoises.
Table 6. Haemogregarines of turtles and tortoises.
Species of HaemogregarinesThe Vertebrate HostSite of MerogonyInvertebrate VectorSite of Gamogony and SporogonyLocalityAuthors
Hemogregarina nicoriaeNicoria trijugaCirculating blood and lungOzobranchus shipleyiIntestinal epitheliumCeylonRobertson [83]
Haemogregarina balliChelydra serpentine serpentinaLacunar endothelial cells, liver, lung, and spleenPlacobdella ornataGastric and intestinal caecaOntario, CanadaSiddall and Desser [84]
Hepatozoon mauritanicumTestudo graecaEndothelial cells of all host organs as liver, lung, spleen … etcHyalomma aegyptiumThe intestinal epithelium of the tick--Michel [85]
Haemogregarina pseudomydisPseudemys scripta elegansLeucocytes and ErythrocytesPlacobdella parasiticaThe intestinal epithelium of the leechLouisiana, USAAcholonu [86]
Haemogregarina gangetica (=H. simondi)Trionyx gangeticusErythrocytes and lung----IndiaMisra [87]
Haemogregarina ganapatiiLissemys punctata granosaPeripheral blood and Liver and lung----IndiaSaratchandra [61]
Haemogregarina sinensisTrionyx sinensisErythrocytes and Kupffer’s cells of the liverMooreotorix cotyliferGastric and intestinal caeca of the leechChinaChai and Chen [88]
Haemogregarina sp.Emys orbicularisIntra-erythrocyticPlacobdella costata--RomaniaMihalca et al. [89]
Haemolivia mauritanicaTestudo graecaIntra-erythrocyticHyalomna aegyptiumGut cellsIsraelPaperna [90]
Haemolivia mauritanicaTortoisesIntra-erythrocyticHyalomma aegyptium--Western Palaearctic realmŠiroký et al. [91]
Haemogregarina macrochelysiMacrochelys temminckiiIntra-erythrocyticLeech--Georgia and FloridaTelford et al. [92]
Haemogregarina stepanowiEmys orbicularis, Mauremys caspica, M. rivulata, M. leprosaIntra-erythrocytic----Western PalaearcticDvořáková et al. [23]
Haemogregarina sp.Lissemys punctata and Geoclemys hamiltoniiIntra-erythrocytic----West Bengal, IndiaHossen et al. [4]
Haemolivia mauritanicaTestudo graeca and Testudo marginataIntra-erythrocytic --North AfricanHarris et al. [93]
Haemogregarina sp.Rhinoclemmys funera and Kinosternon leucostomumIntra-erythrocytic----Costa RicaRossow et al. [94]
Haemogregarina sp.Podocnemis unifilisIntra-erythrocytic----Brazilian AmazoniaSoares et al. [95]
Haemogregarina sundarbanensisLissemys punctataIntra-erythrocytic----West Bengal, IndiaMolla et al. [96]
Haemogregarina stepanowiEmys orbicularisIntra-erythrocytic----Belgrade ZooJòzsef et al. [24]
Haemogregarina sp.Podocnemis expansaIntra-erythrocytic----Araguaia River Basin, BrazilPicelli et al. [97]
Haemogregarina sacaliae
Haemogregarina pellegrini
Cuora galbinifrons, Leucocephalon yuwonoi, Malayemys subtrijuga, Platysternon megacephalum,Intra-erythrocytic----Southeast AsiaDvořáková et al. [37]
Haemogregarina fitzsimonsi
Haemogregarina parvula
Land tortorise, Stigmochelys pardalisIntra-erythrocytic----South AfricanCook et al. [31]
Haemogregarina stepanowiEmys trinacrisIntra-erythrocytic----SicilyArizza et al. [98]
Haemogregarina sp.Mauremys caspicaIntra-erythrocytic----IranRakhshandehroo et al. [99]
Haemogregarina sp.Macrochelys temminckiiIntra-erythrocytic----Caldwell Zoo, TexasAlhaboubi et al. [100]
Haemogregarina sp.Mesoclemmys vanderhaegeiIntra-erythrocytic----BrazilGoes et al. [101]
Haemogregarina podocnemisPodocnemis UnifilisIntra-erythrocytic----BrazilÚngari et al. [102]
Table 7. Haemogregarines of crocodilians.
Table 7. Haemogregarines of crocodilians.
Species of HaemogregarinesThe Vertebrate HostSite of MerogonyInvertebrate VectorSite of Gamogony and SporogonyLocalityAuthors
Haemogregarina crocodilinorumAlligator mississippiensisIntra-erythrocyticPlacobdella multilineataIntestinal epithelial cells of the leechSouthern USA includes Arkansas, Carolina, and FloridaBörner [103]
Haemogregarina caimani
(= Hepatozoon caimani)
Caiman latirostrisIntra-erythrocyticCulex dolosusHemocoelBrazilPessôa and de Biasi [104]
Haemogregarina pettiti (=Hepatozoon pettiti Hoare 1932)Crocodilus niloticusErythrocytes and liverGlossina palpalisIntestineUganda, Senegal, West AfricaHoare [105]
Hepatozoon sp.Caiman c. yacareIntra-erythrocyticPhaeotabanus fervensIntestinePantanalViana and Marques [106]
Hepatozoon caimaniCaiman yacareIntra-erythrocytic----Pantanal region, BrazilViana et al. [107]
Table 8. Haemogregarines of birds.
Table 8. Haemogregarines of birds.
Species of HaemogregarinesThe Vertebrate HostSite of MerogonyInvertebrate VectorSite of Gamogony and SporogonyLocalityAuthors
Hepatozoon atticoraeHirundo spiloderaIntra-erythrocyticOrnithodoros peringueyi and Xenopsylia trispinisHemolymphSouth Africa, South America, Jamaica, EuropeaBennett et al. [108]
Hepatozoon prionopisPrionops plumatusIntra-erythrocytic----Transvaal, South AfricaBennett and Earle [109]
Hepatozoon lanisLanius collarisIntra-erythrocytic----South AfricaBennett et al. [108]
Hepatozoon malacotinusDryoscopus cublaIntra-erythrocytic----South AfricaBennett et al. [108]
Hepatozoon numidisNumida meleagrisIntra-erythrocytic----South AfricaBennett et al. [108]
Hepatozoon pittaePitta arcuateIntra-erythrocytic----SabahBennett et al. [108]
Hepatozoon estrildusLonchura cucullataIntra-erythrocytic----ZambiaBennett et al. [108]
Hepatozoon sylvaeParisoma subcaeruleumIntra-erythrocytic----South AfricaBennett et al. [108]
Hepatozoon zosteropisZosterops pallidaIntra-erythrocytic----South AfricaBennett et al. [108]
Hepatozoon passerisSporopipes squamifronsIntra-erythrocytic----Botswana, South AfricaBennett et al. [108]
Table 9. Haemogregarines of mammals.
Table 9. Haemogregarines of mammals.
Species of HaemogregarinesThe Vertebrate HostSite of MerogonyInvertebrate VectorSite of Gamogony and SporogonyLocalityAuthors
Hepatozoon perniciosumLaboratory white ratsThe liverEchinolaelaps echidninusStomachWashington, USAMiller [9]
Hepatozoon griseisciuriSciurus carolinensisBone marrow, liver, lung, and spleen (with intra-leucocytic gametocytes)Euhaemogamasus ambulans, Echinolaelaps echidninus and Haemogamasus reidiStomachWashington, Marland, Georgia, USADesser [110]
Hepatozoon erhardovaeClethrionomys glareolusLungXenopsylla cheopis, Ctenophthalmus agyrtes, C. assimilis and Nosopsyllus fasciatusStomach and fat-body cellsMunich, GermanyGöbel and Krampitz [111]
Hepatozoon sylvaticiApodemus sylvaticus and Apodemus flavicollisBone marrow and liverLaelaps agilisStomachAustriaFrank [112]
Hepatozoon sp.DogsIntra-erythrocytic----BrazilForlano et al. [113]
Hepatozoon canisDogsIntra-erythrocytic----ItalyOtranto et al. [114]
Hepatozoon felisCatsIntra-erythrocytic----IndiaBaneth et al. [115]
Hepatozoon canisDogsIntra-erythrocyticRhipicephalus sanguineus--Mato Grosso do Sul, BrazilRamos et al. [116]
Hepatozoon canisDogsIntra-erythrocytic----Central-western BrazilPaiz et al. [117]
Hepatozoon sp.Cerdocyon thous, Nasua nasua, Leopardus pardalis, Canis familiaris, Thrichomys fosteri, Oecomys mamorae, Clyomys laticeps, Thylamys macrurus, Monodelphis domesticsIntra-erythrocyticAmblyomma sculptum, A. parvum, A. tigrinum, Rhipicephalus microplus, R. sanguineus, A. auricularium--BrazilDe Sousa et al. [118]
Hepatozoon felisPanthera leo--Rhipicephalus sanguineus--ThailandBhusri et al. [119]
Hepatozoon canisDogsIntra-erythrocytic----Czech RepublicMitkova et al. [120]
Hepatozoon felisDogsIntra-erythrocytic----Northeastern IranBarati and Razmi [121]
Hepatozoon sp.CatsIntra-erythrocytic----TurkeyTuna et al. [122]
Hepatozoon canisDogsIntra-erythrocytic----United KingdomAttipa et al. [123]
Hepatozoon felisFelis silvestris, Caracal caracal, Panthera pardus, P. leo, Leptailurus servalMuscle and Liver----Limpopo and MpumalangaHarris et al. [124]
Hepatozoon luiperdjiePanthera pardusLeukocytes----Limpopo Province, South AfricaVan As et al. [125]
Hepatozoon canisDogsIntra-erythrocytic----Manila, PhilippinesBaticados et al. [126]
Table 10. Primer sets used in the phylogenetic analysis of haemogregarines by 18S rRNA gene.
Table 10. Primer sets used in the phylogenetic analysis of haemogregarines by 18S rRNA gene.
Primer SetPrimer SequenceReference
4558F5′- GCT AAT ACA TGA GCA AAA TCT CAA -3ʹMathew et al. [146]
2733R5′- CGG AAT TAA CCA GAC AAA T -3ʹ
2867F5′- AAC CTG GTT GAT CCT GCC AG -3′Mathew et al. [146]
2868R5′- TGA TCC TTC TGC AGG TTC ACC TAC -3′
HEMO15′ - TAT TGG TTT TAA GAA CTA ATT TTA TGA TTG - 3′Perkins and Keller [147]
HEMO25′ - CTT CTC CTT CCT TTA AGT GAT AAG GTT CAC - 3′
HepF5′- ATA-CAT-GAG-CAA-AAT-CTC-AAC -3′Inokuma et al. [148]
HepR5′- CTT-ATT-ATT-CCA-TGC-TGC-AG -3′
HepF3005′- GTTTCTGACCTATCAGCTTTCGAC -3ʹUjvari et al. [20]
HepR9005′- CAAATCTAAGAATTTCACCTCTGAC -3ʹ
HEP-15′- CGC GAA ATT ACC CAA TT -3′Criado-Fornelio et al. [149]
HEP-25′- CAG ACC GGT TAC TTT YAG CAG -3′
Piroplasmid-F5′- CCA GCA GCC GCG GTA ATT -3ʹTabar et al. [150]
Piroplasmid-R5′- CTT TCG CAG TAG TTY GTC TTT AAC AAA TCT -3ʹ
EF5′-GAA ACT GCG AAT GGC TCA TT-3′Kvičerová et al. [26]
ER5′-CTT GCG CCT ACT AGG CAT TC-3′
Hep-001F5′- CCT GGC TAT ACA TGA GCA AAA TCT CAA CTT -3′Kledmanee et al. [151]
Hep-737R5′- CCA ACT GTC CCT ATC AAT CAT TAA AGC -3′
BTH-1F5′- CCT GAG AAA CGG CTA CCA CAT CT -3′Zintl et al. [152]
BTH-1R5′- TTG CGA CCA TAC TCC CCC CA -3′
GF25′- GTC TTG TAA TTG GAA TGA TGG -3′Hodžić et al. [153]
GR25′- CCA AAG ACT TTG ATT TCT CTC -3′
Haemog11_F5′- ATT GGA GGG CAA GTC TGG TG -3ʹRakhshandehroo et al. [99]
Haemog11_R5′- GCG TTA GAC ACG CAA AGT CT -3ʹ
HemoFN5′- CCG TGG TAA TTC TAG AGC TAA TAC ATG AGC -3′Alhaboubi et al. [100]
HemoRN5′- GAT AAG GTT TAC GAA ACT TTC TAT ATT TA -3′
Table 11. List of sequences for haemogregarines from GenBank database based on the 18S rRNA gene.
Table 11. List of sequences for haemogregarines from GenBank database based on the 18S rRNA gene.
ParasitesHosts Accession Number in GenBank
Haemogregarina podocnemisPodocnemis unifilisMF476203.1 - MF476205.1
Haemogregarina pellegriniPlatysternon megacephalumKM887509.1
Malayemys subtrijugaKM887508.1
Haemogregarina sacaliaeSacalia quadriocellataKM887507.1
Haemogregarina stepanowiEmys orbicularisMT345287.1
Mauremys leprosaMT345284.1 - MT345286.1, KX691418.1, KX691417.1
Emys orbicularisKT749877.1, KF257928.1
Mauremys leprosaKF257929.1
Mauremys rivlataKF257927.1
Mauremys caspicaKF257926.1, KF992697.1
Haemogregarina bigeminaLipophrys pholisMK393799.1 - MK393801.1
Haemogregarina balliChelydra serpentineHQ224959.1
Hepatozoon fitzsimonsiKinixys zombensisKR069084.1
Chersina angulateKJ702453.1
Hepatozoon ursiUrsus thibetanus japonicusEU041718.1, AB586028.1, LC431855.1 - LC431853.1
Melursus ursinusHQ829437.1 - HQ829429.1
Hepatozoon seychellensisGradisonia alternansKF246566.1, KF246565.1,
Hepatozoon ayorgborApodemus sylvaticusKT274177.1, KT274178.1
Ctenophthalmus agyrtesKJ634066.1
Python regiusEF157822.1
Rhombomys opimusMW342705.1
Hepatozoon musaCrotalus durissusMF497763.1 - MF497767.1
Philodryas nattereiKX880079.1
Hepatozoon involucrumHyperolius marmoratusMG041591.1 - MG041594.1
Ursus arctosMN150506.1 - MN150504.1
Hepatozoon clamataeRana pipiensMN310689.1
Hepatozoon catesbianaeRana clamitansMN244529.1, MN244528.1, AF040972.1,
Hepatozoon aegyptiSpalerosophis diademaMH198742.1
Hepatozoon martisMartes foinaMG136688.1, MG136687.1
Hepatozoon procyonisNasua nasuaMF685386.1 - MF685409.1
Hepatozoon griseisciuriScinurus carolinensisMK452389.1, MK452388.1, MK452253.1, MK452252.1,
Hepatozoon sciuriScinus vulgarisMN104636.1 - MN104640.1,
Hepatozoon americanumCanis familiarisAF206668.1, KU729739.1
Hepatozoon ingwePanthera pardus pardusMN793001.1, MN793000.1
Hepatozoon theileriAmietia queckettiKP119773.1, KX512804.1, KJ599676.1,
Amietia delalandiiMG041605.1
Hepatozoon caimaniCaiman crocodilus yacareMF322538.1, MF322539.1
Caiman crocodilusMF435046.1 - MF435049.1
Hepatozoon silvestrisFelis silvestris silvestrisKX757032.1
Felis catusMH078194.1, KY649445.1
Hepatozoon tenuisAfrixalus fornasiniMG041595.1 - MG041599.1
Hepatozoon thoriHyperolius argusMG041600.1 - MG041603.1
Hepatozoon ixoxoAmietophrynus maculatusKP119772.1
Hepatozoon luiperdjiePanthera pardus pardusMN793002.1 - MN793004.1,
Hepatozoon cuestensisCrotalus durissusMF497769.1, MF497770.1
Hepatozoon sipedonSnakesAF110249.1 - AF110241.1
Hepatozoon erhardovaeMegabothris turbidusKJ608372.1
Hepatozoon domergueiFurcifer sp.KM234649.1 - KM234646.1
Hepatozoon tuataraeSphenodon punctatusGU385473.1 - GU385470.1
Hepatozoon cf. ophisauriRhombomys opimusMW256822.1
Hepatozoon colubri--MN723844.1
Hepatozoon canisAmblyomma cajennenseKT215377.1 - KT215353.1
Amblyomma sculptumKP167594.1
Tapir tapirMT458172.1
Haemaphysalis longicornisMT107092.1 - MT107097.1, MT107087.1 - MT107089.1, LC169075.1
Haemaphysalis concinnaKC509532.1 - KC509527.1
Rhipicephalus sanguineusMH595911.1 - MH595892.1, MG807347.1, KY056823.1, MG241229.1, KT587790.1, KT587789.1, KY196999.1, KY197000.1 - KY197002.1, JQ867389.1, MN207197.1
Rhipicephalus microplusHQ605710.1
Rhipicephalus decoloratusMN294724.1
Canis lupus familiarisMH615003.1, EU289222.1, DQ071888.1, MK910141.1 - MK910144.1, MK757793.1 - MK757815.1, MN791089.1, MN791088.1, MN393913.1, MN393910.1, MK645971.1 - MK645946.1, MK214285.1 - MK214282.1, MG254613.1 - MG254622.1, MK091084.1 - MK091092.1, KY940658.1, MG772658.1, MG254573.1 - MG254611.1, KY021176.1 - KY021184.1, MG496257.1, MG496273.1, MG062866.1, MG076961.1, MG209580.1 - MG209594.1, KX588232.1, KU729737.1, KU729738.1, KY026191.1, KY026192.1, KX880502.1 - KX880506.1, KX761384.1, KU232309.1, KU232310.1, KT736298.1, LC012839.1 - LC012821.1, LC053450.1, JX976545.1, JN584478.1 - JN584475.1, JF459994.1, GQ176285.1, EU571737.1, EF650846.1, MW019643.1 - MW019630.1, MT909554.1, MT081051.1, MT081050.1, MT821184.1, MT499356.1 - MT499354.1, MT754266.1, LC556379.1, MT433126.1 - MT433121.1
Lycalopex vetulusAY150067.2, MT458173.1
Kinixys speciesMT704950.1
Lycalopex gymnocercusKX816958.1
Didelphis albiventrisKY392884.1, KY392885.1
Canis aureusKF322145.1, KC886721.1, KC886729.1 - KC886733.1, KJ868814.1, KJ572977.1 - KJ572975.1, KJ634654.1, JX466886.1 - JX466880.1,
Felis catusKY469446.1, MN689671.1 - MN689661.1
Vulpes vulpesKF322141.1-KF322144.1, KC886720.1 - KC886728.1, MK757741.1 - MK757792.1, MN103520.1, MN103519.1, MH699884.1 - MH699892.1, MG077084.1 - MG077087.1, KY693670.1, KJ868819.1 - KJ868815.1, KU893118.1 - KU893127.1, KM096414.1 - KM096411.1, KJ572979.1, KJ572978.1, EU165370.1, GU376458.1 - GU376446.1, DQ869309.1, AY731062.1, MW295531.1, MN463026.1 - MN463021.1
Ixodes ricinusKU597235.1 - KU597242.1, KC584780.1
Hydrochoerus hydrochaerisKY965141.1 - KY965144.1
Cuon alpinusHQ829448.1 - HQ829438.1, MK144332.1
Dermacentor reticulatusKC584777.1 - KC584773.1
Pseudalopex gymnocercusAY471615.1, AY461376.1, AY461375.1
Panthera leoMT814748.1
Panthera tigrisMT232064.1 - MT232062.1
Camelus dromedriusMN989311.1
Hepatozoon apriSus scrofa leucomystaxLC314791.1
Amietophrynus gutturalisKP119771.1
Amietophrynus garmaniKP119770.1,
Sclerophrys maculataKX512803.1
Sclerophrys pusillaMG041604.1
Hepatozoon cf. felisFelis catusMK301457.1 - MK301462.1, MK724001.1, MG386482.1 - MG386484.1, KY649442.1 - KY649444.1, AY628681.1, AY620232.1
Felis silvestris silvestrisKX757033.1, MT210593.1 - MT210598.1,
Puma concolorMT458171.1
Eira barbaraMT458170.1
Lycalopex gymnocercusHQ020489.1
Leopardus pardalisKY684005.1
Asiatic lionKX017290.1
Prionailurus bengalensisAB771577.1 - AB771501.1, GQ377218.1 - GQ377216.1
Prionailurus iriomotensisAB636287.1 - AB636285.1
Panthera oncaKU232302.1 - KU232308.1
Panthera tigrisMT645336.1, MT634695.1
Rhipicephalus sanguineusJQ867388.1
Eurasian lynxMN905025.1, MN905023.1, MN905027.1
Haemolivia parvulaKinixys zombensisKR069083.1, KR069082.1
Haemolivia stellataAmblyomma dissimileMH196477.1 - MH196482.1, MH196475
Amblyomma rotundatumKP881349.1
Haemolivia mariaeEgernia stokesiiKF992712.1, KF992711.1
Tiliqua rugosaJN211118.1, HQ224961.1
Haemolivia mauritanicaHyalomma aegyptiumMH618775.1, MN463032.1, MN463031.1, MW092781.1 - MW092776.1, MK918611.1 - MK918608.1, MH497199.1 - MH497190.1, MH975037.1, MH975031.1, MH975026.1, MH975025.1,
Hyalomma sp.MF383512. - MF383506.1,
Haemolivia mauritanicaCanis lupus familiarisKP719092.1
Testudo marginataKF992710.1, KF992699.1
Testudo graecaKF992709.1 - KF992698.1, MH975039.1 - MH975032.1, MH975030.1 - MH975027.1, MH975024.1 - MH975021.1,
Karyolysus paradoxaVaranus albigularisKX011039.1, KX011040.1
Karyolysus cf. lacazeiIxodes ricinusMK497254.1
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Al-Quraishy, S.; Abdel-Ghaffar, F.; Dkhil, M.A.; Abdel-Gaber, R. Haemogregarines and Criteria for Identification. Animals 2021, 11, 170. https://doi.org/10.3390/ani11010170

AMA Style

Al-Quraishy S, Abdel-Ghaffar F, Dkhil MA, Abdel-Gaber R. Haemogregarines and Criteria for Identification. Animals. 2021; 11(1):170. https://doi.org/10.3390/ani11010170

Chicago/Turabian Style

Al-Quraishy, Saleh, Fathy Abdel-Ghaffar, Mohamed A. Dkhil, and Rewaida Abdel-Gaber. 2021. "Haemogregarines and Criteria for Identification" Animals 11, no. 1: 170. https://doi.org/10.3390/ani11010170

APA Style

Al-Quraishy, S., Abdel-Ghaffar, F., Dkhil, M. A., & Abdel-Gaber, R. (2021). Haemogregarines and Criteria for Identification. Animals, 11(1), 170. https://doi.org/10.3390/ani11010170

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop