Overexpression of PLIN1 Promotes Lipid Metabolism in Bovine Adipocytes
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Information
2.2. Construction of Interference and Overexpression Adenovirus Vectors of PLIN1
2.3. Isolation, Culture, and Differentiation of Bovine Preadipocytes
2.4. Tissue Collection and Quantitative Reverse-Transcription PCR (RT-PCR) Analysis
2.5. Western Blotting
2.6. Oil Red O Staining and Cellular Triglyceride Determination
2.7. The 5-ethynyl-2-deoxyuridine (EdU) Proliferation Assay
2.8. Cell Cycle Assay through Flow Cytometry
2.9. RNA Sequencing (RNA-seq)
2.10. Identification of DEGs and Functional Enrichment Analysis
2.11. qRT-PCR Validation of Key Genes
2.12. Statistical Analyses
3. Results
3.1. Expression of PLIN1 in Bovine Preadipocytes
3.2. PLIN1 Affected Triglyceride Level and LD Sizes in Bovine Preadipocytes
3.3. Study of DEGs in Bovine Adipocytes
3.4. GO Terms and KEGG Pathway Analysis of the DEGs
3.5. Identification of the DEGs during Promote of Differentiation in Bovine Adipocytes
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Jeremiah, L.E. The influence of subcutaneous fat thickness and marbling on beef Palatability and consumer acceptability. Food Res. Int. 1996, 29, 513–520. [Google Scholar] [CrossRef]
- Dolezal, H.G.; Smith, G.C.; Savell, J.W.; Carpenter, Z.L. Comparison of Subcutaneous Fat Thickness, Marbling and Quality Beef Grade for Predicting Palatability of beef. J. Food Sci. 1982, 47, 397–401. [Google Scholar] [CrossRef]
- Martins, T.S.; Sanglard, L.M.; Silva, W.; Chizzotti, M.L.; Renno, L.N.; Serao, N.V.; Silva, F.F.; Guimaraes, S.E.; Ladeira, M.M.; Dodson, M.V.; et al. Molecular Factors Underlying the Deposition of Intramuscular Fat and Collagen in Skeletal Muscle of Nellore and Angus Cattle. PLoS ONE 2015, 10, e0139943. [Google Scholar] [CrossRef] [PubMed]
- Raza, S.H.A.; Gui, L.; Khan, R.; Schreurs, N.M.; Xiaoyu, W.; Wu, S.; Mei, C.; Wang, L.; Ma, X.; Wei, D.; et al. Association between FASN gene polymorphisms ultrasound carcass traits and intramuscular fat in Qinchuan cattle. Gene 2018, 645, 55–59. [Google Scholar] [CrossRef] [PubMed]
- Raza, S.H.A.; Shijun1, L.; Khan, R.; Schreurs, N.M.; Manzari, Z.; El-Aziz, A.H.A.; Ullah, I.; Kaster, N.; Shah, M.A.; Zan, L. Polymorphism of PLIN1 gene and their association with body measures and ultrasound carcass traits in Qinchuan beef cattle. Genome 2020, 63, 483–492. [Google Scholar] [CrossRef] [PubMed]
- Cai, H.; Li, M.; Sun, X.; Plath, M.; Li, C.; Lan, X.; Lei, C.; Huang, Y.; Bai, Y.; Qi, X.; et al. Global Transcriptome Analysis During Adipogenic Differentiation and Involvement of Transthyretin Gene in Adipogenesis in Cattle. Front. Genet. 2018, 9, 463. [Google Scholar] [CrossRef]
- Antoni, P.; Lawrence, C.; Perry, E.B. The PAT Family of Lipid Droplet Proteins in Heart and Vascular Cells. Curr. Hypertens. Rep. 2008, 10, 461–466. [Google Scholar]
- Raza, S.H.A.; Khan, S.; Amjadi, M.; Abdelnour, S.A.; Ohran, H.; Alanazi, K.M.; Abd El-Hack, M.E.; Taha, A.E.; Khan, R.; Gong, C.; et al. Genome-wide association studies reveal novel loci associated with carcass and body measures in beef cattle. Arch. Biochem. Biophys. 2020, 13, 108543. [Google Scholar] [CrossRef]
- Luo, J.; Deng, Z.-L.; Luo, X.; Tang, N.; Song, W.-X.; Chen, J.; Sharff, K.A.; Luu, H.H.; Haydon, R.C.; Kinzler, K.W. A protocol for rapid generation of recombinant adenoviruses using the AdEasy system. Nat. Protoc. 2007, 2, 1236–1247. [Google Scholar] [CrossRef]
- He, T.-C.; Zhou, S.; Da Costa, L.T.; Yu, J.; Kinzler, K.W.; Vogelstein, B. A simplified system for generating recombinant adenoviruses. Proc. Natl. Acad. Sci. USA 1998, 95, 2509–2514. [Google Scholar] [CrossRef]
- Lee, B.; Zhu, J.; Wolins, N.E.; Cheng, J.X.; Buhman, K.K. Differential association of adipophilin and TIP47 proteins with cytoplasmic lipid droplets in mouse enterocytes during dietary fat absorption. Biochim. Biophys. Acta 2009, 1791, 1173–1180. [Google Scholar] [CrossRef]
- Walther, T.C.; Farese, R.V., Jr. Lipid droplets and cellular lipid metabolism. Annu. Rev. Biochem. 2012, 81, 687–714. [Google Scholar] [CrossRef] [PubMed]
- Sun, Z.; Gong, J.; Wu, H.; Xu, W.; Wu, L.; Xu, D.; Gao, J.; Wu, J.W.; Yang, H.; Yang, M.; et al. Perilipin1 promotes unilocular lipid droplet formation through the activation of Fsp27 in adipocytes. Nat. Commun. 2013, 4, 1594. [Google Scholar] [CrossRef] [PubMed]
- Castro-Chavez, F.; Yechoor, V.K.; Wooten, E.C.; Sharma, S.; Saha, P.K.; O’Connell, P.; Martinez-Botas, J.; Taegtmeyer, H.; Chan, L. Coordinated Upregulation of Oxidative Pathways and Downregulation of Lipid Biosynthesis Underlie Obesity Resistance in Perilipin Knockout Mice. Diabetes 2003, 52, 2666–2674. [Google Scholar] [CrossRef]
- Martinez-Botas, J.; Anderson, J.B.; Tessier, D.; Lapillonne, A.; Chang, B.H.-J.; Quast, M.J.; Gorenstein, D.; Chen, K.-H.; Chan, L. Absence of perilipin results in leanness and reverses obesity in Lepr db/db mice. Nat. Genet. 2000, 26, 474–479. [Google Scholar] [CrossRef]
- Temprano, A.; Sembongi, H.; Han, G.-S.; Sebastián, D.; Capellades, J.; Moreno, C.; Guardiola, J.; Wabitsch, M.; Richart, C.; Yanes, O.; et al. Redundant roles of the phosphatidate phosphatase family in triacylglycerol synthesis in human adipocytes. Diabetologia 2016, 59, 1985–1994. [Google Scholar] [CrossRef]
- Maurizi, G.; Poloni, A.; Mattiucci, D.; Santi, S.; Maurizi, A.; Izzi, V.; Giuliani, A.; Mancini, S.; Zingaretti, M.C.; Perugini, J.; et al. Human white adipocytes convert into “rainbow”adipocytes in vitro. J. Cell. Physiol. 2017, 232, 2887–2899. [Google Scholar] [CrossRef] [PubMed]
- Zhai, W.; Xu, C.; Ling, Y.; Liu, S.; Deng, J.; Qi, Y.; Londos, C.; Xu, G. Increased Lipolysis in Adipose Tissues is Associated with Elevation of Systemic Free Fatty Acids and Insulin Resistance in Perilipin Null Mice. Horm. Metab. Res. 2010, 42, 247–253. [Google Scholar] [CrossRef]
- Puri, V.; Ranjit, S.; Konda, S.; Nicoloro, S.M.; Straubhaar, J.; Chawla, A.; Chouinard, M.; Lin, C.; Burkart, A.; Corvera, S.; et al. Cidea is associated with lipid droplets and insulin sensitivity in humans. Proc. Natl. Acad. Sci. USA 2008, 105, 7833–7838. [Google Scholar] [CrossRef]
- Lyu, Y.; Su, X.; Deng, J.; Liu, S.; Zou, L.; Zhao, X.; Wei, S.; Geng, B.; Xu, G. Defective differentiation of adipose precursor cells from lipodystrophic mice lacking perilipin 1. PLoS ONE 2015, 10, e0117536. [Google Scholar] [CrossRef]
- Maurizi, G.; Petäistö, T.; Maurizi, A.; Della Guardia, L. Key-genes regulating the liposecretion process of mature adipocytes. J. Cell. Physiol. 2018, 233, 3784–3793. [Google Scholar] [CrossRef] [PubMed]
- Gandotra, S.; Dour, C.L.; Bottomley, W.; Cervera, P.; Giral, P.; Reznik, Y.; Charpentier, G.; Auclair, M.; Delépine, M.; Barroso, I.; et al. Perilipin Deficiency and Autosomal Dominant Partial Lipodystrophy. N. Engl. J. Med. 2011, 364, 740–748. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, M.; Griffith, L.G.; Wells, A. Growth factor regulation of proliferation and survival of multipotential stromal cells. Stem Cell Res. Ther. 2010, 1, 32. [Google Scholar] [CrossRef] [PubMed]
- Shijun, L.; Khan, R.; Raza, S.H.A.; Jieyun, H.; Chugang, M.; Kaster, N.; Gong, C.; Chunping, Z.; Schreurs, N.M.; Linsen, Z. Function and characterization of the promoter region of perilipin 1 (PLIN1): Roles of E2F1, PLAG1, C/EBPβ, and SMAD3 in bovine adipocytes. Genomics 2020, 112, 2400–2409. [Google Scholar] [CrossRef] [PubMed]
- Hong, J.; Li, S.; Wang, X.; Mei, C.; Zan, L. Study of expression analysis of SIRT4 and the coordinate regulation of bovine adipocyte differentiation by SIRT4 and its transcription factors. Biosci. Rep. 2018, 38. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D. Real-Time Quantitative PCR. Methods 2001, 25, 383–385. [Google Scholar] [CrossRef]
- Zongqian, N.; Zhiqi, S.; Luxin, Y.; Yon, T.S.; Jianli, S.; Peng, L. Fat-specific protein 27 undergoes ubiquitin-dependent degradation regulated by triacylglycerol synthesis and lipid droplet formation. J. Biol. Chem. 2010, 285, 9604–9615. [Google Scholar]
- Cao, Y.; Toh, S.Y.; Gong, J.; Du, G.; Li, J.Z.; Yang, S.; Ye, J.; Yao, H.; Zhang, Y.; Xue, B.; et al. Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice. PLoS ONE 2008, 3, e2890. [Google Scholar]
- Da, W.H.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2008, 4, 44–57. [Google Scholar]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Bioinformatics enrichment tools: Paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 2009, 37, 1–13. [Google Scholar] [CrossRef]
- Xie, C.; Mao, X.; Huang, J.; Ding, Y.; Wu, J.; Dong, S.; Kong, L.; Gao, G.; Li, C.Y.; Wei, L. KOBAS 2.0: A web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011, 39 (Suppl. S2), W316–W322. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Mao, X.; Cai, T.; Luo, J.; Wei, L. KOBAS server: A web-based platform for automated annotation and pathway identification. Nucleic Acids Res. 2006, 34, W720–W724. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402. [Google Scholar] [CrossRef] [PubMed]
- Ikura, Y.; Caldwell, S.H. Lipid droplet-associated proteins in alcoholic liver disease: A potential linkage with hepatocellular damage. Int. J. Clin. Exp. Pathol. 2015, 8, 8699–8708. [Google Scholar]
- Beate Katharina, S.; Pamela, S.; Hans, H.; Ralf, Z.; Peter, S. Differential pattern of lipid droplet-associated proteins and de novo perilipin expression in hepatocyte steatogenesis. Hepatology 2010, 47, 1936–1946. [Google Scholar]
- Krahmer, N.; Hilger, M.; Kory, N.; Wilfling, F.; Stoehr, G.; Mann, M.; Farese, R.V.; Walther, T.C. Protein Correlation Profiles Identify Lipid Droplet Proteins with High Confidence. Mol. Cell. Proteom. 2013, 12, 1115–1126. [Google Scholar] [CrossRef]
- Merkel, D.E.; Mcguire, W.L. Ploidy, proliferative activity and prognosis. DNA flow cytometry of solid tumors. Cancer 1990, 65, 1194–1205. [Google Scholar] [CrossRef]
- Corvò, R.; Giaretti, W.; Sanguineti, G.; Geido, E.; Barbieri, M. In vivo cell kinetics in head and neck squamous cell carcinoma predicts local control and helps guide radiotherapy regimen. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 1995, 13, 1843–1850. [Google Scholar] [CrossRef]
- Holm, C.; Kirchgessner, T.; Svenson, K.; Fredrikson, G.; Nilsson, S.; Miller, C.; Shively, J.; Heinzmann, C.; Sparkes, R.; Mohandas, T. Hormone-sensitive lipase: Sequence, expression, and chromosomal localization to 19 cent-q13.3. Science 1988, 241, 1503–1506. [Google Scholar] [CrossRef]
- Xia, B.; Cai, G.H.; Yang, H.; Wang, S.P.; Wu, J.W. Adipose Tissue Deficiency of Hormone-Sensitive Lipase Causes Fatty Liver in Mice. PLoS Genet. 2017, 13, e1007110. [Google Scholar] [CrossRef]
- Sztalryd, C. Perilipin A is essential for the translocation of hormone-sensitive lipase during lipolytic activation. J. Cell Biol. 2003, 161, 1093–1103. [Google Scholar] [CrossRef] [PubMed]
- Granneman, J.G.; Moore, H.P.H.; Granneman, R.L.; Greenberg, A.S.; Obin, M.S.; Zhu, Z. Analysis of Lipolytic Protein Trafficking and Interactions in Adipocytes. J. Biol. Chem. 2007, 282, 5726–5735. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Gerstein, M.; Snyder, M. RNA-Seq: A revolutionary tool for transcriptomics. Nat. Rev. Genet. 2009, 10, 57–63. [Google Scholar] [CrossRef] [PubMed]
- Shendure, J.; Ji, H. Next-generation DNA sequencing. Nat. Biotechnol. 2008, 26, 1135–1145. [Google Scholar] [CrossRef]
- Croucher, N.J.; Thomson, N.R. Studying bacterial transcriptomes using RNA-seq. Curr. Opin. Microbiol. 2010, 13, 619–624. [Google Scholar] [CrossRef]
- Park, Y.; Storkson, J.M.; Ntambi, J.M.; Cook, M.E.; Sih, C.J.; Pariza, M.W. Inhibition of hepatic stearoyl-CoA desaturase activity by trans -10, cis -12 conjugated linoleic acid and its derivatives. BBA Mol. Cell Biol. Lipids 2000, 1486, 285–292. [Google Scholar] [CrossRef]
- Hotamisligil, G.S.; Bernlohr, D.A. Metabolic functions of FABPs—mechanisms and therapeutic implications. Nat. Rev. Endocrinol. 2015, 11, 592. [Google Scholar] [CrossRef]
- Cao, W.; Xu, Y.; Luo, D.; Saeed, M.; Sun, C. Hoxa5 Promotes Adipose Differentiation via Increasing DNA Methylation Level and Inhibiting PKA/HSL Signal Pathway in Mice. Cell. Physiol. Biochem. 2018, 45, 1023–1033. [Google Scholar] [CrossRef]
- Bi, J.; Xiang, Y.; Chen, H.; Liu, Z.; Gronke, S.; Kuhnlein, R.P.; Huang, X. Opposite and redundant roles of the two Drosophila perilipins in lipid mobilization. J. Cell Sci. 2012, 125, 3568–3577. [Google Scholar] [CrossRef]
Name of shRNAs | Sense Strand (5′–3′) | Loop | Anti-Sense Strand (5′–3′) | RNA Poly III Terminator |
---|---|---|---|---|
shRNA-264 | GCCTCTGTATGCAATGCCTAC | TCAAGAG | GTAGGCATTGCATACAGAGGC | TTTTTT |
shRNA-786 | GCCAACACTCTCTCTAGACAC | TCAAGAG | GTGTCTAGAGAGAGTGTTGGC | TTTTTT |
shRNA-1337 | GATGGAACCCGAGAGCGAATT | TCAAGAG | GAATTCGCTCTCGGGTTCCATC | TTTTTT |
shRNA-NC | GTTCCACGACCAAATCAGCTC | TCAAGAG | GAGCTGATTTGGTCGTGGAAC | TTTTTT |
Gene Name | Gene Full Name | log2FoldChange (Ad/NC) | p-Value |
---|---|---|---|
ACSF2 | acyl-CoA synthetase family member 2 | 1.579670955 | 1.69E−221 |
RBP4 | retinol binding protein 4 | 0.775424841 | 6.02E−46 |
THBS3 | thrombospondin 3 | 0.828570053 | 3.32E−59 |
LUM | lumican | 0.720545336 | 1.99E−101 |
GLIPR2 | GLI pathogenesis related 2 | 0.845982741 | 1.59E−96 |
CSF1 | colony stimulating factor 1 | 1.252623086 | 1.33E−241 |
SYTL2 | synaptotagmin like 2 | 0.798285899 | 2.66E−132 |
NR4A1 | nuclear receptor subfamily 4 group A member 1 | 0.726639325 | 2.10E−33 |
PLTP | phospholipid transfer protein | 2.733646178 | 6.32E−256 |
PALLD | palladin, cytoskeletal associated protein | 0.852884845 | 2.09E−132 |
TMEM79 | transmembrane protein 79 | −0.864004155 | 6.77E−16 |
CYR61 | cysteine rich angiogenic inducer 61 | 0.961861819 | 1.90E−154 |
ZFP36L1 | ZFP36 ring finger protein like 1 | −0.455224558 | 3.95E−29 |
SPOCK2 | SPARC/osteonectin, cwcv and kazal like domains proteoglycan 2 | −1.811236856 | 9.02E−173 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, S.; Raza, S.H.A.; Zhao, C.; Cheng, G.; Zan, L. Overexpression of PLIN1 Promotes Lipid Metabolism in Bovine Adipocytes. Animals 2020, 10, 1944. https://doi.org/10.3390/ani10111944
Li S, Raza SHA, Zhao C, Cheng G, Zan L. Overexpression of PLIN1 Promotes Lipid Metabolism in Bovine Adipocytes. Animals. 2020; 10(11):1944. https://doi.org/10.3390/ani10111944
Chicago/Turabian StyleLi, Shijun, Sayed Haidar Abbas Raza, Chunping Zhao, Gong Cheng, and Linsen Zan. 2020. "Overexpression of PLIN1 Promotes Lipid Metabolism in Bovine Adipocytes" Animals 10, no. 11: 1944. https://doi.org/10.3390/ani10111944
APA StyleLi, S., Raza, S. H. A., Zhao, C., Cheng, G., & Zan, L. (2020). Overexpression of PLIN1 Promotes Lipid Metabolism in Bovine Adipocytes. Animals, 10(11), 1944. https://doi.org/10.3390/ani10111944