Antimicrobial Activity of Some Essential Oils against Methicillin-Susceptible and Methicillin-Resistant Staphylococcus pseudintermedius-Associated Pyoderma in Dogs
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Essential Oils
2.2. Chemical Composition of the Tested EOs
2.3. Phenotypic and Genotypic Identification of Bacterial Isolates
2.4. Genotypic and Phenotypic Antibiotic Resistance of Isolates
2.5. Minimum Inhibitory Concentration (MIC) and Minimal Bactericidal Concentration (MBC) Determinations
3. Results
3.1. S. pseudintermedius Strain Identification
3.2. Antibiotic Resistance Patterns of the S. pseudintermedius Isolates
3.3. Essential Oil Composition
3.4. Antibacterial Activity of the Tested Essential Oils
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Mason, I.S.; Lloyd, D.H. The role of allergy in the development of canine pyoderma. J. Small Anim. Pract. 1989, 30, 216–218. [Google Scholar] [CrossRef]
- Gómez-Sanz, E.; Torres, C.; Ceballos, S.; Lozano, C.; Zarazaga, M. Clonal dynamics of nasal Staphylococcus aureus and Staphylococcus pseudintermedius in dog-owning household members. Detection of MSSA ST(398). PLoS ONE 2013, 8, e69337. [Google Scholar] [CrossRef] [PubMed]
- Loeffler, A.; Linek, M.; Moodley, A.; Guardabassi, L.; Sung, J.M.L.; Winkler, M.; Weiss, R.; Lloyd, D.H. First report of multiresistant, mecA-positive Staphylococcus intermedius in Europe: 12 cases from a veterinary dermatology referral clinic in Germany. Vet. Dermatol. 2007, 18, 412–421. [Google Scholar] [CrossRef] [PubMed]
- van Duijkeren, E.; Catry, B.; Greko, C.; Moreno, M.A.; Pomba, M.C.; Pyorala, S.; Ruzauskas, M.; Sanders, P.; Threlfall, E.J.; Torren-Edo, J.; et al. Review on methicillin-resistant Staphylococcus pseudintermedius. J. Antimicrob Chemother. 2011, 66, 2705–2714. [Google Scholar] [CrossRef]
- Kasai, T.; Saegusa, S.; Shirai, M.; Murakami, M.; Kato, Y. New categories designated as healthcare-associated and community-associated methicillin-resistant Staphylococcus pseudintermedius in dogs. Microbiol. Immunol. 2016, 60, 540–551. [Google Scholar] [CrossRef]
- Perreten, V.; Kadlec, K.; Schwarz, S.; Gronlund Andersson, U.; Finn, M.; Greko, C.; Moodley, A.; Kania, S.A.; Frank, L.A.; Bemis, D.A.; et al. Clonal spread of methicillin-resistant Staphylococcus pseudintermedius in Europe and North America: An international multicentre study. J. Antimicrob Chemother. 2010, 65, 1145–1154. [Google Scholar] [CrossRef]
- Sim, J.X.F.; Khazandi, M.; Pi, H.; Venter, H.; Trott, D.J.; Deo, P. Antimicrobial effects of cinnamon essential oil and cinnamaldehyde combined with EDTA against canine otitis externa pathogens. J. Appl. Microbiol. 2019, 127, 99–108. [Google Scholar] [CrossRef]
- Piotr, S.; Magdalena, Z.; Joanna, P.; Barbara, K.; Sławomir, M. Essential oils as potential anti-staphylococcal agents. Acta Vet. Brno 2018, 68, 95–107. [Google Scholar] [CrossRef]
- Duangkaew, L.; Larsuprom, L.; Lekcharoensuk, C.; Chen, C. Effect of a mixture of essential oils and a plant-based extract for the management of localized superficial pyoderma in dogs: An open-label clinical trial. Thai J. Vet. Med. 2017, 47, 513–522. [Google Scholar]
- Swamy, M.K.; Akhtar, M.S.; Sinniah, U.R. Antimicrobial properties of plant essential oils against human pathogens and their mode of action: An updated review. Evid.-Based Complement. Altern. Med. 2016, 3012462. [Google Scholar] [CrossRef]
- Nieto, G. Biological activities of three essential oils of the Lamiaceae family. Medicines 2017, 4, 63. [Google Scholar] [CrossRef] [PubMed]
- Fratini, F.; Mancini, S.; Turchi, B.; Friscia, E.; Pistelli, L.; Giusti, G.; Cerri, D. A novel interpretation of the Fractional Inhibitory Concentration Index: The case Origanum vulgare L. and Leptospermum scoparium J. R. et G. Forst essential oils against Staphylococcus aureus strains. Microbiol. Res. 2017, 195, 11–17. [Google Scholar] [CrossRef] [PubMed]
- Song, C.Y.; Nam, E.H.; Park, S.H.; Hwang, C.Y. In vitro efficacy of the essential oil from Leptospermum scoparium (manuka) on antimicrobial susceptibility and biofilm formation in Staphylococcus pseudintermedius isolates from dogs. Vet. Dermatol. 2013, 24, 404-e87. [Google Scholar] [CrossRef] [PubMed]
- Auda, S.H.; Salem-Bekhit, M.M.; Alanazi, F.K.; Alsarra, I.A.; Shakeel, F. Antimicrobial evaluation of novel buccoadhesive films containing Myrrh extract. Polym. Bull. 2017, 74, 4041–4054. [Google Scholar] [CrossRef]
- Murthy, K.S.R.; Reddy, M.C.; Rani, S.S.; Pullaiah, T. Bioactive principles and biological properties of essential oils of Burseraceae: A review. J. Pharmacogn. Phytochem. 2016, 5, 247–258. [Google Scholar]
- Zhang, Y.; Liu, X.; Wang, Y.; Jiang, P.; Quek, S. Antibacterial activity and mechanism of cinnamon essential oil against Escherichia coli and Staphylococcus aureus. Food Control. 2016, 59, 282–289. [Google Scholar] [CrossRef]
- Gupta, A.K.; Muhury, R.; Ganjewala, D. A Study on antimicrobial activities of essential oils of different cultivars of lemongrass (Cymbopogon flexuosus). Pharm. Sci. 2016, 22, 164–169. [Google Scholar] [CrossRef]
- Bey-Ould Si Said, Z.; Haddadi-Guemghar, H.; Boulekbache-Makhlouf, L.; Rigou, P.; Remini, H.; Adjaoud, A.; Khoudja, N.K.; Madani, K. Essential oils composition, antibacterial and antioxidant activities of hydrodistillated extract of Eucalyptus globulus fruits. Ind. Crops Prod. 2016, 89, 167–175. [Google Scholar] [CrossRef]
- Oliva, M.d.L.M.; Carezzano, M.E.; Gallucci, M.N.; Freytes, S.A.; Zygadlo, J.A.; Demo, M.S. Growth inhibition and morphological alterations of Staphylococcus aureus caused by the essential oil of Aloysia triphylla. Boletín Latinoam y Del Caribe Plantas Med. y Aromáticas. 2015, 14, 83–91. [Google Scholar]
- Rossi, P.G.; Berti, L.; Panighi, J.; Luciani, A.; Maury, J.; Muselli, A.; de Rocca Serra, D.; Gonny, M.; Bolla, J.M. Antibacterial action of essential oils from Corsica. J. Essent. Oil Res. 2007, 19, 176–182. [Google Scholar] [CrossRef]
- Dosoky, N.; Setzer, W. Biological activities and safety of Citrus spp. essential oils. Int. J. Mol. Sci. 2018, 19, 1966. [Google Scholar] [CrossRef]
- Azhdarzadeh, F.; Hojjati, M. Chemical composition and antimicrobial activity of leaf, ripe and unripe peel of bitter orange (Citrus aurantium) essential oils. Nutr. Food Sci. Res. 2016, 3, 43–50. [Google Scholar] [CrossRef]
- Iseppi, R.; Brighenti, V.; Licata, M.; Lambertini, A.; Sabia, C.; Messi, P.; Pellati, F.; Benvenuti, S. Chemical characterization and evaluation of the antibacterial activity of essential oils from fibre-type Cannabis sativa L. (Hemp). Molecules 2019, 24, 2302. [Google Scholar] [CrossRef] [PubMed]
- Adams, R.P. Identification of essential oil components by gas chromatography/quadrupole mass spectroscopy, 3rd ed.; Allured Publishing Corporation: Carol Stream, IL, USA, 1995. [Google Scholar]
- Davies, N.W. Gas chromatographic retention indices of monoterpenes and sesquiterpenes on methyl silicon and Carbowax 20M phases. J. Chromatogr. A. 1990, 503, 1–24. [Google Scholar] [CrossRef]
- Jennings, W.; Shibamoto, T. Qualitative Analysis of Flavor and Fragrance Volatiles by Glass Capillary Gas Chromatography; Food/Nahrung Academic Press: New York, NY, USA, 1982. [Google Scholar]
- Masada, Y. Analysis of Essential Oils by Gas Chromatography and Mass Spectrometry; Wiley: New York, NY, USA, 1976. [Google Scholar]
- Stenhagen, E.; Abrahamsson, S.; McLafferty, F.W. Registry of Mass Spectral Data; Wiley: New York, NY, USA, 1974. [Google Scholar]
- Swigar, A.A.; Silverstein, R.M. Monoterpenes; Aldrich Chemical Company: Milwaukee, WI, USA, 1981. [Google Scholar]
- Santos, A.F.; Cayô, R.; Schandert, L.; Gales, A.C. Evaluation of MALDI-TOF MS in the microbiology laboratory. J. Bras. Patol. Med. Lab. 2013, 49, 191–197. [Google Scholar] [CrossRef]
- Sasaki, T.; Tsubakishita, S.; Tanaka, Y.; Sakusabe, A.; Ohtsuka, M.; Hirotaki, S.; Hirotaki, S.; Kawakami, T.; Fukata, T.; Hiramatsu, K. Multiplex-PCR method for species identification of coagulase-positive staphylococci. J. Clin. Microbiol. 2010, 48, 765–769. [Google Scholar] [CrossRef] [PubMed]
- Kmieciak, W.; Szewczyk, E.M.; Ciszewski, M. Searching for beta-haemolysin hlb gene in Staphylococcus pseudintermedius with species-specific primers. Curr. Microbiol. 2016, 73, 148–152. [Google Scholar] [CrossRef] [PubMed]
- Chovanová, R.; Mikulášová, M.; Vaverková, Š. Modulation of mecA gene expression by essential oil from Salvia sclarea and synergism with oxacillin in methicillin resistant Staphylococcus epidermidis carrying different types of staphylococcal chromosomal cassette mec. Int. J. Microbiol. 2016, 2016, 6475837. [Google Scholar] [CrossRef] [PubMed]
- CLSI. Performance Standard for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 3rd ed.; Clinical Laboratory and Standards Institute: Wayne, PA, USA, 2015. [Google Scholar]
- EUCAST. The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 7.1. 2017. Available online: http://www.eucast.org (accessed on 10 March 2017).
- Wiegand, I.; Hilpert, K.; Hancock, R.E.W. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat. Protoc. 2008, 3, 163–175. [Google Scholar] [CrossRef]
- Asif Saeed, M.; Sabir, A.W. Antibacterial activities of some constituents from oleo-gum-resin of Commiphora mukul. Fitoterapia 2004, 75, 204–208. [Google Scholar] [CrossRef]
- Fratini, F.; Mancini, S.; Turchi, B.; Sparagni, D.; Abd Al-Gwad, A.; Najar, B.; Pistelli, L.; Cerri, D.; Pedonese, F. Antimicrobial activity of three essential oils (cinnamon, manuka, an winter savory), and their synergic interaction against Listeria monocytogenes. Flavour Fragr. J. 2019, 34, 339–348. [Google Scholar] [CrossRef]
- Soedarmanto, I.; Kanbar, T.; Ülbegi-Mohyla, H.; Hijazin, M.; Alber, J.; Lämmler, C.; Akineden, Ӧ.; Weiss, R.; Moritz, A.; Zschӧck, M. Genetic relatedness of methicillin-resistant Staphylococcus pseudintermedius (MRSP) isolated from a dog and the dog owner. Res. Vet. Sci. 2011, 91, e25-7. [Google Scholar] [CrossRef] [PubMed]
- Abdulla, E.H.; Abdoun, M.A.; Mahmoud, W.S.; Alhamdani, F. Antibacterial activity of crude Cinnamomum zeylanicum ethanol extract on bacterial isolates from orofacial infections. Acta Sci. Dent. Sci. 2019, 3, 58–63. [Google Scholar] [CrossRef]
- Salma, U.; Saha, S.K.; Sultana, S.; Ahmed, S.M.; Haque, S.D.; Mostaqim, S. The antibacterial activity of ethanolic extract of cinnamon (Cinnamomum zeylanicum) against to food borne pathogens: Staphylococcus aureus and Escherichia coli. Mymensing Med. J. 2019, 28, 767–772. [Google Scholar]
- Gupta, A.; Duhan, J.; Tewari, S.; Sangwan, P.; Yadav, A.; Singh, G.; Juneja, R.; Saini, H. Comparative evaluation of antimicrobial efficacy of Syzygium aromaticum, Ocimum sanctum and Cinnamomum zeylanicum plant extracts against Enterococcus faecalis: A preliminary study. Int. Endod. J. 2013, 46, 775–783. [Google Scholar] [CrossRef]
- Ehsani, A.; Alizadeh, O.; Hashemi, M.; Afshari, A.; Aminzare, M. Phytochemical, antioxidant and antibacterial properties of Melissa officinalis and Dracocephalum moldavica essential oils. Vet. Res. Forum 2017, 8, 223–229. [Google Scholar]
- Klüga, A.; Terentjeva, M.; Kántor, A.; Kluz, M.; Puchalski, C.; Kačániová, M. Antibacterial activity of Melissa officinalis L., Mentha piperita L., Origanum vulgare L. and Malva mauritiana against bacterial microflora isolated from fish. Adv. Res. Life Sci. 2017, 1, 75–80. [Google Scholar] [CrossRef]
- Pirbalouti, A.G.; Nekoei, M.; Rahimmalek, M.; Malekpoor, F. Chemical composition and yield of essential oil from lemon balm (Melissa officinalis L.) under foliar applications of jasmonic and salicylic acids. Biocatal. Agric. Biotechnol. 2019, 19, 101144. [Google Scholar] [CrossRef]
- Lis-Balchin, M.; Hart, S.L.; Deans, S.G. Pharmacological and antimicrobial studies on different tea-tree oils (Melaleuca alternifolia, Leptospermum scoparium or Manuka and Kunzea ericoides or Kanuka), originating in Australia and New Zealand. Phyther. Res. 2000, 14, 623–629. [Google Scholar] [CrossRef]
| Gene | Primer Sequences | Amplicon Size (bp) | Amplification Program |
|---|---|---|---|
| nuc | F: TRGGCAGTAGGATTCGTTAA R: CTTTTGTGCTYCMTTTTGG | 926 | 94 °C 5 min; 94 °C 30 s, 58 °C 60 s, 72 °C 90 s, for 30 cycles; 72 °C 5 min. |
| hlb | F: GACGAAAATCAAGCGGAA R: TCTAAATACTCTGGCGCAC | 734 | 94 °C 2.5 min; 94 °C 30 s, 56 °C 30 s, 72 °C 1 min, for 30 cycles; 72 °C 10 min. |
| mecA | F: TCCACCCTCAAACAGGTGAA R: GGAACTTGTTGAGCAGAGGT | 139 | 94 °C 5 min; 94 °C 30 s, 55 °C 40 s, 72 °C 30 s, for 30 cycles; 72 °C 5 min. |
| Antibiotics | Isolates | |||||||
|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | |
| AMC | R | R | R | R | R | R | S | R |
| AMP | R | R | R | R | R | R | R | R |
| CRO | R | R | R | R | S | S | S | S |
| CD | S | R | R | R | S | S | S | S |
| CIP | R | R | R | R | S | S | S | S |
| E | R | R | R | R | S | S | R | S |
| ENR | R | R | R | S | S | S | S | S |
| CN | S | R | R | S | S | S | S | S |
| IMI | S | R | R | R | S | R | S | S |
| LNZ | S | S | S | S | S | S | S | S |
| OX | R | R | R | R | S | S | S | S |
| P | R | R | R | R | R | R | R | R |
| S | R | R | R | S | R | S | R | S |
| SXT | R | R | R | R | S | S | S | R |
| TE | R | R | R | S | R | R | R | S |
| TOB | S | R | R | S | S | S | S | S |
| VA | S | S | S | S | S | S | S | S |
| Compounds | LRI 1 | Class 2 | At | Ca | Cc | Cm | Cs | Cz | Eg | Ls | Mo | Ob | Sm |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| α-Pinene | 939 | mh | 1.1 | 1.2 | 0.2 | 6.2 | 0.3 | 2.3 | 1.6 | 0.5 | 0.9 | ||
| Sabinene | 975 | mh | 26.0 | 0.6 | 0.5 | ||||||||
| β-Pinene | 979 | mh | 2.8 | 0.1 | 0.1 | 1.1 | |||||||
| 6-Methyl-5-hepten-2-one | 986 | nt | 0.2 | 1.5 | 1.0 | ||||||||
| Myrcene | 991 | mh | 0.5 | 3.5 | 16.1 | 0.1 | 0.2 | 0.2 | 0.9 | 1.3 | |||
| α-Terpinene | 1017 | mh | 0.2 | 0.3 | 1.3 | ||||||||
| p-Cymene | 1025 | mh | 0.5 | 1.3 | 0.3 | 10.3 | |||||||
| o-Cymene | 1026 | mh | 0.1 | 8.0 | 0.2 | ||||||||
| Limonene | 1029 | mh | 31.1 | 92.6 | 1.5 | 0.4 | 2.0 | 4.3 | 0.1 | 0.5 | 3.0 | ||
| β-Phellandrene | 1030 | mh | 1.7 | ||||||||||
| 1,8-Cineole | 1033 | om | 6.1 | 0.2 | 84.2 | 10.7 | |||||||
| (Z)-β-Ocimene | 1037 | mh | 0.1 | 0.1 | 1.2 | ||||||||
| (E)-β-Ocimene | 1050 | mh | 2.4 | 7.1 | 0.2 | 0.4 | |||||||
| γ-Terpinene | 1060 | mh | 0.2 | 0.2 | 6.2 | ||||||||
| Terpinolene | 1089 | mh | 14.2 | 0.1 | |||||||||
| Linalool | 1097 | om | 3.4 | 0.5 | 1.1 | 3.1 | 0.1 | 0.3 | 46.0 | 1.5 | |||
| Citronellal | 1158 | om | 11.2 | 0.6 | 8.1 | ||||||||
| Borneol | 1169 | om | 3.0 | ||||||||||
| Isoneral | 1170 | om | 0.8 | 1.2 | |||||||||
| 4-Terpineol | 1177 | om | 0.8 | 0.1 | 0.2 | 0.2 | 1.6 | ||||||
| Isogeranial | 1185 | om | 1.1 | 1.8 | |||||||||
| α-Terpineol | 1189 | om | 0.6 | 0.2 | 0.6 | 0.8 | 1.4 | ||||||
| Estragole | 1196 | pp | 1.3 | ||||||||||
| trans-Isopiperitenol | 1210 | om | 1.5 | ||||||||||
| Citronellol | 1226 | om | 3.3 | 0.5 | 2.0 | ||||||||
| Neral | 1238 | om | 0.8 | 32.6 | 29.0 | ||||||||
| iso-Thymol methyl ether | 1244 | om | 5.2 | ||||||||||
| Geraniol | 1253 | om | 0.1 | 5.0 | 1.8 | ||||||||
| Geranial | 1267 | om | 1.4 | 40.1 | 36.5 | ||||||||
| (E)-Cinnamaldehyde | 1270 | nt | 63.2 | ||||||||||
| Bornyl acetate | 1289 | om | 1.3 | ||||||||||
| Thymol | 1290 | om | 7.0 | ||||||||||
| Carvacrol | 1299 | om | 45.4 | ||||||||||
| α-Cubebene | 1351 | sh | 3.3 | ||||||||||
| Eugenol | 1359 | pp | 3.5 | 2.3 | |||||||||
| α-Copaene | 1377 | sh | 0.2 | 0.7 | 5.2 | 0.1 | 0.3 | 0.3 | |||||
| Geranyl acetate | 1381 | om | 0.6 | 4.5 | 1.7 | ||||||||
| β-Elemene | 1391 | sh | 6.9 | 3.4 | |||||||||
| β-Caryophyllene | 1419 | sh | 1.5 | 2.4 | 0.4 | 20.8 | 6.2 | 0.5 | 9.0 | 0.4 | 3.5 | ||
| trans-α-Bergamotene | 1435 | sh | 1.9 | 8.0 | |||||||||
| α-Guaiene | 1440 | sh | 2.6 | 1.1 | 0.3 | ||||||||
| Cinnamyl acetate | 1445 | nt | 3.5 | ||||||||||
| α-Humulene | 1455 | sh | 0.2 | 0.2 | 6.9 | 1.2 | 0.5 | 1.0 | |||||
| (E)-β-Farnesene | 1457 | sh | 2.1 | 0.1 | |||||||||
| γ-Muurolene | 1480 | sh | 1.8 | 0.2 | |||||||||
| Germacrene D | 1485 | sh | 1.5 | 1.5 | 3.5 | ||||||||
| β-Selinene | 1490 | sh | 0.9 | 1.2 | 3.9 | 0.2 | |||||||
| α-Selinene | 1494 | sh | 0.8 | 1.0 | 3.3 | ||||||||
| Curzerene | 1495 | sh | 17.5 | ||||||||||
| trans-β-Guaiene | 1503 | sh | 1.1 | ||||||||||
| α-Bulnesene | 1510 | sh | 0.8 | 2.2 | |||||||||
| γ-Cadinene | 1513 | sh | 6.2 | ||||||||||
| trans-γ-Cadinene | 1514 | sh | 1.6 | 3.8 | |||||||||
| cis-Calamenene | 1540 | sh | 22.7 | ||||||||||
| Selina-3,7(11)-diene | 1542 | sh | 1.8 | ||||||||||
| Flavesone | 1547 | nt | 7.2 | ||||||||||
| Germacrene B | 1561 | sh | 5.2 | 0.7 | |||||||||
| Spathulenol | 1578 | os | 1.2 | 0.2 | |||||||||
| Caryophyllene oxide | 1583 | os | 1.0 | 3.5 | 1.3 | 0.6 | |||||||
| Globulol | 1585 | os | 0.1 | 2.8 | |||||||||
| iso-Leptospermone | 1621 | os | 7.0 | ||||||||||
| Leptospermone | 1629 | os | 19.2 | ||||||||||
| epi-α-Cadinol | 1640 | os | 3.1 | ||||||||||
| t-Cadinol | 1643 | os | 1.4 | ||||||||||
| Furanoeudesma-1,3-diene | 1645 | os | 33.7 | ||||||||||
| Lindestrene | 1652 | os | 11.9 | ||||||||||
| cis-Calamene-10-o | 1661 | os | 1.0 | ||||||||||
| Atractylone | 1669 | os | 9.8 | ||||||||||
| cadalene | 1676 | sh | 1.0 | ||||||||||
| Germacrone | 1694 | os | 1.0 | ||||||||||
| (R,5E,9E)-8-Methoxy-3,6,10-trimethyl-4,7,8,11-tetrahydrocyclodeca[b]furan | 1733 | os | 5.6 | ||||||||||
| Benzyl benzoate | 1760 | nt | 2.6 | ||||||||||
| m-Camphorene | 1960 | dh | 1.5 | ||||||||||
| Pentacosane | 2500 | nt | 1.5 | ||||||||||
| 2Class of Compounds | |||||||||||||
| Monoterpene hydrocarbons (mh) | 62.1 | 98.5 | 2.6 | 0.4 | 51.4 | 4.4 | 14.8 | 2.1 | 0.5 | 4.3 | 23 | ||
| Oxygenated monoterpenes (om) | 34.6 | 0.5 | 88.4 | 0.5 | 3.9 | 84.8 | 0.1 | 85.3 | 59.8 | 65.1 | |||
| Sesquiterpene hydrocarbons (sh) | 1.9 | 0.6 | 4.6 | 36.2 | 38.7 | 14.5 | 0.2 | 45.4 | 11.3 | 27.6 | 4.5 | ||
| Oxygenated sesquiterpenes (os) | 1.2 | 63.2 | 4.4 | 1.4 | 0.1 | 32.6 | 0.7 | 3.8 | |||||
| Diterpenes hydrocarbons (dh) | 2.1 | ||||||||||||
| Oxygenated diterpenes (od) | 0.1 | 0.4 | |||||||||||
| Phenylpropanoids (pp) | 0.2 | 3.5 | 3.8 | ||||||||||
| Non-terpene derivatives (nt) | 1.3 | 0.4 | 2.8 | 1.6 | 71.7 | 7.2 | 1.8 | 0.2 | |||||
| Total compounds identified | 99.9 | 100 | 99.9 | 99.8 | 99.1 | 99.4 | 99.9 | 87.6 | 99.6 | 99.5 | 92.6 |
| Isolates | At | Ca | Cc | Cm | Cs | Cz | Eg | Ls | Mo | Ob | Sm |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 1:32 | 1:32 | 1:256 | 1:64 | 1:16 | 1:1024 | 1:128 | 1:512 | 1:1024 | 1:32 | 1:512 |
| 2 | 1:32 | 1:32 | 1:256 | 1:64 | 1:16 | 1:1024 | 1:256 | 1:512 | 1:512 | 1:64 | 1:256 |
| 3 | 1:32 | 1:32 | 1:256 | 1:64 | 1:16 | 1:1024 | 1:256 | 1:1024 | 1:1024 | 1:32 | 1:512 |
| 4 | 1:32 | 1:32 | 1:256 | 1:64 | 1:16 | 1:1024 | 1:256 | 1:1024 | 1:1024 | 1:64 | 1:512 |
| 5 | 1:32 | 1:32 | 1:1024 | 1:256 | 1:32 | 1:1024 | 1:64 | 1:1024 | 1:1024 | 1:64 | 1:1024 |
| 6 | 1:64 | 1:64 | 1:1024 | 1:256 | 1:32 | 1:1024 | 1:64 | 1:512 | 1:1024 | 1:64 | 1:512 |
| 7 | 1:128 | 1:32 | 1:1024 | 1:256 | 1:32 | 1:1024 | 1:64 | 1:1024 | 1:1024 | 1:64 | 1:1024 |
| 8 | 1:64 | 1:32 | 1:1024 | 1:256 | 1:32 | 1:1024 | 1:128 | 1:512 | 1:2048 | 1:64 | 1:512 |
| Isolates | At | Ca | Cc | Cm | Cs | Cz | Eg | Ls | Mo | Ob | Sm |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 1:16 | 1:16 | 1:256 | 1:32 | 1:8 | 1:1024 | 1:64 | 1:256 | 1:512 | 1:16 | 1:256 |
| 2 | 1:32 | 1:16 | 1:256 | 1:64 | 1:8 | 1:1024 | 1:256 | 1:256 | 1:512 | 1:32 | 1:128 |
| 3 | 1:16 | 1:16 | 1:256 | 1:32 | 1:8 | 1:1024 | 1:128 | 1:512 | 1:512 | 1:16 | 1:256 |
| 4 | 1:32 | 1:16 | 1:256 | 1:64 | 1:8 | 1:512 | 1:128 | 1:512 | 1:512 | 1:32 | 1:256 |
| 5 | 1:32 | 1:16 | 1:512 | 1:128 | 1:8 | 1:512 | 1:64 | 1:512 | 1:1024 | 1:32 | 1:512 |
| 6 | 1:32 | 1:32 | 1:1024 | 1:128 | 1:8 | 1:1024 | 1:64 | 1:256 | 1:512 | 1:32 | 1:256 |
| 7 | 1:64 | 1:16 | 1:512 | 1:128 | 1:16 | 1:512 | 1:64 | 1:512 | 1:1024 | 1:32 | 1:512 |
| 8 | 1:32 | 1:16 | 1:1024 | 1:128 | 1:8 | 1:1024 | 1:64 | 1:256 | 1:1024 | 1:32 | 1:256 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nocera, F.P.; Mancini, S.; Najar, B.; Bertelloni, F.; Pistelli, L.; De Filippis, A.; Fiorito, F.; De Martino, L.; Fratini, F. Antimicrobial Activity of Some Essential Oils against Methicillin-Susceptible and Methicillin-Resistant Staphylococcus pseudintermedius-Associated Pyoderma in Dogs. Animals 2020, 10, 1782. https://doi.org/10.3390/ani10101782
Nocera FP, Mancini S, Najar B, Bertelloni F, Pistelli L, De Filippis A, Fiorito F, De Martino L, Fratini F. Antimicrobial Activity of Some Essential Oils against Methicillin-Susceptible and Methicillin-Resistant Staphylococcus pseudintermedius-Associated Pyoderma in Dogs. Animals. 2020; 10(10):1782. https://doi.org/10.3390/ani10101782
Chicago/Turabian StyleNocera, Francesca Paola, Simone Mancini, Basma Najar, Fabrizio Bertelloni, Luisa Pistelli, Anna De Filippis, Filomena Fiorito, Luisa De Martino, and Filippo Fratini. 2020. "Antimicrobial Activity of Some Essential Oils against Methicillin-Susceptible and Methicillin-Resistant Staphylococcus pseudintermedius-Associated Pyoderma in Dogs" Animals 10, no. 10: 1782. https://doi.org/10.3390/ani10101782
APA StyleNocera, F. P., Mancini, S., Najar, B., Bertelloni, F., Pistelli, L., De Filippis, A., Fiorito, F., De Martino, L., & Fratini, F. (2020). Antimicrobial Activity of Some Essential Oils against Methicillin-Susceptible and Methicillin-Resistant Staphylococcus pseudintermedius-Associated Pyoderma in Dogs. Animals, 10(10), 1782. https://doi.org/10.3390/ani10101782

