Recombinase Polymerase Amplification Based Multiplex Lateral Flow Dipstick for Fast Identification of Duck Ingredient in Adulterated Beef
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Preparation and DNA Extraction
2.2. RPA Primer and Probe Design
2.3. Preparation of AuNPs and AuNP-FITC Conjugates
2.4. Preparation of Lateral Flow Dipsticks
2.5. RPA for DNA Amplification
2.6. Detection of Processed Meat Samples with RPA-MLFD
3. Results and Discussion
3.1. Design of RPA-MLFD Assay
3.2. Specificity and Optimization of RPA-MLFD Assay
3.3. Sensitivity of RPA-MLFD Assay
3.4. Application of RPA-MLFD in Processed Meat Samples
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Lee, S.-Y.; Kim, M.-J.; Hong, Y.; Kim, H.-Y. Development of a rapid on-site detection method for pork in processed meat products using real-time loop-mediated isothermal amplification. Food Control 2016, 66, 53–61. [Google Scholar] [CrossRef]
- Research Report on the Market Status and Development Prospect of Beef Industry in 2018 (in Chinese). Available online: https://wk.askci.com/details/79734402b7dc4659b7669fb3836236f5/ (accessed on 23 November 2018).
- Cabrera, M.C.; Saadoun, A. An overview of the nutritional value of beef and lamb meat from South America. Meat Sci. 2014, 98, 435–444. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Guan, Y. Specific identification of the adulterated components in beef or mutton meats using multiplex PCR. J. AOAC Int. 2019, 102, 1181–1185. [Google Scholar] [CrossRef] [PubMed]
- Nau, J.Y. mad cow: The new and problematic British epidemiologic situation. Rev. Med. Suisse 2013, 9, 2018–2019. [Google Scholar]
- Qin, P.; Qu, W.; Xu, J.; Qiao, D.; Yao, L.; Xue, F.; Chen, W. A sensitive multiplex PCR protocol for simultaneous detection of chicken, duck, and pork in beef samples. J. Food Sci. Technol. 2019, 56, 1266–1274. [Google Scholar] [CrossRef]
- Skouridou, V.; Tomaso, H.; Rau, J.; Bashammakh, A.S.; El-Shahawi, M.S.; Alyoubi, A.O.; O’Sullivan, C.K. Duplex PCR-ELONA for the detection of pork adulteration in meat products. Food Chem. 2019, 287, 354–362. [Google Scholar] [CrossRef]
- Shocking! How Can Duck Meat be Changed into Beef and Learn to Differentiate Them (in Chinese). Available online: https://www.sohu.com/a/123007605_581978 (accessed on 30 December 2016).
- Behind “Duck Posing as Beef”, You Can’t Imagine How Cheap Duck Meat is Now (in Chinese). Available online: https://www.sohu.com/a/126272705_616821 (accessed on 15 February 2017).
- Bohme, K.; Calo-Mata, P.; Barros-Velazquez, J.; Ortea, I. Review of recent DNA-based methods for main food-authentication topics. J. Agric. Food Chem. 2019, 67, 3854–3864. [Google Scholar] [CrossRef]
- Hsieh, Y.H.; Ofori, J.A. Detection of horse meat contamination in raw and heat-processed meat products. J. Agric. Food Chem. 2014, 62, 12536–12544. [Google Scholar] [CrossRef]
- Jiang, X.; Fuller, D.; Hsieh, Y.P.; Rao, Q. Monoclonal antibody-based ELISA for the quantification of porcine hemoglobin in meat products. Food Chem. 2018, 250, 170–179. [Google Scholar] [CrossRef]
- Mandli, J.; El Fatimi, I.; Seddaoui, N.; Amine, A. Enzyme immunoassay (ELISA/immunosensor) for a sensitive detection of pork adulteration in meat. Food Chem. 2018, 255, 380–389. [Google Scholar] [CrossRef]
- Prusakova, O.V.; Glukhova, X.A.; Afanas’eva, G.V.; Trizna, Y.A.; Nazarova, L.F.; Beletsky, I.P. A simple and sensitive two-tube multiplex PCR assay for simultaneous detection of ten meat species. Meat Sci. 2018, 137, 34–40. [Google Scholar] [CrossRef] [PubMed]
- Kaltenbrunner, M.; Hochegger, R.; Cichna-Markl, M. Development and validation of a fallow deer (dama dama)-specific TaqMan real-time PCR assay for the detection of food adulteration. Food Chem. 2018, 243, 82–90. [Google Scholar] [CrossRef] [PubMed]
- Xu, R.; Wei, S.; Zhou, G.; Ren, J.; Liu, Z.; Tang, S.; Cheung, P.C.K.; Wu, X. Multiplex TaqMan locked nucleic acid real-time PCR for the differential identification of various meat and meat products. Meat Sci. 2018, 137, 41–46. [Google Scholar] [CrossRef] [PubMed]
- Piepenburg, O.; Williams, C.H.; Stemple, D.L.; Armes, N.A. DNA detection using recombination proteins. PLoS Biol. 2006, 4, e204. [Google Scholar] [CrossRef]
- Du, X.J.; Zang, Y.X.; Liu, H.B.; Li, P.; Wang, S. Recombinase polymerase amplification combined with lateral flow strip for listeria monocytogenes detection in food. J. Food Sci. 2018, 83, 1041–1047. [Google Scholar] [CrossRef]
- Daher, R.K.; Stewart, G.; Boissinot, M.; Boudreau, D.K.; Bergeron, M.G. Influence of sequence mismatches on the specificity of recombinase polymerase amplification technology. Mol. Cell. Probes 2015, 29, 116–121. [Google Scholar] [CrossRef]
- Babu, B.; Ochoa-Corona, F.M.; Paret, M.L. Recombinase polymerase amplification applied to plant virus detection and potential implications. Anal. Biochem. 2018, 546, 72–77. [Google Scholar] [CrossRef]
- Yan, L.; Zhou, J.; Zheng, Y.; Gamson, A.S.; Roembke, B.T.; Nakayama, S.; Sintim, H.O. Isothermal amplified detection of DNA and RNA. Mol. Biosyst. 2014, 10, 970–1003. [Google Scholar] [CrossRef]
- Garrido-Maestu, A.; Azinheiro, S.; Carvalho, J.; Prado, M. Combination of immunomagnetic separation and real-time recombinase polymerase amplification (IMS-qRPA) for specific detection of listeria monocytogenes in smoked salmon samples. J. Food Sci. 2019, 84, 1881–1887. [Google Scholar] [CrossRef]
- Lei, R.; Kong, J.; Qiu, Y.; Chen, N.; Zhu, S.; Wang, X.; Wu, P. Rapid detection of the pathogenic fungi causing blackleg of brassica napus using a portable real-time fluorescence detector. Food Chem. 2019, 288, 57–67. [Google Scholar] [CrossRef]
- Li, J.; Ma, B.; Fang, J.; Zhi, A.; Chen, E.; Xu, Y.; Yu, X.; Sun, C.; Zhang, M. Recombinase polymerase amplification (RPA) combined with lateral flow immunoassay for rapid detection of salmonella in food. Foods 2019, 9, 27. [Google Scholar] [CrossRef] [PubMed]
- Feng, T.; Li, S.; Wang, S.; Pan, J. Cross priming amplification with nucleic acid test strip analysis of mutton in meat mixtures. Food Chem. 2018, 245, 641–645. [Google Scholar] [CrossRef] [PubMed]
- Magiati, M.; Myridaki, V.M.; Christopoulos, T.K.; Kalogianni, D.P. Lateral flow test for meat authentication with visual detection. Food Chem. 2019, 274, 803–807. [Google Scholar] [CrossRef] [PubMed]
- Qin, P.; Qiao, D.; Xu, J.; Song, Q.; Yao, L.; Lu, J.; Chen, W. Rapid visual sensing and quantitative identification of duck meat in adulterated beef with a lateral flow strip platform. Food Chem. 2019, 294, 224–230. [Google Scholar] [CrossRef] [PubMed]
- Gao, W.; Huang, H.; Zhu, P.; Yan, X.; Fan, J.; Jiang, J.; Xu, J. Recombinase polymerase amplification combined with lateral flow dipstick for equipment-free detection of salmonella in shellfish. Bioprocess Biosyst. Eng. 2018, 41, 603–611. [Google Scholar] [CrossRef]
- Ebbehoj, K.F.; Thomsen, P.D. Species differentiation of heated meat products by DNA hybridization. Meat Sci. 1991, 30, 221–234. [Google Scholar] [CrossRef]
- Frens, G. Controlled nucleation for regulation of particle-size in monodisperse gold suspensions. Nat. Phys. Sci. 1973, 241, 20–22. [Google Scholar] [CrossRef]
- Barakat, H.; El-Garhy, H.A.; Moustafa, M.M. Detection of pork adulteration in processed meat by species-specific PCR-qiaxcel procedure based on D-loop and cytb genes. Appl. Microbiol. Biotechnol. 2014, 98, 9805–9816. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Zheng, K.; Jiang, J.; Wu, J.; Shi, F.; Song, X.; Jiang, Y. A novel method to detect meat adulteration by recombinase polymerase amplification and SYBR green I. Food Chem. 2018, 266, 73–78. [Google Scholar] [CrossRef]
- Wu, Q.; Xiang, S.; Wang, W.; Zhao, J.; Xia, J.; Zhen, Y.; Liu, B. Species identification of fox-, mink-, dog-, and rabbit-derived ingredients by multiplex PCR and real-time PCR assay. Appl. Biochem. Biotechnol. 2018, 185, 1–12. [Google Scholar] [CrossRef]
- Cho, A.R.; Dong, H.J.; Cho, S. Meat species identification using loop-mediated isothermal amplification assay targeting species-specific mitochondrial DNA. Korean J. Food Sci. Anim. Resour. 2014, 34, 799–807. [Google Scholar] [CrossRef] [PubMed]
- Deb, R.; Sengar, G.S.; Singh, U.; Kumar, S.; Raja, T.V.; Alex, R.; Alyethodi, R.R.; Prakash, B. LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples. Iran. J. Vet. Res. 2017, 18, 134–137. [Google Scholar] [PubMed]
- Kumari, S.; Kumar, R.R.; Mendiratta, S.K.; Kumar, D.; Rana, P.; Kumar, D.; Jawla, J. Species-specific loop-mediated isothermal amplification (LAMP) assay for identification of tissue of cattle origin by targeting mitochondrial gene sequences. 3 Biotech. 2019, 9, 69. [Google Scholar] [CrossRef] [PubMed]
- Hou, B.; Meng, X.; Zhang, L.; Guo, J.; Li, S.; Jin, H. Development of a sensitive and specific multiplex PCR method for the simultaneous detection of chicken, duck and goose DNA in meat products. Meat Sci. 2015, 101, 90–94. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Liu, J.; Zhang, Q.; Zhou, X.; Liu, B. Multiplex PCR assay for identification and quantification of bovine and equine in minced meats using novel specific nuclear DNA sequences. Food Control. 2019, 105, 29–37. [Google Scholar] [CrossRef]
Species | Primer | Sequence (5′–3′) |
---|---|---|
Bovine | BF | CAGACAAAGGTCAGGAAGTAATCCCAGCGCT |
BR | Biotin–ATTCCTCCAGCCCCCCAGCCGTATTCC | |
BP | FITC–CTTGCCCCAAGATGTGGCCTCCAGTTCCCTG dSpacer(THF)–CAAGACTGTAGCCC–C3 Spacer | |
Anatinae | AF | CCCCAAAGTGTCAACGATTGCCCCGAAACC |
AR | Digoxin–ACGCCCTCATCTCCAAAATCTACCCCAGCC | |
AP | FITC–GCCGTCAAAGTCCCCCAAAACACCCTGAAAC dSpacer(THF)–CCCCCAAACCACCGA–C3 Spacer |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fu, M.; Zhang, Q.; Zhou, X.; Liu, B. Recombinase Polymerase Amplification Based Multiplex Lateral Flow Dipstick for Fast Identification of Duck Ingredient in Adulterated Beef. Animals 2020, 10, 1765. https://doi.org/10.3390/ani10101765
Fu M, Zhang Q, Zhou X, Liu B. Recombinase Polymerase Amplification Based Multiplex Lateral Flow Dipstick for Fast Identification of Duck Ingredient in Adulterated Beef. Animals. 2020; 10(10):1765. https://doi.org/10.3390/ani10101765
Chicago/Turabian StyleFu, Ming, Quanwang Zhang, Xiang Zhou, and Bang Liu. 2020. "Recombinase Polymerase Amplification Based Multiplex Lateral Flow Dipstick for Fast Identification of Duck Ingredient in Adulterated Beef" Animals 10, no. 10: 1765. https://doi.org/10.3390/ani10101765
APA StyleFu, M., Zhang, Q., Zhou, X., & Liu, B. (2020). Recombinase Polymerase Amplification Based Multiplex Lateral Flow Dipstick for Fast Identification of Duck Ingredient in Adulterated Beef. Animals, 10(10), 1765. https://doi.org/10.3390/ani10101765