Widespread Infection with Hemotropic Mycoplasmas in Free-Ranging Dogs and Wild Foxes Across Six Bioclimatic Regions of Chile
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Area and Sampling Methods
2.2. DNA Extraction and Molecular Detection
2.3. Identification of Ectoparasites
2.4. Data Analysis
3. Results
3.1. Hemoplasma Prevalence and Sequence Types
3.2. Risk Factors
3.3. Genetic Relationships
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sykes, J.E.; Tasker, S. Hemoplasma infections. In Canine and Feline Infectious Diseases, 1st ed.; Elsevier Health Sciences: Amsterdam, The Netherlands, 2013; pp. 390–398. [Google Scholar]
- Millán, J.; di Cataldo, S.; Volokhov, D.; Becker, D. Worlwide occurrence of hemoplasmas in wildlife: Insights into the patterns of infection, transmission, pathology, and zoonotic potential. Transbound. Emerg. Dis. 2020, 1–21. [Google Scholar] [CrossRef]
- Greene, C. Infectious Diseases of the Dog and Cat, 3rd ed.; W.B. Saunders/Elsevier Science: London, UK, 2006. [Google Scholar]
- Tsai, S.; Wear, D.J.; Shih, J.W.K.; Lo, S.C. Mycoplasmas and oncogenesis: Persistent infection and multistage malignant transformation. Proc. Natl. Acad. Sci. USA 1995, 92, 10197–10201. [Google Scholar] [CrossRef] [Green Version]
- Peters, I.; Helps, C.; McAuliffe, L.; Neimark, H.; Lappin, M.; Gruffydd-Jones, T.; Day, M.; Hoelzle, L.; Willi, B.; Meli, M.; et al. RNase P RNA gene (rnpB) phylogeny of Hemoplasmas and other Mycoplasma species. Journal of clinical microbiology. J. Clin. Microbiol. 2008, 46, 1873–1877. [Google Scholar] [CrossRef] [Green Version]
- Barker, E.N.; Langton, D.A.; Helps, C.R.; Brown, G.; Malik, R.; Shaw, S.E.; Tasker, S. Haemoparasites of free-roaming dogs associated with several remote Aboriginal communities in Australia. BMC Vet. Res. 2012, 8, 1–7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Obara, H.; Fujihara, M.; Watanabe, Y.; Ono, H.K.; Harasawa, R. A Feline Hemoplasma, ‘Candidatus Mycoplasma haemominutum’, Detected in Dog in Japan. J. Vet. Med. Sci. 2011, 73, 841–843. [Google Scholar] [CrossRef] [Green Version]
- Huggins, L.G.; Koehler, A.V.; Ng-Nguyen, D.; Wilcox, S.; Schunack, B.; Inpankaew, T.; Traub, R.J. Assessment of a metabarcoding approach for the characterisation of vector-borne bacteria in canines from Bangkok, Thailand. Parasit. Vectors 2019, 12, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Willi, B.; Novacco, M.; Meli, M.L.; Wolf-Jäckel, G.A.; Boretti, F.S.; Wengi, N.; Lutz, H.; Hofmann-Lehmann, R. Haemotropic mycoplasmas of cats and dogs: Transmission, diagnosis, prevalence and importance in Europe. Schweiz. Arch. Tierheilkd. 2010, 152, 237–244. [Google Scholar] [CrossRef] [PubMed]
- Soto, F.; Walker, R.; Sepulveda, M.; Bittencourt, P.; Acosta-Jamett, G.; Müller, A. Occurrence of canine hemotropic mycoplasmas in domestic dogs from urban and rural areas of the Valdivia Province, southern Chile. Comp. Immunol. Microbiol. Infect. Dis. 2017, 50, 70–77. [Google Scholar] [CrossRef]
- Di Cataldo, S.; Hidalgo-Hermoso, E.; Sacristán, I.; Cevidanes, A.; Napolitano, C.; Hernández, C.; Esperón, F.; Moreira-Arce, D.; Cabello-Stom, J.; Müller, A.; et al. Hemoplasmas Are Endemic and Cause Asymptomatic Infection in the Endangered Darwin’s Fox (Lycalopex fulvipes). Appl. Environ. Microbiol. 2020, 86, e00779. [Google Scholar] [CrossRef]
- Cabello, J.; Altet, L.; Napolitano, C.; Sastre, N.; Hidalgo, E.; Dávila, J.A.; Millán, J. Survey of infectious agents in the endangered Darwin’s fox (Lycalopex fulvipes): High prevalence and diversity of hemotrophic mycoplasmas. Vet. Microbiol. 2013, 167, 448–454. [Google Scholar] [CrossRef]
- Daszak, P.; Cunningham, A.; Hyatt, A. Emerging infectious diseases of wildlife—Threats to biodiversity and human health. Science 2000, 287, 443–449. [Google Scholar] [CrossRef] [PubMed]
- Sillero-Zubiri, C.; Hoffmann, M.; Macdonald, D. Canids: Foxes, Wolves, Jackals and Dogs: Status Survey and Conservation Action Plan, 1st ed.; Princeton University Press: New Jersey, NJ, USA, 2018; ISBN 978-0-691-18372-5. [Google Scholar]
- Pedersen, A.B.; Jones, K.E.; Nunn, C.L.; Altizer, S. Infectious diseases and extinction risk in wild mammals. Conserv. Biol. 2007, 21, 1269–1279. [Google Scholar] [CrossRef]
- Gompper, M.E. Free-Ranging Dogs and Wildlife Conservation, 1st ed.; Oxford University Press: New York, NY, USA, 2014; ISBN 978-0-19-966321-7. [Google Scholar]
- Villatoro, F.; Naughton-Treves, L.; Sepulveda, M.; Stowhas, P.; Mardones, F.O.; Silva-Rodríguez, E.A. When free-ranging dogs threaten wildlife: Public attitudes toward management strategies in southern Chile. J. Environ. Manage. 2019, 229, 67–75. [Google Scholar] [CrossRef]
- Acosta-Jamett, G.; Surot, D.; Cortés, M.; Marambio, V.; Valenzuela, C.; Vallverdu, A.; Ward, M.P. Epidemiology of canine distemper and canine parvovirus in domestic dogs in urban and rural areas of the Araucanía region in Chile. Vet. Microbiol. 2015, 178, 260–264. [Google Scholar] [CrossRef]
- Villatoro, F.; Sepúlveda, M.A.; Stowhas, P.; Silva-Rodríguez, E.A. Urban dogs in rural areas: Human-mediated movement defines dog populations in southern Chile. Prev. Vet. Med. 2016, 135, 59–66. [Google Scholar] [CrossRef]
- Lucherini, M. Lycalopex Griseus and Culpaeus. In The IUCN Red List of Threatened Species; IUCN UK: London, UK, 2016. [Google Scholar] [CrossRef]
- Sutherst, E. Arthropods as diseases vectors in a changing environment. In Environmental Change and Human Health, 2nd ed.; Wiley J. & Sons: West Sussex, UK, 1993; ISBN 0-471-93842-4. [Google Scholar]
- Mann, G. Regiones biogeográficas de Chile. Investig. Zoológicas Chil. 1960, 6, 15–49. [Google Scholar]
- CONAMA. Biodiversidad de Chile: Patrimonio y Desafíos, 2nd ed.; Ocho Libros Editores: Santiago, Chile, 2008; ISBN 978-956-8018-56-6. [Google Scholar]
- Marchiondo, A.A.; Holdsworth, P.A.; Fourie, L.J.; Rugg, D.; Hellmann, K.; Snyder, D.E.; Dryden, M.W. World Association for the Advancement of Veterinary Parasitology (W.A.A.V.P.) second edition: Guidelines for evaluating the efficacy of parasiticides for the treatment, prevention and control of flea and tick infestations on dogs and cats. Vet. Parasitol. 2013, 194, 84–97. [Google Scholar] [CrossRef]
- Chirife, A.D.; Cevidanes, A.; Millán, J. Effective field immobilization of andean fox (Lycalopex culpaeus) with ketamine-dexmedetomidine and antagonism with atipamezole. J. Wildl. Dis. 2020, 56, 447–451. [Google Scholar] [CrossRef]
- Acosta-Jamett, G.; Astorga-Arancibia, F.; Cunningham, A.A. Comparison of chemical immobilization methods in wild foxes (Pseudalopex griseus and Pseudalopex culpaeus) in Chile. J. Wildl. Dis. 2010, 46, 1204–1213. [Google Scholar] [CrossRef] [Green Version]
- Iriarte, A.; Jaksic, F. Los Carnívoros de Chile, 2nd ed.; Ediciones Flora y Fauna, CASEB, Pontifica Universidad Católica de Chile: Santiago, Chile, 2012; ISBN 978-956-351-168-0. [Google Scholar]
- Brinkhof, B.; Spee, B.; Rothuizen, J.; Penning, L. Development and evaluation of canine reference genes for accurate quantification of gene expression. Anal. Biochem. 2006, 356, 36–43. [Google Scholar] [CrossRef] [PubMed]
- Millán, J.; López-Roig, M.; Delicado, V.; Serra-Cobo, J.; Esperón, F. Widespread infection with hemotropic mycoplasmas in bats in Spain, including a hemoplasma closely related to “Candidatus Mycoplasma hemohominis. ” Comp. Immunol. Microbiol. Infect. Dis. 2015, 39, 9–12. [Google Scholar] [CrossRef] [PubMed]
- Lv, J.; Wu, S.; Zhang, Y.; Chen, Y.; Feng, C.; Yuan, X.; Jia, G.; Deng, J.; Wang, C.; Wang, Q.; et al. Assessment of four DNA fragments (COI, 16S rDNA, ITS2, 12S rDNA) for species identification of the Ixodida (Acari: Ixodida). Parasites Vectors 2014, 7, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nava, S.; Venzal, J.M.; Gonzalez-Acuña, D.; Martins, T.; Gugliermone, A.A. Ticks of the Southern Cone of America, 1st ed.; Academic Press: London, UK, 2017; ISBN 978-0-12-811075-1. [Google Scholar]
- Beaucournu, J.; Gonzalez-Acuña, D. Fleas (Insecta-Siphonaptera) of Chile: A review. Zootaxa 2014, 2, 151–203. [Google Scholar] [CrossRef] [Green Version]
- Stevenson, M.; Nunes, T.; Sanchez, J.; Thornton, R.; Reiczigel, J.; Robison-Cox, J.; Sebastiani, P. epiR: An R package for the analysis of epidemiological data. R Package Version 0.9-43, 2013. [Google Scholar]
- Barton, K. “MuMIn” Multi-Model Inference. R package version 1-18, 2020. [Google Scholar]
- Bandelt, H.; Forster, P.; Röhl, A. Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 1999, 16, 37–48. [Google Scholar] [CrossRef]
- Librado, P.; Rozas, J. DnaSP v5:a software for comprehensive analysis of DNA polymorphism data. Bioinformatics2 2009, 25, 1451–1452. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Excoffier, L.; Lischer, H.E. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef]
- Hudson, R.R. A new statistic for detecting genetic differentiation. Genet. Soc. Am. 2000, 155, 2011–2014. [Google Scholar]
- Birkenheuer, A.J.; Breitschwerdt, E.B.; Alleman, A.R.; Pitulle, C. Differentiation of Haemobartonella canis and Mycoplasma haemofelis on the basis of comparative analysis of gene sequences. Am. J. Vet. Res. 2002, 63, 1385–1388. [Google Scholar] [CrossRef] [PubMed]
- Di Cataldo, S.; Kamani, J.; Cevidanes, A.; Msheliza, E.G.; Millán, J. Hemotropic mycoplasmas in bats captured near human settlements in Nigeria. Comp. Immunol. Microbiol. Infect. Dis. 2020, 70, 101448. [Google Scholar] [CrossRef]
- Sacristán, I.; Acuña, F.; Aguilar, E.; García, S.; López, M.J.; Cevidanes, A.; Cabello, J.; Hidalgo-Hermoso, E.; Johnson, W.E.; Poulin, E.; et al. Assessing cross-species transmission of hemoplasmas at the wild-domestic felid interface in Chile using genetic and landscape variables analysis. Sci. Rep. 2019, 9, 1–14. [Google Scholar] [CrossRef]
- Millán, J.; Travaini, A.; Cevidanes, A.; Sacristán, I.; Rodríguez, A. Assessing the natural circulation of canine vector-borne pathogens in foxes, ticks and fleas in protected areas of Argentine Patagonia with negligible dog participation. Int. J. Parasitol. Parasites Wildl. 2019, 8, 63–70. [Google Scholar] [CrossRef]
- Astorga, F.; Escobar, L.E.; Poo-Muñoz, D.A.; Medina-Vogel, G. Dog ownership, abundance and potential for bat-borne rabies spillover in Chile. Prev. Vet. Med. 2015, 118, 397–405. [Google Scholar] [CrossRef] [PubMed]
- Vicente, J.; Hölfe, U.; Garrido, J.; Fernández-De-Mera, I.; Acevedo, P.; Juste, R.; Barral, M.; Gortazar, C. Risk factors associated with the prevalence of tuberculosis-like lesions in fenced wild boar and red deer in south central Spain. Vet. Res. 2007, 38, 451–464. [Google Scholar] [CrossRef] [Green Version]
- Sasaki, M.; Ohta, K.; Matsuu, A.; Hirata, H.; Ikadai, H.; Oyamada, T. A molecular survey of Mycoplasma haemocanis in dogs and foxes in Aomori Prefecture, Japan. J. Protozool. Res. 2008, 18, 57–60. [Google Scholar]
- Millán, J.; Velarde, R.; Delicado, V.; Negre, N.; Ribas, A.; Oleaga, Á.; Llaneza, L.; Esperón, F. High diversity of hemotropic mycoplasmas in Iberian wild carnivores. Comp. Immunol. Microbiol. Infect. Dis. 2018, 60, 11–16. [Google Scholar] [CrossRef] [PubMed]
- Koneval, M.; Miterpáková, M.; Hurníková, Z.; Blaňarová, L.; Víchová, B. Neglected intravascular pathogens, Babesia vulpes and haemotropic Mycoplasma spp. in European red fox (Vulpes vulpes) population. Vet. Parasitol. 2017, 243, 176–182. [Google Scholar] [CrossRef]
- Cortese, L.; Beall, M.; Buono, F.; Buch, J.; Pacifico, L.; Neola, B.; Palatucci, A.T.; Tyrrell, P.; Fioretti, A.; Breitschwerdt, E.B.; et al. Distribution and risk factors of canine haemotropic mycoplasmas in hunting dogs from southern Italy. Vet. Microbiol. 2020, 251, 108910. [Google Scholar] [CrossRef]
- Sepúlveda, M.; Pelican, K.; Cross, P.; Eguren, A.; Singer, R. Fine-scale movements of rural free-ranging dogs in conservation areas in the temperate rainforest of the coastal range of southern Chile. Mamm. Biol. 2015, 80, 290–297. [Google Scholar] [CrossRef]
- Suh, G.H.; Ahn, K.S.; Ahn, J.H.; Kim, H.J.; Leutenegger, C.; Shin, S.S. Serological and molecular prevalence of canine vector-borne diseases (CVBDs) in Korea. Parasites Vectors 2017, 10, 1–8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Novacco, M.; Meli, M.L.; Gentilini, F.; Marsilio, F.; Ceci, C.; Pennisi, M.G.; Lombardo, G.; Lloret, A.; Santos, L.; Carrapiço, T.; et al. Prevalence and geographical distribution of canine hemotropic mycoplasma infections in Mediterranean countries and analysis of risk factors for infection. Vet. Microbiol. 2010, 142, 276–284. [Google Scholar] [CrossRef] [PubMed]
- Barker, E.N.; Tasker, S.; Day, M.J.; Warman, S.M.; Woolley, K.; Birtles, R.; Georges, K.C.; Ezeokoli, C.D.; Newaj-Fyzul, A.; Campbell, M.D.; et al. Development and use of real-time PCR to detect and quantify Mycoplasma haemocanis and “Candidatus Mycoplasma haematoparvum” in dogs. Vet. Microbiol. 2010, 140, 167–170. [Google Scholar] [CrossRef] [PubMed]
- Messick, J.B. Hemotrophic mycoplasmas (hemoplasmas): A review and new insights into pathogenic potential. Vet. Clin. Pathol. 2004, 33, 2–13. [Google Scholar] [CrossRef]
Target | Primer Names | Primer Sequences (5′–3′) | Amplicon Length (bp) | Reference |
---|---|---|---|---|
Canine endogenous control (RPS19) | RPS19F RPS19R | CCTTCCTCAAAAA/GTCTGGG1 GTTCTCATCGTAGGGAGCAAG | 95 | [28] |
Mycoplasma screening (16S) | Mycop16S rRNA-F Mycop16S rRNA-R | ATGTTGCTTAATTCGATAATACACGAAA ACRGGATTACTAGTGATTCCAACTTCAA | 384 | [29] |
Tick endogenous control (16S) | 16S-F 16S-R1 | TTAAATTGCTGTRGTATT CCGGTCTGAACTCASAWC | 455 | [30] |
Bioregion | Dog | Andean Fox | South American Grey Fox | ||||||
---|---|---|---|---|---|---|---|---|---|
n | Mhc/Mhf | CMhp | n | Mhc/Mhf | CMhp | n | Mhc/Mhf | CMhp | |
Prev. % (C.I.) | Prev. % (C.I.) | Prev. % (C.I.) | Prev. % (C.I.) | Prev. % (C.I.) | Prev. % (C.I.) | ||||
Coastal Desert | 196 | 23.5 (18.1–29.9) | 7.6 (4.7–12.2) | 16 | 6.2 (0.2–28.3) | 25.0 (10.2–49.5) | 3 | 33.3 (1.7–79.2) | 33.3 (1.7–79.2) |
Mountain Desert | 108 | 27.8 (20.2–36.9) | 15.8 (10.1–23.8) | 0 | - | - | 0 | - | - |
Steppe | 75 | 14.7 (8.4–24.4) | 22.7 (14.7–33.3) | 7 | 28.6 (8.2–64.1) | 0 (0–35.4) | 41 | 24.4 (13.8–39.3) | 12.2 (5.3–25.5) |
Mediterranean | 111 | 20.7 (14.2–29.2) | 13.5 (8.4–21.1) | 106 | 21.7 (14.9–30.5) | 4.7 (2.0–10.7) | 17 | 23.5 (9.5–47.3) | 5.9 (0.3–26.7) |
Temperate Warm Rainy | 80 | 26.3 (17.9–36.8) | 10.0 (5.1–18.5) | 10 | 20.0 (5.7–50.9) | 10.0 (0.5–40.4) | 22 | 31.8 (16.4–52.7) | 0 (0–14.9) |
Temperate Maritime Rainy | 56 | 25.0 (15.5–37.7) | 10.7 (10.1–15.3) | 0 | - | - | 0 | - | - |
Overall prevalence | 626 | 23.8 (20.4–27.1) | 12.8 (10.1–15.4) | 139 | 20.1 (14.3–27.6) | 7.2 (3.9–12.7) | 83 | 26.5 (18.2–36.9) | 8.4 (4.1–16.4) |
ntST | Host (n) | Bioregion | P.I. | Best GenBank® Match |
---|---|---|---|---|
ntst1 | Dog (81), Andean fox (9), South American grey fox (14) | All bioregions | 100% | M. haemocanis, dog from Chile (KY117653) |
ntst2 | Dog (1) | Steppe | 99.2% | M. haemofelis, cat from China (MH447082) |
ntst3 | South American grey fox (1) | Steppe | 99.2% | M.a haemofelis, cat from China (MH447082) |
ntst4 | Dog (1) | Coastal Desert | 99.2% | M. haemofelis, cat from China (MH447082) |
ntst5 | Dog (1) | Mountain Desert | 99.4% | M. haemofelis, cat from China (MH447082) |
ntst6 | Dog (1) | Coastal Desert | 99.4% | M. haemofelis, cat from China (MH447082) |
ntst7 | Dog (1) | TWR | 99.7% | M. haemofelis, cat from China (MH447082) |
ntst8 | Dog (1) | TWR | 99.7% | M. haemofelis, cat from China (MH447082) |
ntst9 | Andean fox (13), Dog (3), South American grey fox (3) | Steppe, Mediterranean and TWR | 99.7% | M. haemofelis, cat from China (MH447082) |
ntst10 | South American grey fox (1) | Steppe | 99.7% | M. haemofelis, cat from China (MH447082) |
ntst11 | Dog (1) | Coastal Desert | 99.4% | M. haemofelis, cat from China (MH447082) |
ntst12 | Dog (1) | Steppe | 99.5% | M. haemofelis, cat from China (MH447082) |
ntst13 | Dog (1), South American grey fox (1) | Coastal Desert and Steppe | 100% | M. haemocanis, dog from Portugal (GQ129118) |
ntst14 | Dog (1) | Mediterranean | 99.7% | M. haemofelis, cat from China (MH447082) |
ntst15 | Andean fox (1) | Mediterranean | 100% | M. haemofelis, cat from China (MH447082) |
ntst16 | Dog (1) | Coastal Desert | 99.7% | M. haemofelis, cat from China (MH447082) |
ntst17 | Dog (1) | Coastal Desert | 99.7% | M. haemofelis, cat from China (MH447082) |
ntst18 | Dog (1) | Coastal Desert | 99.7% | M. haemofelis, cat from China (MH447082) |
ntst19 | Andean fox (1) | Steppe | 99.7% | M. haemofelis, cat from China (MH447082) |
ntst20 | Dog (1) | Coastal Desert | 99.7% | M. haemofelis, cat from China (MH447082) |
ntst21 | Dog (1) | Mediterranean | 99.7% | M. haemofelis, cat from China (MH447082) |
ntst22 | Dog (1) | TWR | 99.7% | M. haemofelis, cat from China (MH447082) |
ntst23 | Dog (1) | Mountain Desert | 99.7% | M. haemofelis, cat from China (MH447082) |
ntst24 | Dog (1) | Mediterranean | 99.7% | M. haemofelis, cat from China (MH447082) |
ntst25 | Dog (1) | TWR | 99.4% | C. M. haematoparvum, dog from Chile (KY117661) |
ntst26 | Dog (1) | Coastal Desert | 99.7% | C. M. haematoparvum, dog from Chile (KY117661) |
ntst27 | Dog (1) | Coastal Desert | 99.7% | C. M. haematoparvum, dog from Chile (KY117661) |
ntst28 | Dog (58), Andean fox (4), South American grey fox (1) | All bioregions | 99.7% | C. M. haematoparvum, dog from Chile (KY117661) |
ntst29 | South American grey fox (1) | Steppe | 100% | C. M. haemominutum, cat from Chile (MN543625) |
ntst30 | Andean fox (1) | Coastal Desert | 100% | 100% Mycoplasma sp. clone ZD019, Lycalopex fulvipes from Chile (MK457366) |
Estimate ± SE | Z Value | AIC | Deviance | Df | |
---|---|---|---|---|---|
Mhc/Mhf | 670.8 | 662.8 | 605 | ||
(Intercept) | |||||
Sex male | 0.475 ± 0.2 | 2.366* | |||
CMhp | |||||
(Intercept) | 443.3 | 429.3 | 602 | ||
Age juvenile | −1.014 ± 0.4 | −2.428* | |||
Sex male | 1.252 ± 0.3 | 4.016** | |||
Low flea infestation | 1.253 ± 1.0 | 1.186 | |||
No flea infestation | 1.688 ± 1.03 | 1.629 |
Ectoparasite | n | Prev. (95% C.I.) | M.A. ± S.E. | M.I. ± S.E. |
---|---|---|---|---|
Overall ticks | 1208 | 27.2 (23.8–30.9) | 1.9 ± 0.2 | 7.3 ± 0.7 |
Rhipicephalus sanguineus species group | 1198 | 26.9 (23.5–30.5) | 1.9 ± 0.2 | 7.3 ± 0.7 |
Amblyomma tigrinum | 10 | 0.96 (0.4–2.0) | 0.01 ± 0.009 | 1.7 ± 0.7 |
Overall fleas | 1513 | 32.6 (29.0–36.5) | 2.4 ± 0.2 | 7.4 ± 0.7 |
Ctenocephalides sp. | 790 | 24.2 (20.9–27.6) | 1.3 ± 0.1 | 5.2 ± 0.4 |
Pulex irritans | 385 | 17.1 (14.3–20.3) | 0.6 ± 0.1 | 3.6 ± 0.4 |
Echidnophaga gallinacea | 338 | 3.0 (1.8–4.6) | 0.5 ± 0.2 | 16.2 ± 3.7 |
Mycoplasma Species | Bioregion | Host | Hd | π | K | Snn | PhiST | p-Value |
---|---|---|---|---|---|---|---|---|
Mhc/Mhf | All | All | 0.477 | 0.0024 | 0.6380 | 0.6026 | 0.1663 | < 0.01 |
Dog | 0.370 | 0.0019 | 0.5083 | |||||
Grey fox | 0.505 | 0.0029 | 0.7684 | |||||
Andean fox | 0.587 | 0.0026 | 0.6848 | |||||
Only dogs | 0.325 | 0.0015 | 0.3949 | 0.2250 | 0.1863 | < 0.05 | ||
Only foxes | 0.638 | 0.0029 | 0.8664 | 0.4507 | 0.0956 | < 0.05 | ||
Steppe | All | 0.614 | 0.0035 | 1.2398 | 0.3445 | 0.0160 | > 0.05 | |
Dog | 0.524 | 0.0040 | 1.4286 | |||||
Grey fox | 0.666 | 0.0034 | 1.2000 | |||||
Andean fox | 1.0 | 0.0028 | 1.0000 | |||||
Mediterranean | All | 0.567 | 0.0019 | 0.6304 | 0.5475 | 0.3553 | < 0.01 | |
Dog | 0.419 | 0.0014 | 0.4559 | |||||
Grey fox | 0 | 0 | 0 | |||||
Andean fox | 0.542 | 0.0019 | 0.6144 | |||||
TWR | All | 0.462 | 0.0016 | 0.5146 | 0.5014 | 0.1461 | > 0.05 | |
Dog | 0.423 | 0.0014 | 0.4615 | |||||
Grey fox | 0.500 | 0.0015 | 0.5000 | |||||
Andean fox | 1.0 | 0.0031 | 1.000 | |||||
CMhp* | All | All | 0.909 | 0.0004 | 0.1221 | 0.8810 | 0.0083 | > 0.05 |
Dog | 0.097 | 0.0004 | 0.1301 | |||||
Andean fox | 0 | 0 | 0 | |||||
Only dogs | 0.097 | 0.0004 | 0.1301 | 0.1701 | 0.0112 | > 0.05 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Di Cataldo, S.; Cevidanes, A.; Ulloa-Contreras, C.; Sacristán, I.; Peñaloza-Madrid, D.; Vianna, J.; González-Acuña, D.; Sallaberry-Pincheira, N.; Cabello, J.; Napolitano, C.; et al. Widespread Infection with Hemotropic Mycoplasmas in Free-Ranging Dogs and Wild Foxes Across Six Bioclimatic Regions of Chile. Microorganisms 2021, 9, 919. https://doi.org/10.3390/microorganisms9050919
Di Cataldo S, Cevidanes A, Ulloa-Contreras C, Sacristán I, Peñaloza-Madrid D, Vianna J, González-Acuña D, Sallaberry-Pincheira N, Cabello J, Napolitano C, et al. Widespread Infection with Hemotropic Mycoplasmas in Free-Ranging Dogs and Wild Foxes Across Six Bioclimatic Regions of Chile. Microorganisms. 2021; 9(5):919. https://doi.org/10.3390/microorganisms9050919
Chicago/Turabian StyleDi Cataldo, Sophia, Aitor Cevidanes, Claudia Ulloa-Contreras, Irene Sacristán, Diego Peñaloza-Madrid, Juliana Vianna, Daniel González-Acuña, Nicole Sallaberry-Pincheira, Javier Cabello, Constanza Napolitano, and et al. 2021. "Widespread Infection with Hemotropic Mycoplasmas in Free-Ranging Dogs and Wild Foxes Across Six Bioclimatic Regions of Chile" Microorganisms 9, no. 5: 919. https://doi.org/10.3390/microorganisms9050919
APA StyleDi Cataldo, S., Cevidanes, A., Ulloa-Contreras, C., Sacristán, I., Peñaloza-Madrid, D., Vianna, J., González-Acuña, D., Sallaberry-Pincheira, N., Cabello, J., Napolitano, C., Hidalgo-Hermoso, E., Acosta-Jamett, G., & Millán, J. (2021). Widespread Infection with Hemotropic Mycoplasmas in Free-Ranging Dogs and Wild Foxes Across Six Bioclimatic Regions of Chile. Microorganisms, 9(5), 919. https://doi.org/10.3390/microorganisms9050919