Next Article in Journal
Preclinical Evaluation of Selene-Ethylenelacticamides in Tuberculosis: Effects Against Active, Dormant, and Resistant Mycobacterium Tuberculosis and In Vitro Toxicity Investigation
Previous Article in Journal
Roughage Sources During Late Gestation and Lactation Alter Metabolism, Immune Function and Rumen Microbiota in Ewes and Their Offsprings
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 13
Issue 2
10.3390/microorganisms13020395
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Ugd Is Involved in the Synthesis of Glycans of Glycoprotein and LPS and Is Important for Cellulose Degradation in Cytophaga hutchinsonii

by
Wenxia Song
,
Shaoqi Geng
,
Qingsheng Qi
and
Xuemei Lu
*
State Key Laboratory of Microbial Technology, Shandong University, Qingdao 266237, China
*
Author to whom correspondence should be addressed.
Microorganisms 2025, 13(2), 395; https://doi.org/10.3390/microorganisms13020395
Submission received: 13 January 2025 / Revised: 6 February 2025 / Accepted: 9 February 2025 / Published: 11 February 2025
(This article belongs to the Section Environmental Microbiology)
Browse Figures
Versions Notes

Abstract

:
Cytophaga hutchinsonii, a member of the phylum Bacteroidetes, can rapidly degrade crystalline cellulose through direct cell-to-substrate contact. Most of its cellulases are secreted by the Type IX secretion system (T9SS) and anchored to the cell surface. Our previous study proved that the C-terminal domain (CTD) of the T9SS substrate cellulase Cel9A is glycosylated in C. hutchinsonii. However, its glycosylation mechanism has remained elusive. In this study, we found that chu_3394, which encodes UDP-glucose 6-dehydrogenase (Ugd), was important for the glycosylation of large amounts of periplasmic and outer membrane proteins in C. hutchinsonii. The contents of mannose, glucose, galactose, and xylose were detected to be reduced in the glycoproteins of the ∆ugd mutant compared to that of wild-type. They might be essential monosaccharides that contribute to the structure and function of glycans attached to proteins in C. hutchinsonii. The depletion of mannose, glucose, galactose, and xylose indicates a decrease in glycosylation modifications in the ∆ugd mutant strain. Then, we found that the deletion of ugd resulted in weakened glycosylation modification of the recombinant green fluorescent protein-tagged CTD of Cel9A. Additionally, the outer-membrane localization of Cel9A was affected in the mutant. Besides this, Ugd was also important for the synthesis of O-antigen of lipopolysaccharide (LPS). Thus, Ugd was involved in the synthesis of glycans in both glycoproteins and LPS in C. hutchinsonii. Moreover, the deletion of ugd affected the cellulose degradation, cell motility, and stress resistance of C. hutchinsonii.

1. Introduction

Glycosylation is an important modification that adds carbohydrates to proteins, thereby affecting many important life processes [1]. Research on glycosylation modification systems in bacteria remains relatively limited and is primarily concentrated on pathogenic bacteria. These studies predominantly focus on several species within the phylum Proteobacteria, such as Campylobacter jejuni [2], Helicobacter pylori [3], Pseudomonas aeruginosa [4], and Haemophilus influenzae [5]. Additionally, attention has been given to multiple species in the phylum Firmicutes, including Listeria monocytogenes [6], Clostridium difficile [7], and Streptococcus parasanguinis [8]. Furthermore, research has also covered certain bacteria from the phylum Bacteroidete, such as Bacteroides fragilis [9] and Porphyromonas gingivalis [10]. In cellulose-degrading bacteria, the glycosylation modifications of cellulases in Trichoderma reesei are well-characterized. Endoglucanase Cel7A in T. reesei exhibits both N-glycosylation and O-glycosylation. These glycan modifications not only enhance correct protein folding and secretion efficiency within cells but also protect the enzyme from proteolytic degradation [11,12]. Recently, our laboratory found that glycosylation also occurs in Cytophaga hutchinsonii, which belongs to the phylum Bacteroidetes [12,13,14].
For C. hutchinsonii to digest cellulose, the cells need to be in direct contact with the cellulose; in this degradation pathway, many outer membrane proteins, including cellulases, are responsible for the adsorption and preliminary degradation of the cellulose [15]. Most of the cellulases in C. hutchinsonii are secreted by T9SS and anchored to the cell surface [12,16]. Our previous study has shown that the T9SS in C. hutchinsonii is important for cellulose degradation, absorption of ions, and cell gliding [17,18,19]. The conserved C-terminal domains (CTDs) of T9SS substrate proteins are the outer membrane translocation signals that are recognized by the T9SS [20,21,22]. Our recent studies showed that the CTDs of cellulase Cel9A was glycosylated in C. hutchinsonii [13,14]. But the glycosylation modification system of C. hutchinsonii is currently unknown. To date, only two glycosyltransferases (CHU_3842 and GtrA) have been identified as taking part in the glycosylation pathway in C. hutchinsonii [13,14]. The discovery and investigation of additional enzymes involved in glycosylation modification are imperative for a comprehensive understanding of the glycosylation system of C. hutchinsonii. In order to identify genes involved in the glycosylation modification system of C. hutchinsonii, we attempted to single knock out over 20 genes involved in glycoside or polysaccharide synthesis and metabolism, including UDP-glucose 6-dehydrogenase.
The enzyme UDP-glucose 6-dehydrogenase (Ugd) is found in many organisms and catalyzes the synthesis of UDP-glucuronic acid (UDP-GlcA) from UDP-Glc [23,24]. Several sugar nucleotides, such as UDP-galacturonate, UDP-D-xylose, and UDP-apiose, need UDP-GlcA as a precursor. UDP-GlcA is also the glucuronosyl donor for the synthesis of several structural polysaccharides [25]. In Porphyromonas gingivalis, Ugd participated in the synthesis of O-antigen of lipopolysaccharide (LPS) [26]. In Acinetobacter baumannii LUH5549, Ugd3 was involved in capsular polysaccharide synthesis [27]. In Xanthomonas campestris, Ugd was involved in the precursor synthesis of xanthan gum. In the luminescent bacterium Vibrio fischeri, Ugd was involved in biofilm formation [28]. However, to our knowledge, no studies have reported that Ugd participates in protein glycosylation system in bacteria.
In this study, the function of the chu_3394 gene in C. hutchinsonii, which encodes UDP-glucose dehydrogenase, was investigated. Deletion of ugd led to extensive phenotypic changes in C. hutchinsonii including cellulose degradation capacity, cell motility, and stress resistance. Lectin blot analysis revealed a diminished response of the outer membrane and periplasmic proteins of the ∆ugd mutant to Aleuria aurantia lectin (AAL). The glycoproteins from the wild-type and Δugd mutant strains were enriched and the monosaccharide composition was tested. In the Δugd mutant, the levels of mannose, glucose, galactose, and xylose were significantly reduced. Then, a recombinant GFP-CTDCel9A protein was constructed to study the glycosylation of CTDCel9A. The results showed that there was defective glycosylation of GFP-CTDCel9A in the Δugd mutant strain. Furthermore, Western blot showed that Cel9A failed to anchor to the outer membrane of C. hutchinsonii. Additionally, the O-antigen was undetectable in the Δugd mutant. These findings suggest that Ugd was involved in both protein glycosylation modification and glycan synthesis of LPS in C. hutchinsonii.

2. Materials and Methods

2.1. Bacterial Strains, Plasmids, and Culture Conditions

The bacterial strains and plasmids used in this study are listed in Table 1. The primers used in this study are listed in Table 2. The PY6 medium, Stanier medium, and Luria–Bertani medium were consistent with the previous description [17]. C. hutchinsonii ATCC 33406 was grown at 30 °C with shaking at 160 rpm in PY6 medium. Stanier medium was used for the filter paper degradation assay and colony spreading assay.

2.2. Gene Deletion of Ugd

Gene chu_3394 (Protein accession number in NCBI: ABG60630) was deleted from C. hutchinsonii wild type by linear DNA double crossover. The plasmid Sjhc was used to construct the gene-targeting cassette; a map of Sjhc is shown in Supplementary Figure S1. For the deletion of chu_3394, homologous arms BamHI-3394H1-PstI and SacI-3394H2-XbaI were cloned into plasmid Sjhc by using double enzyme digestion and ligation. The gene-targeting cassette was amplified by primers 3394H1F and 3394H1R from plasmid Sjhc-3394. Approximately 1 μg of the gene-targeting cassette PCR product was transformed into 90 μL of wild-type competent cells by electroporation. After incubation for 5–7 days at 30 °C, positive transformants were screened by PCR and sequencing, then the ∆ugd mutant was obtained.

2.3. Complementation of the Ugd Deletion Mutant

Plasmid pTSK3328 was used for complementation of the deletion of ugd. Primers C3394F/C3394R were used to amplify the complementing fragment Cugd from C. hutchinsonii wild-type strain genome, including the full length of chu_3394 and a 500 bp region directly upstream, with a total length of 1.8 kbp. Fragment Cugd and pTSK3328 were ligated following SacI/SalI double enzyme digestion to construct the complementation plasmid pTSK3328-C3394. Primers EM3328H1F/EM3328H2R were used to amplify a 6-kbp DNA fragment, including the ugd homology arm H1 and H2, erythromycin-resistance gene, and complementation fragment C3394, from pTSK3328-C3394 as the template. Approximately 1 μg of the PCR product was transformed into 90 μL of Δugd mutant competent cells by electroporation after incubation for 5–7 days at 30 °C.

2.4. Cellulose Degradation and Cell Molity Assay

Strains were precultured in Stanier medium. Cells were harvested by centrifugation, washed with carbon-free Stanier medium, and adjusted to OD600 = 1.0 for inoculation. Equal amounts of wild-type and mutant cells were then spotted onto Stanier agar plates covered with filter paper for a cellulose degradation assay or onto Stanier soft agar plates for a cell motility assay. Then, the plates were incubated at 30 °C for 10 days.

2.5. Detection of Endoglucanases by Zymography

The outer membrane and periplasmic proteins were extracted as described by Wang [29]. Secreted proteins were concentrated using a 30 kDa ultrafiltration device (Millipore, Burlington, MA, USA). Samples were separated by using a native gel. Gels were treated as previously reported, with some modifications for the detection of endoglucanases by zymography [30]. Briefly, the gel was treated three to five times with pre-cooled 0.5 M Triton, with shaking at 4 °C for 15 min each time. Then, 2% (w/v) sodium carboxymethyl cellulose was added to completely immerse the gel, and it was incubated at 60 °C for 30 min. The gel was then stained with 0.5 M Congo red and washed with 1 M NaCl until the bands were clear.

2.6. Extraction of Proteins Fractions and Western Blot Analysis

Different component proteins were obtained as described above. The Western blot program was executed as described by Gao et al. [17]. Samples with equal biomass were subjected to 12% SDS-PAGE for separation and subsequently transferred to a PVDF membrane. The lectins used in this study were purchased from Vectors (Shanghai, China). The anti-GFP monoclonal antibody was purchased from ABclonal (Wuhan, China). All reagents were used in accordance with the manufacturer’s instructions.

2.7. Analysis of Monosaccharide Components

The monosaccharide composition analysis of C. hutchinsonii glycoproteins was conducted using high-performance liquid chromatography (HPLC) with a C18 column (Agilent, 4.6 mm × 250 mm, 2.7 μm). Glycoproteins (10 mg) were hydrolyzed with 2 M trifluoroacetic acid (TFA) at 110 °C for 10 h. The hydrolysate was dried at 60 °C to remove residual TFA and neutralized with 0.3 M NaOH. Subsequently, 10 µL of lactose (Lac) internal standard was added, followed by thorough mixing with 150 µL of 0.5 M 1-phenyl-3-methyl-5-pyrazolone (PMP). The resulting mixture was incubated in a water bath at 70 °C for 30 min. After neutralization with a 0.3 M HCl solution, the mixture was extracted 6–8 times with chloroform to eliminate excess PMP. Following centrifugation at 6000× g for 5 min, the upper aqueous layer was filtered through a 0.22 µm filter membrane, and 10 µL was subsequently injected into the HPLC system [31]. The carbohydrate standard mixture, consisting of mannose, glucosamine, rhamnose, glucuronic acid, galactosamine, glucose, galactose, xylose, arabinose, and fucose, was prepared using the same program. The mobile phase comprised 0.1 M KH2PO4 (pH 6.8) and methyl cyanide. The flow rate of mobile phase was 0.4 mL min−1.

2.8. Enrichment of Glycoproteins

Under alkaline conditions, boronic acid groups can bind to cis-dihydroxy structures, forming stable five-membered ring complexes. Since most monosaccharides possess a cis-dihydroxy structure, boronic acid affinity chromatography is an effective method for enriching glycoproteins [32]. Phenylboronic acid is employed to enrich glycoproteins from C. hutchinsonii. Briefly, C. hutchinsonii cells, cultured to the logarithmic phase, were harvested by centrifugation (5000× g, 10 min, 4 °C) and washed with 50 mM piperazine-N, N’-bis (2-ethanesulfonic acid) (PIPES) buffer (pH 6.8). The pellet was resuspended in a binding buffer (20 mM Tris-HCl, 50 mM MgCl2, pH 8.5) and lysed using high-pressure homogenization at 700 bar for 3 min. Cell debris was eliminated by centrifugation at 10,000× g for 30 min, followed by an additional spin at 100,000× g for 45 min. The supernatant obtained after the second centrifugation was designated as the cytoplasmic fraction, while the pellet corresponded to the total membrane fraction [3]. To minimize the influence of polysaccharides, the membrane fraction was resuspended in a binding buffer and centrifuged 2–3 times under the same conditions. Both the cytoplasmic and membrane fractions were filtered and sterilized using a 0.22 µm membrane filter, followed by glycoprotein enrichment with phenylboronic acid. The glycoproteins bound to the chromatography medium were eluted with an elution buffer containing 200 mM sorbitol, 100 mM Tris, and 50 mM EDTA at pH 8.5. The protein samples were dialyzed in double-distilled water (ddH2O) for 24 h and subsequently freeze-dried for further analysis.

2.9. Protein Expression in Escherichia coli

The E. coli strain W3110 carrying plasmid pBAD24-GFP-CTDCel9A was cultured in LB medium at 37 °C with shaking at 220 rpm. When the optical density of the culture at 600 nm reached 0.6–0.8, 0.2% L-arabinose (Sigma, St. Louis, MO, USA) was added to induce the expression of green fluorescent protein (GFP)-CTDCel9A (C-terminal domain of Cel9A). After incubation at 28 °C with shaking at 200 rpm for 20 h, the cells were collected and ultrasonicated. The supernatant was used as the intracellular soluble protein after concentration using an ultrafiltration tube (10 kDa, Millipore). The recombinant protein GFP-CTDCel9A was detected using an anti-GFP monoclonal antibody.

2.10. Extraction of LPS

LPS was isolated by using hot aqueous phenol as described by Davis and appropriately modified [33]. Silver staining of LPS samples were performed in accordance with the instructions of the Beyotime rapid silver staining kit (catalog no. P0017S, Beyotime Biotechnology, Shanghai, China).

2.11. Disk Diffusion Susceptibility Assay

The disk diffusion assay was performed as described by Zhao [34] and appropriately modified. Five milliliters of cell suspension was spread over solid Stanier plates, and then different toxic reagents were seeded on filter papers in the center of the plates. The plates were incubated at 30 °C to determine the inhibition zone.

3. Results

3.1. Bioinformatic Analysis and Deletion of Ugd

According to the National Center for Biotechnology Information (NCBI; available online: https://www.ncbi.nlm.nih.gov/), chu_3394 in the C. hutchinsonii genome is annotated as encoding a UDP-glucose 6-dehydrogenase (Ugd). To identify the functions of Ugd, chu_3394 was deleted from C. hutchinsonii wild-type strain. The deletion process is shown in Supplementary Figure S2A. Deletion strains were verified by PCR (Supplementary Figure S2B).

3.2. Growth of the ∆Ugd Mutant Was Defective in PY6 Medium

To investigate the growth of the Δugd mutant, growth curves were determined in two different media. The Δugd mutant showed an obvious growth defect in PY6 medium, with a lag phase of >24 h and slower growth compared with that of the wild-type strain (Figure 1A). Using the maximum absorbance value at 600 nm as an indicator of the maximum biomass of the strains, the maximum biomass of the Δugd mutant strain is only 65% that of the wild type. These results indicate that there are significant growth differences between the wild type and Δugd mutant in PY6 medium. However, in Stanier medium, a minimal medium with Stanier mineral salts, the growth of the Δugd mutant was nearly the same as that of the wild type (Figure 1B). Therefore, Stanier medium was used to study the properties of the Δugd mutant.

3.3. Deletion of Ugd Resulted in Defects in Cellulose Degradation and Cell Motility

The Δugd mutant exhibited similar growth to the wild type in liquid Stanier medium. Therefore, Stanier medium was selected to evaluate the cellulose degradation ability and cell motility of the Δugd mutant. The wild type could grow rapidly on plates of Stanier agar covered with filter parer, while the Δugd mutant was defective in filter paper degradation (Figure 2A). C. hutchinsonii can rapidly glide over solid surfaces without flagella or type IV pili [35]. Colony spreading of the wild-type and the Δugd mutant was determined on Stanier soft-agar plates. The wild-type cells formed spreading colonies on soft agar, while the ∆ugd mutant cells had lost the ability to spread on this medium (Figure 2B). According to the Image J 1.46r analysis results, the filter paper degradation zone of the ∆ugd mutant is only 0.525 times that of wild type and the colony spreading zone of the ∆ugd mutant is only 0.527 times that of wild type. The complemented strain Cugd could degrade cellulose and spread similarly to the wild type on soft agar.
The degradation of cellulose by C. hutchinsonii requires direct contact between the cells and the substrate. Therefore, the proper localization of cellulase on the cell surface is very important [16]. According to a previous report, the genome of C. hutchinsonii is predicted to encode 18 cellulases, of which 12 are substrate proteins of T9SS. They are transported across the outer membrane by T9SS and anchored to the cell surface to exert their function [16]. To explore the locations of cellulases in the wild type and the Δugd mutant, the endoglucanases in different cellular fractions were detected by zymography. As shown in Figure 2C, the endoglucanases of the wild type were mainly present in the periplasmic and outer membrane fractions. The cellulase detected in the periplasmic fraction of the Δugd mutant was slightly reduced compared to the wild type, while the cellulase in the Δugd mutant outer membrane fraction was significantly diminished. In contrast, the amount of endoglucanases in the extracellular fraction was markedly increased. We inferred that in the Δugd mutant, the cellulases are unable to anchor on the outer membrane and are released to the culture supernatant.

3.4. Ugd Was Involved in Protein Glycosylation in C. hutchinsonii

Our previous studies have shown that glycosylation modification is present in C. hutchinsonii [13,14]. Different lectins can specifically recognize glycoforms and serve as valuable tools for verifying protein glycosylation modification. We extracted the periplasmic and outer membrane proteins from both wild-type and ∆ugd mutant strains and conducted Western blot analysis using five different lectins, including Concanavalin A (ConA), Aleuria Aurantia Lectin (AAL), Sambucus Nigra Lectin (SNL), wheat germ agglutinin (WGA), and soybean agglutinin (SBA). The lectins employed in this study, along with their corresponding recognized structures, are listed in Table S1 [36,37]. We found that AAL can specifically recognize the C. hutchinsonii glycoprotein. A substantial number of outer membrane and periplasmic proteins in the wild-type strain were recognized by AAL, indicating that these proteins are glycosylated. However, only a limited number of proteins were detected in the ∆ugd mutant (Figure 3B).

3.5. The Effect of Ugd Deletion on Monosaccharide Components of Glycoproteins

To investigate the monosaccharide component involved in glycoprotein conjugation in C. hutchinsonii and the effect of Ugd on protein glycosylation, we extracted cytoplasmic and membrane proteins from wild-type and ∆ugd mutant strains. Glycoproteins were then enriched via boric acid affinity chromatography. The samples underwent PMP derivatization, and the monosaccharide components were analyzed by HPLC. As shown in Figure 4, seven monosaccharides were detected in the glycoproteins from C. hutchinsonii, with peak times matching those of the standard sample. An unknown monosaccharide was detected around 18.5 min. The total monosaccharide content in glycoproteins from the membrane components was higher than that from cytoplasmic components. Deletion of the ugd gene reduced the levels of mannose, glucose, galactose, and xylose in both the membrane and cytoplasmic glycoproteins compared to the wild-type strain. There was no significant difference in the content of glucosamine and arabinose between the glycoproteins of the wild-type and the ∆ugd mutant. Conversely, the content of an unidentified monosaccharide was increased in the ∆ugd mutant. These results indicate that Ugd plays an important role in the glycan synthesis of C. hutchinsonii glycoproteins.

3.6. Ugd Was Involved in the Glycosylation and Location of Cel9A

Cellulase Cel9A (CHU_1336) is a T9SS substrate protein with a CTD in C. hutchinsonii. Our previous studies showed that the fusion protein GFP-CTDCel9A was glycosylated in the periplasm of C. hutchinsonii [13]. To assess the impact of Ugd on the glycosylation of GFP-CTDCel9A, we expressed the fusion protein in the ∆ugd mutant strain, with GFP-CTDCel9A expressed in E. coli serving as a negative control without glycosylation. As shown in Figure 5A, two GFP-related bands were detected in wild-type C. hutchinsonii. According to our previous research [13], the higher-weight band was the target protein modified by glycosylation. When GFP-CTDCel9A was expressed in the ∆ugd C. hutchinsonii mutant, the glycosylated GFP-related band in the periplasm was decreased in intensity compared with that in the wild-type strain (Figure 5A). Based on the above results, we suggested that the Ugd contributes to glycosylation in Cel9A.
T9SS substrate proteins are often anchored to the outer membrane after being secreted [38]. To investigate the location of Cel9A, Western blot analysis was performed using a Cel9A-specific antibody. Cel9A was detected in the outer membrane of wild-type C. hutchinsonii, but was absent from the outer membrane of the ∆ugd mutant (Figure 5B). Instead, Cel9A accumulated in the periplasmic space of the ∆ugd mutant and was also present in the culture supernatant (Figure 5B). Interestingly, the molecular weight of Cel9A found in the periplasm and culture supernatant was approximately 100 kDa, matching the theoretical value based on its amino acid sequence (105 kDa). However, mature Cel9A in the outer membrane was detected, with a molecular weight of >130 kDa, suggesting it may have undergone an additional unknown modification after being transported to the cell surface. Further investigation is required to resolve this issue.

3.7. Ugd Is Important for the Synthesis of LPS

LPS was extracted from C. hutchinsonii wild type, Δugd mutant, and complemented strain Cugd by using hot aqueous phenol. The LPS samples were separated by Tricine SDS-PAGE and then visualized with silver stain. As shown in Figure 6A, the integrity of the LPS was disrupted by deletion of ugd. In Figure 6A, the part in the box is the O-antigen repeat unit of LPS, and the arrow indicates the LPS core. The O-antigen was missing in the Δugd mutant, and the lipid A core was heterogeneous in the mutant, with an increased molecular weight.
LPS is an important outer membrane component of Gram-negative bacteria, serving as a protective barrier against toxic agents. Truncation of LPS, particularly the O-antigen, results in a loss of this barrier, making the membrane more susceptible to external damage [39]. Therefore, the tolerance of the wild-type and the ∆ugd mutant to various reagents was determined on Stanier medium containing 0.5% (w/v) agar and 0.2% (w/v) glucose. The test reagents included 20% (w/v) sodium dodecyl sulfate, 1% (w/v) crystal violet, 0.5 M cumene hydroperoxide, 2 M dithiothreitol, and 100 μg/mL erythromycin. As shown in Figure 6B, the Δugd mutant cells were more sensitive to these reagents. Based on the statistics of the diameter of the inhibition zones and P-value analysis, it can be observed that the Δugd mutant cells are particularly sensitive to crystal violet, dithiothreitol, and erythromycin. The inhibition zones produced by the complementation strain Cugd showed no significant difference compared to the wild type (Supplementary Figure S5).

4. Discussion

T9SS substrate proteins were reported to contribute to cellulose degradation, cell motility, toxicity, and digestion of macromolecular substances [40,41,42]. Many cellulases in C. hutchinsonii are secreted to the cell surface through the T9SS. Previous studies in our laboratory have found that some T9SS substrate proteins in C. hutchinsonii are glycosylated in the periplasmic space, and glycosylation has effects on the secretion and localization of substrate proteins [14]. However, understanding of the glycosylation modification system in C. hutchinsonii remains very limited. Until now, only glycosyltransferase CHU_3842 and GtrA have been reported to be involved in the glycosylation process in C. hutchinsonii [13,14]. Here, we identified another enzyme, UDP-glucose 6-dehydrogenase, which was involved in not only protein glycosylation but also in LPS synthesis of C. hutchinsonii. Lectin blotting analysis revealed a significant reduction in glycoproteins recognized by AAL in the outer membrane and periplasmic components of the ∆ugd mutant strain compared to the wild-type strain (Figure 3B). The deletion of ugd resulted in a reduction in several monosaccharides, including mannose, glucose, galactose, and xylose, in the glycoproteins of C. hutchinsonii (Figure 4). AAL specifically binds to fucose residues; however, no peak corresponding to fucose was detected in the HPLC analysis of the glycoforms of these glycoproteins (Figure 4). This discrepancy may be due to the lower sensitivity of HPLC compared to lectin blotting. To our knowledge, no previous report has demonstrated the involvement of Ugd in glycosylation modification in bacteria. But further experiments are needed to demonstrate the involvement of Ugd in the glycosylation modification pathway of C. hutchinsonii.
LPS is an important part of the outer membrane of Gram-negative bacteria, which helps to maintain the integrity of the outer membrane [23]. In C. hutchinsonii, the ∆ugd mutant produced a truncated O-antigen of LPS, which led to migration above the band corresponding to the lipid A core in LPS silver staining result. Meanwhile, the O-antigen repeat units disappeared in the ∆ugd mutant (Figure 6A). In Burkholderia, OgcE is a UDP-glucose/galactose epimerase. Lipid A of LPS in a ∆ogcE mutant showed an upwardly heterogeneous state [43]. It was concluded that, because of the deletion of ogcE, UDP-GalNAc was absent, and the A-core combined with plus Rha-QuiNAc disaccharide, leading to an upshift in the position of lipid A in the LPS profile [43]. In the ∆ugd mutant of C. hutchinsonii, the reason for the lipid A upshift might be similar to that in the ∆ogcE mutant of Burkholderia. LPS are important cell barriers of Gram-negative bacterium. The deletion of ugd results in LPS deficiency, which might be a contributing factor to the increased sensitivity of Δugd cells to toxic reagents (Figure 6B).
C. hutchinsonii is capable of rapidly and efficiently degrading cellulose. However, the mechanism of its cellulose degradation has long been unknown. In this study, the deletion of ugd resulted in defects in cellulose degradation. A previous study has predicted that the genome of C. hutchinsonii encodes 18 cellulases, of which 12 are predicted to be T9SS substrates. These cellulases are transported by the T9SS system and anchored to the cell surface. The degradation of cellulose by C. hutchinsonii requires direct contact between the cells and the substrate; therefore, the normal anchoring of cellulase on the cell surface after translocation across the outer membrane is crucial [16]. Cel9A is a family-9 endoglucanase with a conserved CTD, expected to be located on the cell surface [44]. We found that in the ∆ugd mutant, the glycosylation modification of Cel9A is weakened (Figure 5A). Moreover, in the ∆ugd mutant, Cel9A failed to anchor on the outer membrane, but was accumulated in the periplasm or released into the culture supernatant (Figure 5B). We speculate that the accumulation of T9SS substrate in the periplasm might be caused by defective glycosylation of the substrate. However, it remains to be studied how glycosylation modification of the substrate proteins affects their transportation across the outer membrane via the T9SS.
In summary, the deletion of ugd had a broad impact on the phenotypes of C. hutchinsonii, including cellulose degradation, cell motility, and stress resistance. Ugd catalyzes the synthesis of UDP-glucuronic acid (UDP-GlcA), which serves as a direct or indirect precursor for various sugar nucleotides. Additionally, UDP-GlcA acts as a glucuronosyl donor in the biosynthesis of several structural polysaccharides. We speculated that Ugd influenced these phenotypes by participating in the synthesis of protein-linked glycans and LPS glycans. There are still many mysteries about the cellulose degradation and the glycosylation system of C. hutchinsonii. Our future work will focus on identifying more genes involved in glycosylation to comprehensively elucidate the glycosylation system of C. hutchinsonii, which will facilitate a deeper understanding of its efficient and rapid cellulose degradation mechanisms.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms13020395/s1, Figure S1: Map of the plasmid Sjhc; Figure S2: The deletion of ugd; Figure S3: HPLC chromatogram of standard monosaccharide PMP derivatization; Figure S4: The outer membrane and periplasmic proteins of wild-type and ∆ugd mutant were verified by Western blot and antibody-assisted lectin profiling; Figure S5: The diameters of the inhibition zones for wild type, ∆ugd, and Cugd strains treated with various toxic agents; Figure S6: Diagram illustrating Ugd’s involvement in the nucleotide sugar biosynthesis pathways of C. hutchinsonii. The deletion of Ugd in C. hutchinsonii disrupts one of the UDP-GlcA biosynthesis pathways, which in turn affects the synthesis of various nucleotide sugars, including UDP-D-Xyl, UDP-D-Api, and UDP-L-Ara4O; Table S1: The lectins used in this study.

Author Contributions

X.L. and W.S. developed the article’s initial concepts. W.S. and S.G. performed the experiments under the supervision of X.L., W.S. and X.L. analyzed the results and reviewed the manuscript. X.L. and Q.Q. revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

The work is supported by the National Natural Science Foundation of China (Grant number 32370031).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Acknowledgments

We sincerely thank Mark J McBride (University of Wisconsin-Milwaukee, Milwaukee, WI) for providing the C. hutchinsonii ATCC 33406 strain. We thank Liwen Bianji (Edanz) (available online: www.liwenbianji.cn) for editing the language of a draft of this manuscript. We thank Shuhang Zhang (College of Pharmacy, Heze University, Heze, 274015, China) for her assistance in experimental methods and manuscript writing.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Eichler, J. Protein glycosylation. Curr. Biol. 2019, 29, R229–R231. [Google Scholar] [CrossRef] [PubMed]
  2. Linton, D.; Allan, E.; Karlyshev, A.V. Identification of N-acetylgalactosamine-containing glycoproteins PEB3 and CgpA in Campylobacter jejuni. Mol. Microbiol. 2002, 43, 497–508. [Google Scholar] [CrossRef] [PubMed]
  3. Teng, K.W.; Hsieh, K.S.; Hung, J.S. Helicobacter pylori employs a general protein glycosylation system for the modification of outer membrane adhesins. Gut Microbes 2022, 14, 2130650. [Google Scholar] [CrossRef]
  4. Schirm, M.; Arora, S.K.; Verma, A. Structural and genetic characterization of glycosylation of type a flagellin in Pseudomonas aeruginosa. J. Bacteriol. 2004, 186, 2523–2531. [Google Scholar] [CrossRef] [PubMed]
  5. Grass, S.; Lichti, C.F.; Townsend, R.R. The Haemophilus influenzae HMW1C protein is a glycosyltransferase that transfers hexose residues to asparagine sites in the HMW1 adhesin. PLoS Pathog. 2010, 6, e1000919. [Google Scholar] [CrossRef]
  6. Schirm, M.; Kalmokoff, M.; Aubry, A. Flagellin from Listeria monocytogenes is glycosylated with beta-O-linked N-acetylglucosamine. J. Bacteriol. 2004, 186, 6721–6727. [Google Scholar] [CrossRef]
  7. Valiente, E.; Bouche, L.; Hitchen, P. Role of Glycosyltransferases Modifying Type B Flagellin of Emerging Hypervirulent Clostridium difficile Lineages and Their Impact on Motility and Biofilm Formation. J. Biol. Chem. 2016, 291, 25450–25461. [Google Scholar] [CrossRef]
  8. Zhang, H.; Zhu, F.; Yang, T. The highly conserved domain of unknown function 1792 has a distinct glycosyltransferase fold. Nat. Commun. 2014, 5, 4339. [Google Scholar] [CrossRef]
  9. Fletcher, C.M.; Coyne, M.J.; Villa, O.F. A general O-glycosylation system important to the physiology of a major human intestinal symbiont. Cell 2009, 137, 321–331. [Google Scholar] [CrossRef]
  10. Kishi, M.; Hasegawa, Y.; Nagano, K. Identification and characterization of novel glycoproteins involved in growth and biofilm formation by Porphyromonas gingivalis. Mol. Oral Microbiol. 2012, 27, 458–470. [Google Scholar] [CrossRef]
  11. Qi, F.F.; Zhang, W.X.; Zhang, F.J. Deciphering the Effect of the Different N-Glycosylation Sites on the Secretion, Activity, and Stability of Cellobiohydrolase I from Trichoderma reesei. Appl. Environ. Microbiol. 2014, 80, 3962–3971. [Google Scholar] [CrossRef] [PubMed]
  12. Song, W.X.; Zhuang, X.K.; Tan, Y.H. The type IX secretion system: Insights into its function and connection to glycosylation in Cytophaga hutchinsonii. Eng. Microbiol. 2022, 2, 100038. [Google Scholar] [CrossRef] [PubMed]
  13. Xie, S.S.; Huang, Q.; Tan, R.H. Glycosyltransferase-Related Protein GtrA Is Essential for Localization of Type IX Secretion System Cargo Protein Cellulase Cel9A and Affects Cellulose Degradation in Cytophaga hutchinsonii. Appl. Environ. Microbiol. 2022, 88, e01076-22. [Google Scholar] [CrossRef] [PubMed]
  14. Xie, S.S.; Tan, Y.H.; Song, W.X. Cytophaga hutchinsonii Glycosylation of a Cargo Protein C-Terminal Domain Recognized by the Type IX Secretion System in Affects Protein Secretion and Localization. Appl. Environ. Microbiol. 2022, 88, e01606-21. [Google Scholar] [CrossRef]
  15. Ji, X.F.; Wang, Y.; Zhang, C. Novel outer membrane protein involved in cellulose and cellooligosaccharide degradation by Cytophaga hutchinsonii. Appl. Environ. Microbiol. 2014, 80, 4511–4518. [Google Scholar] [CrossRef]
  16. Taillefer, M.; Arntzen, M.O.; Henrissat, B. Proteomic Dissection of the Cellulolytic Machineries Used by Soil-Dwelling. Msystems 2018, 3, e00240-18. [Google Scholar] [CrossRef]
  17. Gao, L.J.; Guan, Z.W.; Gao, P. Cytophaga hutchinsonii gldN, Encoding a Core Component of the Type IX Secretion System, Is Essential for Ion Assimilation, Cellulose Degradation, and Cell Motility. Appl. Environ. Microbiol. 2020, 86, e00242-20. [Google Scholar] [CrossRef]
  18. Gao, L.J.; Tan, Y.H.; Zhang, W.C. Cytophaga hutchinsonii SprA and SprT Are Essential Components of the Type IX Secretion System Required for Ca2+ Acquisition, Cellulose Degradation, and Cell Motility. Front. Microbiol. 2021, 12, 628555. [Google Scholar] [CrossRef]
  19. Zhao, D.; Song, W.X.; Wang, S. Identification of the Type IX Secretion System Component, PorV (CHU_3238), Involved in Secretion and Localization of Proteins in Cytophaga hutchinsonii. Front. Microbiol. 2021, 12, 742673. [Google Scholar] [CrossRef]
  20. Kulkarni, S.S.; Zhu, Y.T.; Brendel, C.J. Diverse C-Terminal Sequences Involved in Protein Secretion. J. Bacteriol. 2017, 199, e00884-16. [Google Scholar] [CrossRef]
  21. Seers, C.A.; Slakeski, N.; Veith, P.D. The RgpB C-terminal domain has a role in attachment of RgpB to the outer membrane and belongs to a novel C-terminal-domain family found in Porphyromonas gingivalis. J. Bacteriol. 2006, 188, 6376–6386. [Google Scholar] [CrossRef] [PubMed]
  22. Shoji, M.; Sato, K.; Yukitake, H. Por Secretion System-Dependent Secretion and Glycosylation of Hemin-Binding Protein 35. PLoS ONE 2011, 6, e21372. [Google Scholar] [CrossRef] [PubMed]
  23. Egger, S.; Chaikuad, A.; Kavanagh, K.L. UDP-glucose dehydrogenase: Structure and function of a potential drug target. Biochem. Soc. Trans. 2010, 38, 1378–1385. [Google Scholar] [CrossRef] [PubMed]
  24. Johansson, H.; Sterky, F.; Amini, B. Molecular cloning and characterization of a cDNA encoding poplar UDP-glucose dehydrogenase, a key gene of hemicellulose/pectin formation. BBA-Gene Struct. Expr. 2002, 1576, 53–58. [Google Scholar] [CrossRef]
  25. Mainprize, I.L.; Bean, J.D.; Bouwman, C. The UDP-glucose Dehydrogenase of K-12 Displays Substrate Inhibition by NAD That Is Relieved by Nucleotide Triphosphates. J. Biol. Chem. 2013, 288, 23064–23074. [Google Scholar] [CrossRef]
  26. Sato, K.; Kido, N.; Murakami, Y. Lipopolysaccharide biosynthesis-related genes are required for colony pigmentation of Porphyromonas gingivalis. Microbiology 2009, 155, 1282–1293. [Google Scholar] [CrossRef]
  27. Cahill, S.M.; Arbatsky, N.P.; Shashkov, A.S. Elucidation of the K32 Capsular Polysaccharide Structure and Characterization of the KL32 Gene Cluster of Acinetobacter baumannii LUH5549. Biochemistry 2020, 85, 241–247. [Google Scholar] [CrossRef]
  28. Ariyakumar, D.S.; Nishiguchi, M.K. Characterization of two host-specific genes, mannose-sensitive hemagglutinin (mshA) and uridyl phosphate dehydrogenase (UDPDH) that are involved in the Vibrio fischeri-Euprymna tasmanica mutualism. FEMS Microbiol. Lett. 2009, 299, 65–73. [Google Scholar] [CrossRef]
  29. Wang, Y.; Wang, Z.Q.; Cao, J. FLP-FRT-based method to obtain unmarked deletions of CHU_3237 (porU) and large genomic fragments of Cytophaga hutchinsonii. Appl. Environ. Microbiol. 2014, 80, 6037–6045. [Google Scholar] [CrossRef]
  30. Ben Guerrero, E.; Arneodo, J.; Campanha, R.B. Prospection and Evaluation of (Hemi) Cellulolytic Enzymes Using Untreated and Pretreated Biomasses in Two Argentinean Native Termites. PLoS ONE 2015, 10, e0136573. [Google Scholar] [CrossRef]
  31. Zhong, M.Y.; Yan, Y.; Yuan, H.S. Astragalus mongholicus polysaccharides ameliorate hepatic lipid accumulation and inflammation as well as modulate gut microbiota in NAFLD rats. Food Funct. 2022, 13, 7287–7301. [Google Scholar] [CrossRef] [PubMed]
  32. Ahn, Y.H.; Kim, J.Y.; Yoo, J.S. Quantitative Mass Spectrometric Analysis of Glycoproteins Combined with Enrichment Methods. Mass Spectrom. Rev. 2015, 34, 148–165. [Google Scholar] [CrossRef] [PubMed]
  33. Davis, M.R.; Goldberg, J.B. Purification and Visualization of Lipopolysaccharide from Gram-negative Bacteria by Hot Aqueous-phenol Extraction. JoVE-J. Vis. Exp. 2012, 63, e3916. [Google Scholar] [CrossRef]
  34. Zhao, D.; Wang, Y.; Wang, S. A Disulfide Oxidoreductase (CHU_1165) Is Essential for Cellulose Degradation by Affecting Outer Membrane Proteins in Cytophaga hutchinsonii. Appl. Environ. Microbiol. 2020, 86, e02789-19. [Google Scholar] [CrossRef] [PubMed]
  35. Xie, G.; Bruce, D.C.; Challacombe, J.F. Genome sequence of the cellulolytic gliding bacterium Cytophaga hutchinsonii. Appl. Environ. Microbiol. 2007, 73, 3536–3546. [Google Scholar] [CrossRef]
  36. Goumenou, A.; Delaunay, N.; Pichon, V. Recent Advances in Lectin-Based Affinity Sorbents for Protein Glycosylation Studies. Front. Mol. Biosci. 2021, 8, 746822. [Google Scholar] [CrossRef]
  37. Li, S.; Meng, J.; Xu, F. IgG Glycosylation Profiling of Peripheral Artery Diseases with Lectin Microarray. J. Clin. Med. 2022, 11, 5727. [Google Scholar] [CrossRef]
  38. Gabarrini, G.; Heida, R.; van Ieperen, N. Dropping anchor: Attachment of peptidylarginine deiminase A-LPS to secreted outer membrane vesicles of Porphyromonas gingivalis. Sci. Rep. 2018, 8, 8949. [Google Scholar] [CrossRef]
  39. Sperandeo, P.; Martorana, A.M.; Polissi, A. Lipopolysaccharide Biosynthesis and Transport to the Outer Membrane of Gram-Negative Bacteria. Subcell. Biochem. 2019, 92, 9–37. [Google Scholar] [CrossRef]
  40. Barbier, P.; Rochat, T.; Mohammed, H.H. The Type IX Secretion System Is Required for Virulence of the Fish Pathogen Flavobacterium psychrophilum. Appl. Environ. Microbiol. 2020, 86, e00799-20. [Google Scholar] [CrossRef]
  41. Kharade, S.S.; McBride, M.J. Flavobacterium johnsoniae chitinase ChiA is required for chitin utilization and is secreted by the type IX secretion system. J. Bacteriol. 2014, 196, 961–970. [Google Scholar] [CrossRef] [PubMed]
  42. Li, N.; Zhu, Y.T.; LaFrentz, B.R. The Type IX Secretion System Is Required for Virulence of the Fish Pathogen Flavobacterium columnare. Appl. Environ. Microbiol. 2017, 83, e01769-17. [Google Scholar] [CrossRef] [PubMed]
  43. Mohamed, Y.F.; Scott, N.E.; Molinaro, A. A general protein glycosylation machinery conserved in species improves bacterial fitness and elicits glycan immunogenicity in humans. J. Biol. Chem. 2019, 294, 13248–13268. [Google Scholar] [CrossRef] [PubMed]
  44. Zhu, Y.T.; Han, L.L.; Hefferon, K.L. Periplasmic Cytophaga hutchinsonii Endoglucanases Are Required for Use of Crystalline Cellulose as the Sole Source of Carbon and Energy. Appl. Environ. Microbiol. 2016, 82, 4835–4845. [Google Scholar] [CrossRef]
Microorganisms 13 00395 g001
Figure 1. Growth determination of wild-type (WT) Cytophaga hutchinsonii ATCC 33406 and the ∆ugd mutant. (A) Growth curves of cells in PY6 medium. (B) Growth curves of cells in Stanier medium. WT—C. hutchinsonii wild-type strain; ∆ugd—chu_3394 deletion strain. Growth was determined from absorbance values at 600 nm. Three biological replicates were set, and the mean values and SDs are shown.
Figure 1. Growth determination of wild-type (WT) Cytophaga hutchinsonii ATCC 33406 and the ∆ugd mutant. (A) Growth curves of cells in PY6 medium. (B) Growth curves of cells in Stanier medium. WT—C. hutchinsonii wild-type strain; ∆ugd—chu_3394 deletion strain. Growth was determined from absorbance values at 600 nm. Three biological replicates were set, and the mean values and SDs are shown.
Microorganisms 13 00395 g001
Microorganisms 13 00395 g002
Figure 2. Cellulose degradation ability and colony spreading of the wild-type and Δugd mutant. (A) Filter paper degradation ability. (B) Colony spreading ability. (C) Detection of endoglucanases by zymography. WT—C. hutchinsonii wild-type strain; ∆ugd—chu_3394 deletion strain. Cugd—complementation of Δugd mutant. All assays were performed in triplicate using three independent transformants, which yielded consistent results, and a representative result is presented. Significance is reported as ** p < 0.01, *** p < 0.001.
Figure 2. Cellulose degradation ability and colony spreading of the wild-type and Δugd mutant. (A) Filter paper degradation ability. (B) Colony spreading ability. (C) Detection of endoglucanases by zymography. WT—C. hutchinsonii wild-type strain; ∆ugd—chu_3394 deletion strain. Cugd—complementation of Δugd mutant. All assays were performed in triplicate using three independent transformants, which yielded consistent results, and a representative result is presented. Significance is reported as ** p < 0.01, *** p < 0.001.
Microorganisms 13 00395 g002
Microorganisms 13 00395 g003
Figure 3. UDP-glucose 6-dehydrogenase (Ugd) is involved in glycosylation in C. hutchinsonii. (A) SDS-PAGE analysis of outer membrane and periplasmic proteins from the wild type and ∆ugd mutant strains, with sample loading normalized to equal biomass. (B) Western blot analysis demonstrating that Aleuria aurantia lectin (AAL) recognizes glycoproteins in the wild-type strain, while only a limited number of glycoprotein bands are detected in the ∆ugd mutant. (C) Quantitative analysis of Western blot band intensity in Figure 3B using Image J 1.46r. Significance reported as *** p < 0.001. WT—C. hutchinsonii wild-type strain; ∆ugd—chu_3394 deletion strain.
Figure 3. UDP-glucose 6-dehydrogenase (Ugd) is involved in glycosylation in C. hutchinsonii. (A) SDS-PAGE analysis of outer membrane and periplasmic proteins from the wild type and ∆ugd mutant strains, with sample loading normalized to equal biomass. (B) Western blot analysis demonstrating that Aleuria aurantia lectin (AAL) recognizes glycoproteins in the wild-type strain, while only a limited number of glycoprotein bands are detected in the ∆ugd mutant. (C) Quantitative analysis of Western blot band intensity in Figure 3B using Image J 1.46r. Significance reported as *** p < 0.001. WT—C. hutchinsonii wild-type strain; ∆ugd—chu_3394 deletion strain.
Microorganisms 13 00395 g003
Microorganisms 13 00395 g004
Figure 4. HPLC chromatogram of C. hutchinsonii glycoproteins PMP derivatization. (A) Analysis of monosaccharides in membrane glycoproteins of wild-type and ∆ugd mutant strains by HPLC. (B) Analysis of monosaccharides in cytoplasmic glycoproteins of wild-type and ∆ugd mutant strains by HPLC. WT—C. hutchinsonii wild-type strain; ∆ugd—chu_3394 deletion strain; Man—mannose; GlcN—glucosamine; Rha—rhamnose; Lac—lactose; Glc—glucose; Gal—galactose; Xyl—xylose; Ara—arabinose. Lactose is used as an internal standard. Three independent biological replicates were performed, yielding consistent results. A representative data set is presented.
Figure 4. HPLC chromatogram of C. hutchinsonii glycoproteins PMP derivatization. (A) Analysis of monosaccharides in membrane glycoproteins of wild-type and ∆ugd mutant strains by HPLC. (B) Analysis of monosaccharides in cytoplasmic glycoproteins of wild-type and ∆ugd mutant strains by HPLC. WT—C. hutchinsonii wild-type strain; ∆ugd—chu_3394 deletion strain; Man—mannose; GlcN—glucosamine; Rha—rhamnose; Lac—lactose; Glc—glucose; Gal—galactose; Xyl—xylose; Ara—arabinose. Lactose is used as an internal standard. Three independent biological replicates were performed, yielding consistent results. A representative data set is presented.
Microorganisms 13 00395 g004
Microorganisms 13 00395 g005
Figure 5. Ugd is involved in the glycosylation and location of Cel9A. (A) Detection of periplasmic fraction proteins from WTGFP-Cel9ACTD, ∆ugdGFP-Cel9ACTD, and E. coliGFP-Cel9ACTD strains using an anti-GFP antibody. (B) Localization and secretion of type IX secretion system (T9SS) substrate protein Cel9A in the wild-type and the ∆ugd mutant using an anti-Cel9A antibody. WT—C. hutchinsonii wild-type strain; ∆ugd—chu_3394 deletion strain; P—periplasmic proteins; OM—outer membrane proteins.
Figure 5. Ugd is involved in the glycosylation and location of Cel9A. (A) Detection of periplasmic fraction proteins from WTGFP-Cel9ACTD, ∆ugdGFP-Cel9ACTD, and E. coliGFP-Cel9ACTD strains using an anti-GFP antibody. (B) Localization and secretion of type IX secretion system (T9SS) substrate protein Cel9A in the wild-type and the ∆ugd mutant using an anti-Cel9A antibody. WT—C. hutchinsonii wild-type strain; ∆ugd—chu_3394 deletion strain; P—periplasmic proteins; OM—outer membrane proteins.
Microorganisms 13 00395 g005
Microorganisms 13 00395 g006
Figure 6. Lipopolysaccharide (LPS) and disk diffusion susceptibility assays for the wild-type, ∆ugd, and Cugd (chu_3394 complementation) strains of C. hutchinsonii. (A) Silver staining analysis of wild-type and ∆ugd LPS extracts. The part in the box is the O-antigen repeat unit of LPS; the arrow indicates the LPS core. (B) Cell sensitivity to toxic reagents of the wild-type, ∆ugd, and Cugd (chu_3394 complementation) strains. SDS–sodium dodecyl sulfate; CV–crystal violet; CHP—cumene hydroperoxide; DTT—dithiothreitol; EM—erythromycin. Three biological replicates were set, and a representative result is presented.
Figure 6. Lipopolysaccharide (LPS) and disk diffusion susceptibility assays for the wild-type, ∆ugd, and Cugd (chu_3394 complementation) strains of C. hutchinsonii. (A) Silver staining analysis of wild-type and ∆ugd LPS extracts. The part in the box is the O-antigen repeat unit of LPS; the arrow indicates the LPS core. (B) Cell sensitivity to toxic reagents of the wild-type, ∆ugd, and Cugd (chu_3394 complementation) strains. SDS–sodium dodecyl sulfate; CV–crystal violet; CHP—cumene hydroperoxide; DTT—dithiothreitol; EM—erythromycin. Three biological replicates were set, and a representative result is presented.
Microorganisms 13 00395 g006
Table 1. Strains and plasmids used in this study.
Table 1. Strains and plasmids used in this study.
Strains, Plasmids Description aReferences or Source
Strains
C. hutchinsonii strains
ATCC 33406Wild typeLaboratory preservation
Δugd strainDeletion mutant of chu_3394This study
Cugd strainComplementation of Δugd mutant with pTSK3328-3394This study
WTGFP-Cel9ACTD strainWT containing promoter2708-signal peptide2708-GFP-CTDCel9A[13]
ΔugdGFP-Cel9ACTD strainΔ3394 containing promoter2708-signal peptide2708-GFP-CTDCel9AThis study
E. coli strains
DH5αStrain used for plasmid replicationPurchased from Tsingke (Beijing, China)
W3110 (DE3)Strain used for protein expressionPurchased from WEIDI
(Shanghai, China)
Plasmids
SjhcGene deletion template plasmid carrying Cm flanked by two MCS; Apr (Cmr)This study
Sjhc-3394Gene deletion template plasmid carrying chu_3394-targeting cassette; Apr (Cmr)This study
pTSK3328-C3394Plasmid constructed from pTSK3328 used for complementation of Δugd; Apr (Emr)This study
pBAD24Expression vector; AprLaboratory preservation
pBAD24-GFP-CTDCel9APlasmid constructed from pBAD24 for expression of GFP-CTDCel9A; AprThis study
a Cmr (chloramphenicol resistance) and Emr (erythromycin resistance) were expressed in C. hutchinsonii, and Apr (ampicillinresistance) was expressed in E. coli.
Table 2. Sequences of primers used in this study.
Table 2. Sequences of primers used in this study.
PrimersSequence a (5′-3′)Purpose
3394H1FCGGGATCCGTAATTTAAGACGGTAAGAAGCACGCloning 3394H1
3394H1RAACTGCAGCCGTTACTAAACCAACGTATCCC
3394H2FACGAGCTCCTGATCGTTACCGAATGGTCTGACloning 3394H2
3394H2RGCTCTAGAATCTTTGCGGCTTCTGCTACTTT
3394H1UFCGGATACCAGTGCCATACAACAADeletion validation of chu_3394
3394URCTGAGGAGCATCTATACCAACCA
C3394FGCGTCGACCTACAGGAAATTCCTGTACTTCATCCCATTTCCloning C3394
C3394RACGAGCTCTTATTCTGCTTTTAGTCCGATGCAGTAGTAATC
EM3328H1FTTAGCATGCTCTGTTGAGCAGGTTCTACTGGGCloning fragment 3328H1-EM-C3394-3328H2
EM3328H2RATAGGATCCTCTATAATTGGCTGACCGACACG
EM3328UFAGTAAGCGGTATGTGTGAAATGTGCComplementation validation of chu_3394
EM3328URGTTGCCTTCTTTGATTATGCCGTC
C3394RYZGGTTAAGTAGCATTATAATGGAATACGTTG
CM-RGTTTTATCCGGCCTTTATTCACATTDeletion validation of chu_3394 with primer 3394H1UF
PB-GFPFCGCCCGGGATGAAAAAAGTTTTACTTTCTTTATCAATGCCloning GFP-CTDCel9A expressed in Escherichia coli
PB-GFPRAGGTCGACTTAGTATTTAATGATATTCATCG
PB-YZFCGCAACTCTCTACTGTTTCTCCValidation GFP-CTDCel9A expression in Escherichia coli
PB-YZRCAGACCGCTTCTGCGTTCTG
a The underline indicates the restriction endonuclease cleavage site in the primer.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Song, W.; Geng, S.; Qi, Q.; Lu, X. Ugd Is Involved in the Synthesis of Glycans of Glycoprotein and LPS and Is Important for Cellulose Degradation in Cytophaga hutchinsonii. Microorganisms 2025, 13, 395. https://doi.org/10.3390/microorganisms13020395

AMA Style

Song W, Geng S, Qi Q, Lu X. Ugd Is Involved in the Synthesis of Glycans of Glycoprotein and LPS and Is Important for Cellulose Degradation in Cytophaga hutchinsonii. Microorganisms. 2025; 13(2):395. https://doi.org/10.3390/microorganisms13020395

Chicago/Turabian Style

Song, Wenxia, Shaoqi Geng, Qingsheng Qi, and Xuemei Lu. 2025. "Ugd Is Involved in the Synthesis of Glycans of Glycoprotein and LPS and Is Important for Cellulose Degradation in Cytophaga hutchinsonii" Microorganisms 13, no. 2: 395. https://doi.org/10.3390/microorganisms13020395

APA Style

Song, W., Geng, S., Qi, Q., & Lu, X. (2025). Ugd Is Involved in the Synthesis of Glycans of Glycoprotein and LPS and Is Important for Cellulose Degradation in Cytophaga hutchinsonii. Microorganisms, 13(2), 395. https://doi.org/10.3390/microorganisms13020395

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop