Characterisation of Putative Outer Membrane Proteins from Leptospira borgpetersenii Serovar Hardjo-Bovis Identifies Novel Adhesins and Diversity in Adhesion across Genomospecies Orthologs
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Cultures and DNA Extraction
2.2. In Silico Identification of Unique L. borgpetersenii Hardjo-Bovis OMPs
2.3. Cloning, Expression and Purification of Recombinant OMPs
2.4. Circular Dichroism Spectroscopy
2.5. Host Ligand Components
2.6. Binding of Recombinant Proteins to Host Components
2.7. Binding-Saturation Experiment
2.8. Assessment of Recombinant OMPs Binding to Fibrinogen Chains by Far-Western Blotting
2.9. Anti-Leptospiral OMP Antibodies in Cattle Milk Samples
2.10. Statistical Analysis
2.11. In Silico Analysis of the Allelic Diversity of LBL2618 and OmpL1
2.12. Construction of Expression Vector
2.13. Protein Expression and Purification of Leptospira Recombinant OMP Variants
3. Results
3.1. Selection of Putative Transmembrane OMPs from L. borgpetersenii Serovar Hardjo-Bovis L550 Genome
3.2. Overexpression, Purification and Determination of Secondary Structure of Recombinant OMPs
3.3. Assessment of Protein Structure Using SDS-PAGE Analysis
3.4. Adherence of Recombinant OMPs to Host Components
3.5. Recombinant Leptospiral OMPs Binding to Fibrinogen Components
3.6. Evaluation of Host Antibody Reactivity against Leptospiral Proteins
3.7. In Silico Analysis of the Allelic Diversity of LBL2618 and OmpL1
Selection of OmpL1 and LBL2618 across Pathogenic Genomospecies
3.8. Variant OmpL1 and rLBL2618 Production, Secondary Structure and Binding to Host Molecules
3.9. Binding Saturation Curves of Leptospiral Recombinant OMP Variants to Select Host Molecules
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lehmann, J.S.; Matthias, M.A.; Vinetz, J.M.; Fouts, D.E. Leptospiral Pathogenomics. Pathogens 2014, 3, 280–308. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Torgerson, P.R.; Hagan, J.E.; Costa, F.; Calcagno, J.; Kane, M.; Martinez-Silveira, M.S.; Goris, M.G.A.; Stein, C.; Ko, A.I.; Abela-Ridder, B. Global Burden of Leptospirosis: Estimated in Terms of Disability Adjusted Life Years. PLoS Neglected Trop. Dis. 2015, 9, e0004122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fouts, D.E.; Matthias, M.A.; Adhikarla, H.; Adler, B.; Amorim-Santos, L.; Berg, D.E.; Bulach, D.; Buschiazzo, A.; Chang, Y.-F.; Galloway, R.L.; et al. What Makes a Bacterial Species Pathogenic?: Comparative Genomic Analysis of the Genus Leptospira. PLoS Neglected Trop. Dis. 2016, 10, e0004403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, Y.; Zhu, Y.; Wang, Y.; Chang, Y.-F.; Zhang, Y.; Jiang, X.; Zhuang, X.; Zhu, Y.; Zhang, J.; Zeng, L.; et al. Whole genome sequencing revealed host adaptation-focused genomic plasticity of pathogenic Leptospira. Sci. Rep. 2016, 6, 20020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bennett, R.M.; Christiansen, K.; Clifton-Hadley, R.S. Estimating the costs associated with endemic diseases of dairy cattle. J. Dairy Res. 1999, 66, 455–459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martins, G.; Lilenbaum, W. Control of bovine leptospirosis: Aspects for consideration in a tropical environment. Res. Veter. Sci. 2017, 112, 156–160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grooms, D.L. Reproductive losses caused by bovine viral diarrhea virus and leptospirosis. Theriogenology 2006, 66, 624–628. [Google Scholar] [CrossRef] [Scilit]
- Schoonman, L.; Swai, E.S. Herd- and animal-level risk factors for bovine leptospirosis in Tanga region of Tanzania. Trop. Anim. Health Prod. 2010, 42, 1565–1572. [Google Scholar] [CrossRef] [Scilit]
- Bolin, C.A.; Alt, D.P. Use of a monovalent leptospiral vaccine to prevent renal colonization and urinary shedding in cattle exposed to Leptospira borgpetersenii serovar hardjo. Am. J. Veter. Res. 2001, 62, 995–1000. [Google Scholar] [CrossRef] [Scilit]
- Raja, V.; Natarajaseenivasan, K. Pathogenic, diagnostic and vaccine potential of leptospiral outer membrane proteins (OMPs). Crit. Rev. Microbiol. 2015, 41, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Fernandes, L.G.V.; Vieira, M.L.; Kirchgatter, K.; Alves, I.J.; de Morais, Z.M.; Vasconcellos, S.A.; Romero, E.C.; Nascimento, A.L.T.O. OmpL1 Is an Extracellular Matrix- and Plasminogen-Interacting Protein of Leptospira spp. Infect. Immun. 2012, 80, 3679–3692. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pinne, M.; Choy, H.A.; Haake, D.A. The OmpL37 surface-exposed protein is expressed by pathogenic Leptospira during infection and binds skin and vascular elastin. PLoS Neglected Trop. Dis. 2010, 4, e815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shang, E.S.; Exner, M.M.; Summers, T.A.; Martinich, C.; I Champion, C.; E Hancock, R.; A Haake, D. The rare outer membrane protein, OmpL1, of pathogenic Leptospira species is a heat-modifiable porin. Infect. Immun. 1995, 63, 3174–3181. [Google Scholar] [CrossRef] [Scilit]
- Bulach, D.M.; Zuerner, R.L.; Wilson, P.; Seemann, T.; McGrath, A.; Cullen, P.A.; Davis, J.; Johnson, M.; Kuczek, E.; Alt, D.P.; et al. Genome reduction in Leptospira borgpetersenii reflects limited transmission potential. Proc. Natl. Acad. Sci. USA 2006, 103, 14560–14565. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rappuoli, R. Reverse vaccinology. Curr. Opin. Microbiol. 2000, 3, 445–450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ko, A.I.; Reis, M.G.; Dourado, C.M.R.; Johnson, W.D., Jr.; Riley, L.W. Urban epidemic of severe leptospirosis in Brazil. Salvador Leptospirosis Study Group. Lancet 1999, 354, 820–825. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Staton, G.J.; Carter, S.D.; Ainsworth, S.; Mullin, J.; Smith, R.F.; Evans, N.J. Putative β-Barrel Outer Membrane Proteins of the Bovine Digital Dermatitis-Associated Treponemes: Identification, Functional Characterization, and Immunogenicity. Infect. Immun. 2020, 88, 1110–1128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Petersen, T.N.; Brunak, S.; von Heijne, G.; Nielsen, H. SignalP 4.0: Discriminating signal peptides from transmembrane regions. Nat. Methods 2011, 8, 785–786. [Google Scholar] [CrossRef] [Scilit]
- Bagos, P.G.; Liakopoulos, T.D.; Spyropoulos, I.C.; Hamodrakas, S.J. PRED-TMBB: A web server for predicting the topology of -barrel outer membrane proteins. Nucleic Acids Res. 2004, 32, W400–W404. [Google Scholar] [CrossRef] [Scilit]
- Berven, F.S.; Flikka, K.; Jensen, H.B.; Eidhammer, I. BOMP: A program to predict integral -barrel outer membrane proteins encoded within genomes of Gram-negative bacteria. Nucleic Acids Res. 2004, 32, W394–W399. [Google Scholar] [CrossRef] [Scilit]
- Bagos, P.G.; Liakopoulos, T.D.; Hamodrakas, S.J. Finding beta-barrel outer membrane proteins with a Markov chain model. WSEAS Trans. Biol. Biomed. 2004, 2, 186–189. [Google Scholar]
- Enright, A.J.; Van Dongen, S.; Ouzounis, C.A. An efficient algorithm for large-scale detection of protein families. Nucleic Acids Res. 2002, 30, 1575–1584. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
- Sachdeva, G.; Kumar, K.; Jain, P.; Ramachandran, S. SPAAN: A software program for prediction of adhesins and adhesin-like proteins using neural networks. Bioinformatics 2005, 21, 483–491. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nascimento, A.L.T.O.; Ko, A.I.; Martins, E.A.L.; Monteiro-Vitorello, C.B.; Ho, P.L.; Haake, D.A.; Verjovski-Almeida, S.; Hartskeerl, R.A.; Marques, M.V.; Oliveira, M.C.; et al. Comparative Genomics of Two Leptospira interrogans Serovars Reveals Novel Insights into Physiology and Pathogenesis. J. Bacteriol. 2004, 186, 2164–2172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rosano, G.L.; Morales, E.S.; Ceccarelli, E.A. New tools for recombinant protein production in Escherichia coli: A 5-year update. Protein Sci. 2019, 28, 1412–1422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burgess, R.R. Refolding solubilized inclusion body proteins. Methods Enzymol. 2009, 463, 259–282. [Google Scholar] [CrossRef] [Scilit]
- Wiedemann, C.; Bellstedt, P.; Görlach, M. CAPITO—A web server-based analysis and plotting tool for circular dichroism data. Bioinformatics 2013, 29, 1750–1757. [Google Scholar] [CrossRef] [Scilit]
- Staton, G.J.; Clegg, S.R.; Ainsworth, S.; Armstrong, S.; Carter, S.D.; Radford, A.D.; Darby, A.; Wastling, J.; Hall, N.; Evans, N.J. Dissecting the molecular diversity and commonality of bovine and human treponemes identifies key survival and adhesion mechanisms. PLoS Pathog. 2021, 17, e1009464. [Google Scholar] [CrossRef] [Scilit]
- Barbosa, A.S.; Abreu, P.A.E.; Neves, F.O.; Atzingen, M.V.; Watanabe, M.M.; Vieira, M.L.; Morais, Z.M.; Vasconcellos, S.A.; Nascimento, A.L.T.O. A Newly Identified Leptospiral Adhesin Mediates Attachment to Laminin. Infect. Immun. 2006, 74, 6356–6364. [Google Scholar] [CrossRef] [Scilit]
- Walsh, B.W.; Lenhart, J.S.; Schroeder, J.W.; Simmons, L.A. Far Western Blotting as a Rapid and Efficient Method for Detecting Interactions Between DNA Replication and DNA Repair Proteins. In Single-Stranded DNA Binding Proteins; Springer: Berlin/Heidelberg, Germany, 2012; pp. 161–168. [Google Scholar] [CrossRef] [Scilit]
- Yan, K.-T.; Ellis, W.; Mackie, D.; Taylor, M.; McDowell, S.; Montgomery, J. Development of an ELISA to detect antibodies to a protective lipopolysaccharide fraction of Leptospira borgpetersenii serovar hardjo in cattle. Veter.-Microbiol. 1999, 69, 173–187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ryan, E.G.; Leonard, N.; O’grady, L.; More, S.J.; Doherty, M.L. Seroprevalence of Leptospira hardjo in the Irish suckler cattle population. Ir. Veter. J. 2012, 65, 8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, Y.-P.; Lee, D.-W.; McDonough, S.P.; Nicholson, L.K.; Sharma, Y.; Chang, Y.-F. Repeated domains of Leptospira immunoglobulin-like proteins interact with elastin and tropoelastin. J. Biol. Chem. 2009, 284, 19380–19391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hall, A.T. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Scilit]
- Guerreiro, H.; Croda, J.; Flannery, B.; Mazel, M.; Matsunaga, J.; Reis, M.G.; Levett, P.N.; Ko, A.I.; Haake, D.A. Leptospiral Proteins Recognized during the Humoral Immune Response to Leptospirosis in Humans. Infect. Immun. 2001, 69, 4958–4968. [Google Scholar] [CrossRef] [Scilit]
- Subathra, M.; Senthilkumar, T.M.A.; Ramadass, P. Recombinant OmpL1 protein as a diagnostic antigen for the detection of canine leptospirosis. Appl. Biochem. Biotechnol. 2012, 169, 431–437. [Google Scholar] [CrossRef] [Scilit]
- Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [Scilit]
- Haake, D.A.; Suchard, M.A.; Kelley, M.M.; Dundoo, M.; Alt, D.P.; Zuerner, R.L. Molecular evolution and mosaicism of leptospiral outer membrane proteins involves horizontal DNA transfer. J. Bacteriol. 2004, 186, 2818–2828. [Google Scholar] [CrossRef] [Scilit]
- Adler, B.; Lo, M.; Seemann, T.; Murray, G.L. Pathogenesis of leptospirosis: The influence of genomics. Veter.-Microbiol. 2011, 153, 73–81. [Google Scholar] [CrossRef] [Scilit]
- Murray, G.L.; Lo, M.; Bulach, D.M.; Srikram, A.; Seemann, T.; Quinsey, N.S.; Sermswan, R.W.; Allen, A.; Adler, B. Evaluation of 238 antigens of Leptospira borgpetersenii serovar Hardjo for protection against kidney colonisation. Vaccine 2013, 31, 495–499. [Google Scholar] [CrossRef] [Scilit]
- Awanye, A.M.; Chang, C.-M.; Wheeler, J.X.; Chan, H.; Marsay, L.; Dold, C.; Rollier, C.S.; Bird, L.E.; Nettleship, J.E.; Owens, R.J.; et al. Immunogenicity profiling of protein antigens from capsular group B Neisseria meningitidis. Sci. Rep. 2019, 9, 6843. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gubellini, F.; Verdon, G.; Karpowich, N.K.; Luff, J.D.; Boël, G.; Gauthier, N.; Handelman, S.K.; Ades, S.E.; Hunt, J.F. Physiological Response to Membrane Protein Overexpression in E. coli. Mol. Cell. Proteom. 2011, 10, M111.007930. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rath, A.; Glibowicka, M.; Nadeau, V.G.; Chen, G.; Deber, C.M. Detergent Binding Explains Anomalous SDS-PAGE Migration of Membrane Proteins. Proc. Natl. Acad. Sci. USA 2009, 106, 1760–1765. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murray, G.L. The Molecular Basis of Leptospiral Pathogenesis. In Leptospira and Leptospirosis; Adler, B., Ed.; Springer: Berlin/Heidelberg, Germany, 2015; pp. 139–185. [Google Scholar] [CrossRef] [Scilit]
- Dall’Antonia, M.; Sluga, G.; Whitfield, S.; Teall, A.; Wilson, P.; Krahe, D. Leptospirosis pulmonary haemorrhage: A diagnostic challenge. Emerg. Med. J. 2008, 25, 51–52. [Google Scholar] [CrossRef] [Scilit]
- Vieira, M.L.; Fernandes, L.G.; Domingos, R.F.; Oliveira, R.; Siqueira, G.H.; Souza, N.M.; Teixeira, A.R.; Atzingen, M.V.; Nascimento, A.L. Leptospiral extracellular matrix adhesins as mediators of pathogen-host interactions. FEMS Microbiol. Lett. 2014, 352, 129–139. [Google Scholar] [CrossRef] [Scilit]
- Ghosh, S.; O’Connor, T.J. Beyond Paralogs: The Multiple Layers of Redundancy in Bacterial Pathogenesis. Front. Cell. Infect. Microbiol. 2017, 7, 467. [Google Scholar] [CrossRef] [Scilit]
- Picardeau, M.; Bulach, D.M.; Bouchier, C.; Zuerner, R.L.; Zidane, N.; Wilson, P.J.; Creno, S.; Kuczek, E.S.; Bommezzadri, S.; Davis, J.C.; et al. Genome sequence of the saprophyte Leptospira biflexa provides insights into the evolution of Leptospira and the pathogenesis of leptospirosis. PLoS ONE 2008, 3, e1607. [Google Scholar] [CrossRef] [Scilit]
- Hurley, W.L.; Theil, P.K. Perspectives on immunoglobulins in colostrum and milk. Nutrients 2011, 3, 442–474. [Google Scholar] [CrossRef] [Scilit]
- King, A.M.; Bartpho, T.; Sermswan, R.W.; Bulach, D.M.; Eshghi, A.; Picardeau, M.; Adler, B.; Murray, G.L. Leptospiral Outer Membrane Protein LipL41 Is Not Essential for Acute Leptospirosis but Requires a Small Chaperone Protein, Lep, for Stable Expression. Infect. Immun. 2013, 81, 2768–2776. [Google Scholar] [CrossRef] [Scilit]
- Dong, H.; Hu, Y.; Xue, F.; Sun, D.; Ojcius, D.M.; Mao, Y.; Yan, J. Characterization of the ompL1 gene of pathogenic Leptospira species in China and cross-immunogenicity of the OmpL1 protein. BMC Microbiol. 2008, 8, 223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dezhbord, M.; Esmaelizad, M.; Khaki, P.; Fotohi, F.; Moghaddam, A.Z. Molecular identification of the ompL1 gene within Leptospira interrogans standard serovars. J. Infect. Dev. Ctries. 2014, 8, 688–693. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Oliveira, D.; Figueira, C.P.; Zhan, L.; Pertile, A.C.; Pedra, G.G.; Gusmão, I.M.; Wunder, E.A.; Rodrigues, G.; Ramos, E.A.G.; Ko, A.I.; et al. Leptospira in breast tissue and milk of urban Norway rats (Rattus norvegicus). Epidemiology Infect. 2016, 144, 2420–2429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maneewatch, S.; Tapchaisri, P.; Sakolvaree, Y.; Klaysing, B.; Tongtawe, P.; Chaisri, U.; Songserm, T.; Wongratnacheewin, S.; Srimanote, P.; Chongsa-Nguanz, M.; et al. OmpL1 DNA vaccine cross-protects against heterologous Leptospira spp. challenge. Asian Pac. J. Allergy Immunol. 2007, 25, 75–82. [Google Scholar] [PubMed]
- Slack, A.T.; Symonds, M.L.; Dohnt, M.F.; Smythe, L.D. The epidemiology of leptospirosis and the emergence of Leptospira borgpetersenii serovar Arborea in Queensland, Australia, 1998–2004. Epidemiology Infect. 2006, 134, 1217–1225. [Google Scholar] [CrossRef] [Scilit]
- Kallel, H.; Bourhy, P.; Mayence, C.; Houcke, S.; Hommel, D.; Picardeau, M.; Caro, V.; Matheus, S. First report of human Leptospira santarosai infection in French Guiana. J. Infect. Public Health 2020, 13, 1181–1183. [Google Scholar] [CrossRef] [Scilit]
- De Faria, M.T.; Calderwood, M.S.; Athanazio, D.A.; McBride, A.J.; Hartskeerl, R.A.; Pereira, M.M.; Ko, A.I.; Reis, M.G. Carriage of Leptospira interrogans among domestic rats from an urban setting highly endemic for leptospirosis in Brazil. Acta Trop. 2008, 108, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Zwijnenberg, R.; Smythe, L.; Symonds, M.; Dohnt, M.; Toribio, J.-A. Cross-sectional study of canine leptospirosis in animal shelter populations in mainland Australia. Aust. Veter. J. 2008, 86, 317–323. [Google Scholar] [CrossRef] [Scilit]
- Koizumi, N.; Muto, M.; Tanikawa, T.; Mizutani, H.; Sohmura, Y.; Hayashi, E.; Akao, N.; Hoshino, M.; Kawabata, H.; Watanabe, H. Human leptospirosis cases and the prevalence of rats harbouring Leptospira interrogans in urban areas of Tokyo, Japan. J. Med. Microbiol. 2009, 58, 1227–1230. [Google Scholar] [CrossRef] [Scilit]
- Feresu, S.B.; Steigerwalt, A.G.; Brenner, D.J. DNA relatedness of Leptospira strains isolated from beef cattle in Zimbabwe. Int. J. Syst. Evol. Microbiol. 1999, 49, 1111–1117. [Google Scholar] [CrossRef] [Scilit]
- Mgode, G.F.; Machang’u, R.S.; Mhamphi, G.G.; Katakweba, A.; Mulungu, L.S.; Durnez, L.; Leirs, H.; Hartskeerl, R.A.; Belmain, S.R. Leptospira serovars for diagnosis of leptospirosis in humans and animals in Africa: Common Leptospira isolates and reservoir hosts. PLoS Neglected Trop. Dis. 2015, 9, e0004251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Daud, A.; Fuzi, N.M.H.M.; Arshad, M.M.; Kamarudin, S.; Mohammad, W.M.Z.W.; Amran, F.; Ismail, N. Leptospirosis seropositivity and its serovars among cattle in Northeastern Malaysia. Veter. World 2018, 11, 840–844. [Google Scholar] [CrossRef] [Scilit] [PubMed]











| Gene | Primer’s Sequence (Forward/Reverse) b | Size (kb) |
|---|---|---|
| LBL1341 | F: 5′ caccCAACTTTGGACGCCGC 3′ R: 5′ TTAAAAACTTAAACCGCCCGA 3′ | 1.57 |
| LBL0972 | F: 5′ caccAACGATGGAAACGAAAATTCTTC 3′ R: 5′ TTACGGGTTACAAGGCGC 3′ | 1.03 |
| LBL1054 | F: 5′ caccGAACAAGTTGTAACCACGAAA 3′ R: 5′ TTAAAACTCTATTGTGGTTCTC 3′ | 1.39 |
| LBL2618 | F: 5′ caccGAAAGGATCAGTATCGATGC 3′ R: 5′ TCAGAGATCATCACTGACG 3′ | 1.35 |
| LBL2925 | F: 5′ caccGCTGAAAAAAAAGAGGAATCTGC R: 5′ TTATTGTTGTGGAGCGGAAG 3′ | 0.59 |
| LBL0375 | F: 5′ caccCAAGAAGATTTGGATGAAAATCC 3′ R: 5′ TTATTTCTTGGCTGGAGGAG 3′ | 1.02 |
| LBL2510 a (OmpL1) | F: 5′ caccAAATCATACGCAATTGTAGGA 3′ R: 5′ TTAGAGTTCGTATTTATAGCCA 3′ | 0.89 |
| LIC10973 a (OmpL1) | F: 5′ caccAAAACATATGCAATTGTAGGATTTG 3′ R: 5′ TTAGAGTTCGTGTTTATAACCG 3′ | 0.89 |
| Locus Tag | Molecular Weight | Signal Peptide | β-Barrel Prediction | SPAAN Adhesin Prediction d | ||||
|---|---|---|---|---|---|---|---|---|
| Size (kDa) | SPI/SPII | Cleavage Site | BOMP a | PRED-TMBB b (Yes/No) with Scores | MCMBB c | |||
| LBL1341 | 61 | SPI | IQA-QL | 1 | Yes | 2.94 | 0.015 | Yes |
| LBL0972 | 36 | SPII | FAG-CA | 0 | Yes | 2.88 | 0.024 | Yes |
| LBL1054 | 50 | SPI | THA-EQ | 0 | Yes | 2.95 | 0.025 | No |
| LBL2618 | 49 | SPII | SQA-ER | 0 | No | 3.02 | 0.008 | Yes |
| LBL2925 | 20 | SPII | SSA-EK | 0 | Yes | 2.94 | 0.00 | No |
| LBL0375 | 37 | SPI | LVA-QE | 0 | Yes | 2.92 | 0.016 | Yes |
| LBL2510 e (OmpL1) | 31 | SP1 | LSA-KS | 0 | Yes | 2.91 | 0.024 | Yes |
| LIC10973 e (OmpL1) | 31 | SPI | LSA-KT | 1 | Yes | 2.90 | 0.024 | Yes |
| Recombinant Protein | Host Ligand Molecules [Mean Kd (μM) ± SEM] | ||||||
|---|---|---|---|---|---|---|---|
| Fibronectin | Laminin | Heparin Sulphate | Chondroitin | Fibrinogen | Collagen | Elastin | |
| rLBL2618 | 0.10 ± 0.02 | 0.14 ± 0.01 | ND | ND | 0.05 ± 0.01 | ND | ND |
| rLBL0972 | 0.44 ± 0.21 | ND | ND | ND | 0.20 ± 0.06 | ND | ND |
| rLBL0375 | ND | ND | ND | ND | NS | ND | ND |
| rLIC10973 (LIC OmpL1) | 0.81 ± 1.30 | 1.46 ± 5.44 | ND | NS | 0.92 ± 1.38 | ND | ND |
| Recombinant OMP/r Values | rLBL2510 (OmpL1) a | rLBL2618 | rLBL0972 | rLBL0375 | rLIC10973 (OmpL1) b |
|---|---|---|---|---|---|
| rLBL2510 (OmpL1) a | r = 0.01 NS | r = 0.01 NS | r = 0.02 NS | r = 0.41 (p < 0.0001) | |
| rLBL2618 | r = 0.80 (p < 0.0001) | r = 0.35 (p < 0.001) | r = 0.004 NS | ||
| rLBL0972 | r = 0.50 (p < 0.0001) | r = 0.02 NS | |||
| rLBL0375 | r = 0.04 NS | ||||
| rLIC10973 (OmpL1) b |
| Leptospira Species | Binding to Host Molecules (Kd) (Micromolar) | |||||||
|---|---|---|---|---|---|---|---|---|
| Annotation | Fibronectin | Laminin | Heparan Sulphate | Chondroitin | Fibrinogen | Collagen | Elastin a | |
| L. borgpetersenii svr Hardjo L550 | OmpL1 | 2.50 ± 1.77 | ND | ND | ND | 0.45 ± 0.11 | ND | 0.82 ± 0.35 |
| L. interrogans svr Pyrogenes | OmpL1 | ND | ND | ND | ND | 0.86 ± 0.22 | ND | ND |
| L. noguchii | OmpL1 | ND | ND | ND | ND | 0.78 ± 0.17 | ND | ND |
| L. santarosai | OmpL1 | 1.37 ± 1.47 | NS | ND | NS | 0.30 ± 0.07 | ND | 1.72 ± 1.00 |
| L. alstonii | OmpL1 | 0.13 ± 0.08 | 0.54 ± 0.37 | ND | ND | 0.21 ± 0.12 | ND | ND |
| L. interrogans svr Copenhageni L1-130 | OmpL1 | 1.27 ± 1.76 | 6.05 ± 18.5 | ND | NS | 1.54 ± 2.02 | ND | ND |
| L. borgpetersenii svr Hardjo L550 | rLBL2618 | 0.08 ± 0.01 | 0.15 ± 0.02 | ND | ND | 0.05 ± 0.01 | ND | ND |
| L. kirschneri | rLBL2618 | ND | ND | ND | ND | 0.01 ± 0.00 | ND | ND |
| L. noguchii | rLBL2618 | ND | ND | ND | ND | 0.04 ± 0.02 | ND | ND |
| L. alstonii | rLBL2618 | 0.06 ± 0.03 | 0.05 ± 0.02 | ND | ND | 0.02 ± 0.01 | ND | ND |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kamaruzaman, I.N.A.; Staton, G.J.; Ainsworth, S.; Carter, S.D.; Evans, N.J. Characterisation of Putative Outer Membrane Proteins from Leptospira borgpetersenii Serovar Hardjo-Bovis Identifies Novel Adhesins and Diversity in Adhesion across Genomospecies Orthologs. Microorganisms 2024, 12, 245. https://doi.org/10.3390/microorganisms12020245
Kamaruzaman INA, Staton GJ, Ainsworth S, Carter SD, Evans NJ. Characterisation of Putative Outer Membrane Proteins from Leptospira borgpetersenii Serovar Hardjo-Bovis Identifies Novel Adhesins and Diversity in Adhesion across Genomospecies Orthologs. Microorganisms. 2024; 12(2):245. https://doi.org/10.3390/microorganisms12020245
Chicago/Turabian StyleKamaruzaman, Intan Noor Aina, Gareth James Staton, Stuart Ainsworth, Stuart D. Carter, and Nicholas James Evans. 2024. "Characterisation of Putative Outer Membrane Proteins from Leptospira borgpetersenii Serovar Hardjo-Bovis Identifies Novel Adhesins and Diversity in Adhesion across Genomospecies Orthologs" Microorganisms 12, no. 2: 245. https://doi.org/10.3390/microorganisms12020245
APA StyleKamaruzaman, I. N. A., Staton, G. J., Ainsworth, S., Carter, S. D., & Evans, N. J. (2024). Characterisation of Putative Outer Membrane Proteins from Leptospira borgpetersenii Serovar Hardjo-Bovis Identifies Novel Adhesins and Diversity in Adhesion across Genomospecies Orthologs. Microorganisms, 12(2), 245. https://doi.org/10.3390/microorganisms12020245

