The Knob Domain of the Fiber-1 Protein Affects the Replication of Fowl Adenovirus Serotype 4
Abstract
1. Introduction
2. Materials and Methods
2.1. Virus and Cells
2.2. Identification of Fiber-1 Protein Domains and Their Functionality via Prediction Software
2.3. Cloning Genes and Construction Plasmids
2.4. Transfection and Verification by Western Blotting
2.5. Immunofluorescence Assay
2.6. Measurement of FAdV-4 Growth in LMH Cells
2.7. Transcriptome Sequencing Analysis
2.8. Functional Analysis of DEGs
2.9. RNA Extraction and qPCR
2.10. Data Processing and Statistical Analysis
3. Results
3.1. Identification of Fiber-1 Protein Domains and Cloning of the Genes
3.2. Expression of Fiber-1-Δ1 and Fiber-1-Δ2 in LMH Cells
3.3. High-Level Expression of Fiber-1-Δ1 and Fiber-1-Δ2 Inhibits FAdV-4 Replication
3.4. Identification and Clustering of DEGs
3.5. GO Enrichment and KEGG Enrichment Analyses
3.6. Activation of Several Immune-Related Pathways After FAdV-4 Infection
3.7. Effects on Type I Interferons and Cytokines
4. Discussion
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Hess, M. Detection and differentiation of avian adenoviruses: A review. Avian Pathol. 2000, 29, 195–206. [Google Scholar] [CrossRef] [PubMed]
- Steer, P.A.; Kirkpatrick, N.C.; O’Rourke, D.; Noormohammadi, A.H. Classification of Fowl Adenovirus Serotypes by Use of High-Resolution Melting-Curve Analysis of the Hexon Gene Region. J. Clin. Microbiol. 2009, 47, 311–321. [Google Scholar] [CrossRef] [PubMed]
- Benko, M.; Aoki, K.; Arnberg, N.; Davison, A.J.; Echavarria, M.; Hess, M.; Jones, M.S.; Kajan, G.L.; Kajon, A.E.; Mittal, S.K.; et al. ICTV Virus Taxonomy Profile: Adenoviridae 2022. J. Gen. Virol. 2022, 103, 001721. [Google Scholar] [CrossRef]
- Schachner, A.; Matos, M.; Grafl, B.; Hess, M. Fowl adenovirus-induced diseases and strategies for their control—A review on the current global situation. Avian Pathol. 2018, 47, 111–126. [Google Scholar] [CrossRef] [PubMed]
- Haiyilati, A.; Zhou, L.; Li, J.; Li, W.; Gao, L.; Cao, H.; Wang, Y.; Li, X.; Zheng, S.J. Gga-miR-30c-5p Enhances Apoptosis in Fowl Adenovirus Serotype 4-Infected Leghorn Male Hepatocellular Cells and Facilitates Viral Replication through Myeloid Cell Leukemia-1. Viruses 2022, 14, 990. [Google Scholar] [CrossRef] [PubMed]
- Ye, J.; Liang, G.; Zhang, J.; Wang, W.; Song, N.; Wang, P.; Zheng, W.; Xie, Q.; Shao, H.; Wan, Z.; et al. Outbreaks of serotype 4 fowl adenovirus with novel genotype, China. Emerg. Microbes Infect. 2016, 5, 1–12. [Google Scholar] [CrossRef]
- Liu, Y.; Wan, W.; Gao, D.; Li, Y.; Yang, X.; Liu, H.; Yao, H.; Chen, L.; Wang, C.; Zhao, J. Genetic characterization of novel fowl aviadenovirus 4 isolates from outbreaks of hepatitis-hydropericardium syndrome in broiler chickens in China. Emerg. Microbes Infect. 2016, 5, 1–8. [Google Scholar] [CrossRef]
- Russell, W.C. Adenoviruses: Update on structure and function. J. Gen. Virol. 2009, 90, 1–20. [Google Scholar] [CrossRef]
- Liu, J.; Mei, N.; Wang, Y.; Shi, X.; Chen, H. Identification of a novel immunological epitope on Hexon of fowl adenovirus serotype 4. AMB Express 2021, 11, 153. [Google Scholar] [CrossRef]
- Wang, X.; Tang, Q.; Chu, Z.; Wang, P.; Luo, C.; Zhang, Y.; Fang, X.; Qiu, L.; Dang, R.; Yang, Z. Immune protection efficacy of FAdV-4 surface proteins fiber-1, fiber-2, hexon and penton base. Virus Res. 2018, 245, 1–6. [Google Scholar] [CrossRef]
- Pan, Q.; Wang, J.; Gao, Y.; Wang, Q.; Cui, H.; Liu, C.; Qi, X.; Zhang, Y.; Wang, Y.; Li, K.; et al. Identification of chicken CAR homology as a cellular receptor for the emerging highly pathogenic fowl adenovirus 4 via unique binding mechanism. Emerg. Microbes Infect. 2020, 9, 586–596. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Liu, Q.; Li, T.; Geng, T.; Chen, H.; Xie, Q.; Shao, H.; Wan, Z.; Qin, A.; Ye, J. Fiber-1, Not Fiber-2, Directly Mediates the Infection of the Pathogenic Serotype 4 Fowl Adenovirus via Its Shaft and Knob Domains. J. Virol. 2020, 94, 10–1128. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Liu, R.; Tian, K.; Wang, Z.; Yang, X.; Gao, D.; Zhang, Y.; Fu, J.; Wang, H.; Zhao, J. Fiber2 and hexon genes are closely associated with the virulence of the emerging and highly pathogenic fowl adenovirus 4. Emerg. Microbes Infect. 2018, 7, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Zhang, Y.; Guo, H.; Li, N.; Wang, B.; Tian, K.; Wang, Z.; Yang, X.; Li, Y.; Wang, H.; et al. The increased virulence of hypervirulent fowl adenovirus 4 is independent of fiber-1 and penton. Res. Vet. Sci. 2020, 131, 31–37. [Google Scholar] [CrossRef] [PubMed]
- Xie, Q.; Wang, W.; Li, L.; Kan, Q.; Fu, H.; Geng, T.; Li, T.; Wan, Z.; Gao, W.; Shao, H.; et al. Domain in Fiber-2 interacted with KPNA3/4 significantly affects the replication and pathogenicity of the highly pathogenic FAdV-4. Virulence 2021, 12, 754–765. [Google Scholar] [CrossRef]
- Zou, X.; Rong, Y.; Guo, X.; Hou, W.; Yan, B.; Hung, T.; Lu, Z. Fiber1, but not fiber2, is the essential fiber gene for fowl adenovirus 4 (FAdV-4). J. Gen. Virol. 2021, 102, 001559. [Google Scholar] [CrossRef]
- Yamamoto, M.; Takeda, K. Current views of toll-like receptor signaling pathways. Gastroenterol. Res. Pract. 2010, 2010, 240365. [Google Scholar] [CrossRef]
- Zhang, T.; Ren, M.; Liu, C.; Xu, L.; Wang, F.; Han, Z.; Shao, Y.; Ma, D. Comparative analysis of early immune responses induced by two strains of Newcastle disease virus in chickens. Microbiologyopen 2019, 8, e701. [Google Scholar] [CrossRef]
- Yongli, S. Study on the Effect of Fowl Adenovirus Type 4 and Its Main Encoding Proteins on the mRNA Transcription Levels of Toll-Like Receptors. Master’s Thesis, Guangxi University, Nanning, China.
- Wang, P.; Zhang, J.; Wang, W.; Li, T.; Liang, G.; Shao, H.; Gao, W.; Qin, A.; Ye, J. A novel monoclonal antibody efficiently blocks the infection of serotype 4 fowl adenovirus by targeting fiber-2. Vet. Res. 2018, 49, 29. [Google Scholar] [CrossRef]
- Henry, L.J.; Xia, D.; Wilke, M.E.; Deisenhofer, J.; Gerard, R.D. Characterization of the knob domain of the adenovirus type 5 fiber protein expressed in Escherichia coli. J. Virol. 1994, 68, 5239–5246. [Google Scholar] [CrossRef]
- Ruan, S.; Zhao, J.; Yin, X.; He, Z.; Zhang, G. A subunit vaccine based on fiber-2 protein provides full protection against fowl adenovirus serotype 4 and induces quicker and stronger immune responses than an inactivated oil-emulsion vaccine. Infect. Genet. Evol. 2018, 61, 145–150. [Google Scholar] [CrossRef] [PubMed]
- Schachner, A.; Marek, A.; Jaskulska, B.; Bilic, I.; Hess, M. Recombinant FAdV-4 fiber-2 protein protects chickens against hepatitis—hydropericardium syndrome (HHS). Vaccine 2014, 32, 1086–1092. [Google Scholar] [CrossRef] [PubMed]
- De Luca, C.; Schachner, A.; Heidl, S.; Hess, M. Vaccination with a fowl adenovirus chimeric fiber protein (crecFib-4/11) simultaneously protects chickens against hepatitis-hydropericardium syndrome (HHS) and inclusion body hepatitis (IBH). Vaccine 2022, 40, 1837–1845. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, S.; Yamamoto, Y.; Kurokawa, A.; Iseki, H.; Tanikawa, T.; Mase, M. Recombinant fiber-1 protein of fowl adenovirus serotype 4 induces high levels of neutralizing antibodies in immunized chickens. Arch. Virol. 2023, 168, 84. [Google Scholar] [CrossRef]
- Pallister, J.T.U.C.; Wright, P.J.; Sheppard, M. A single gene encoding the fiber is responsible for variations in virulence in the fowl adenoviruses. J. Virol. 1996, 70, 5115–5122. [Google Scholar] [CrossRef]
- Hess, M.; Cuzange, A.; Ruigrok, R.W.; Chroboczek, J.; Jacrot, B. The avian adenovirus penton: Two fibres and one base. J. Mol. Biol. 1995, 252, 379–385. [Google Scholar] [CrossRef]
- Wu, E.; Pache, L.; Von Seggern, D.J.; Mullen, T.M.; Mikyas, Y.; Stewart, P.L.; Nemerow, G.R. Flexibility of the adenovirus fiber is required for efficient receptor interaction. J. Virol. 2003, 77, 7225–7235. [Google Scholar] [CrossRef]
- Guardado-Calvo, P.; Llamas-Saiz, A.L.; Fox, G.C.; Langlois, P.; van Raaij, M.J. Structure of the C-terminal head domain of the fowl adenovirus type 1 long fiber. J. Gen. Virol. 2007, 88, 2407–2416. [Google Scholar] [CrossRef]
- Kawaguchi, T.; Nomura, K.; Hirayama, Y.; Kitagawa, T. Establishment and characterization of a chicken hepatocellular carcinoma cell line, LMH. Cancer Res. 1987, 47, 4460–4464. [Google Scholar]
- Zhang, J.; Zou, Z.; Huang, K.; Lin, X.; Chen, H.; Jin, M. Insights into leghorn male hepatocellular cells response to fowl adenovirus serotype 4 infection by transcriptome analysis. Vet. Microbiol. 2018, 214, 65–74. [Google Scholar] [CrossRef]
- Ren, G.; Wang, H.; Huang, M.; Yan, Y.; Liu, F.; Chen, R. Transcriptome analysis of fowl adenovirus serotype 4 infection in chickens. Virus Genes 2019, 55, 619–629. [Google Scholar] [CrossRef]
- Achek, A.; Yesudhas, D.; Choi, S. Toll-like receptors: Promising therapeutic targets for inflammatory diseases. Arch. Pharm. Res. 2016, 39, 1032–1049. [Google Scholar] [CrossRef] [PubMed]
- Temperley, N.D.; Berlin, S.; Paton, I.R.; Griffin, D.K.; Burt, D.W. Evolution of the chicken Toll-like receptor gene family: A story of gene gain and gene loss. BMC Genom. 2008, 9, 62. [Google Scholar] [CrossRef] [PubMed]
- Brownlie, R.; Allan, B. Avian toll-like receptors. Cell Tissue Res. 2011, 343, 121–130. [Google Scholar] [CrossRef] [PubMed]
- Boyd, A.; Philbin, V.J.; Smith, A.L. Conserved and distinct aspects of the avian Toll-like receptor (TLR) system: Implications for transmission and control of bird-borne zoonoses. Biochem. Soc. Trans. 2007, 35, 1504–1507. [Google Scholar] [CrossRef]
- Smith, J.; Speed, D.; Law, A.S.; Glass, E.J.; Burt, D.W. In-silico identification of chicken immune-related genes. Immunogenetics 2004, 56, 122–133. [Google Scholar] [CrossRef]
- Iqbal, M.; Philbin, V.J.; Smith, A.L. Expression patterns of chicken Toll-like receptor mRNA in tissues, immune cell subsets and cell lines. Vet. Immunol. Immunopathol. 2005, 104, 117–127. [Google Scholar] [CrossRef]
- Keestra, A.M.; de Zoete, M.R.; Bouwman, L.I.; Vaezirad, M.M.; van Putten, J.P. Unique features of chicken Toll-like receptors. Dev. Comp. Immunol. 2013, 41, 316–323. [Google Scholar] [CrossRef]
- Neerukonda, S.N.; Katneni, U. Avian Pattern Recognition Receptor Sensing and Signaling. Vet. Sci. 2020, 7, 14. [Google Scholar] [CrossRef]
- Li, R.; Li, G.; Lin, J.; Han, S.; Hou, X.; Weng, H.; Guo, M.; Lu, Z.; Li, N.; Shang, Y.; et al. Fowl Adenovirus Serotype 4 SD0828 Infections Causes High Mortality Rate and Cytokine Levels in Specific Pathogen-Free Chickens Compared to Ducks. Front. Immunol. 2018, 9, 49. [Google Scholar] [CrossRef]
- Zhao, W.; Li, X.; Li, H.; Han, Z.; Wang, F.; Liu, C.; Shao, Y.; Ma, D. Fowl adenoviruse-4 infection induces strong innate immune responses in chicken. Comp. Immunol. Microbiol. Infect. Dis. 2020, 68, 101404. [Google Scholar] [CrossRef] [PubMed]
- Niu, Y.; Sun, Q.; Zhang, G.; Liu, X.; Shang, Y.; Xiao, Y.; Liu, S. Fowl adenovirus serotype 4-induced apoptosis, autophagy, and a severe inflammatory response in liver. Vet. Microbiol. 2018, 223, 34–41. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Sequence (5′-3′) | Amplified Sequence Length |
---|---|---|
Fiber-1-Δ1-U | CCGGAATTCGGATGGGTGGCGGAGGAGGAGGT | 399 bp |
Fiber-1-Δ1-D | CCCGGTACCTCAGGGTCCCACGGAGCTG | |
Fiber-1-Δ2-U | CCGGAATTCGGTCAGGGTCCCACGGAGCTG | 606 bp |
Fiber-1-Δ2-D | CCCGGTACCTCAGATTGGGCCCGTGGTCA |
Primer Name | Sequence (5′-3′) | Login Number |
---|---|---|
TLR3-U | ACAATGGCAGATTGTAGTCACCT | NM_001011691.3 |
TLR3-D | GCACAATCCTGGTTTCAGTTTAG | |
TLR7-U | TCTGGACTTCTCTAACAACA | NM_001011688 |
TLR7-D | AATCTCATTCTCATTCATCATCA | |
IFN-α-U | ATGCCACCTTCTCTCACGAC | AB021154.1 |
IFN-α-D | AGGCGCTGTAATCGTTGTCT | |
INF-β-U | CCTCAACCAGATCCAGCATT | KF741874.1 |
INF-β-D | GGATGAGGCTGTGAGAGGAG | |
IL-1β-U | GTTAATGATGAAGATGTTGATAGC | NM_204305.1 |
IL-1β-D | GTTCCAGACACAGCAATC | |
IL-6-U | TGGTGATAAATCCCGATGAAG | NM_204628.2 |
IL-6-D | GGCACTGAAACTCCTGGTCT | |
IL-8-U | CCATCTTCCACCTTTCACA | HM179639.1 |
IL-8-D | ATCCCACAGCACTGACCAT | |
TRIF-U | AGCCTGATGGAGAGAGACAGAG | NM_001081506.1 |
TRIF-D | GATAGACGAGAGGAACTGACCTG | |
IRF7-U | ACACTCCCACAGACAGTACTGA | NM_205372.1 |
IRF7-D | TGTGTGTGCCCACAGGGTTG | |
Hexon-U | ACGATCAGACCTTCGTGGAC | KY379035.1 |
Hexon-D | GGTGTGCGAGAGGTAGAAGC | |
GADPH-U | GCACTGTCAAGGCTGAGAACG | KC294567 |
GADPH-D | GATGATAACACGCTTAGCACCAC |
Antigen | Position | Antigenic Peptide | Score |
---|---|---|---|
fiber-1-Δ1 | 85–104 | LDSVTGVLKVLVDSQGPLQA | 1.208 |
116–130 | QDFVVNNGVLALASSPSSCLQD | 1.148 | |
32–46 | PIYVSDRAVSLLIDD | 1.141 | |
57–66 | ALMVKTAAPL | 1.095 | |
9–15 | QIAVDPD | 1.080 | |
17–27 | PLELTGDLLTLE | 1.044 | |
fiber-1-Δ2 | 82–95 | EVNLSLIVPPTVSP | 1.172 |
4–12 | YEVTPVLGI | 1.145 | |
29–55 | IGYYIYMVSSAGLVNGLITLELAHDLT | 1.140 | |
171–182 | DAIAFTVSLPQT | 1.123 | |
110–119 | DVGYLGLPPH | 1.122 | |
98–106 | QNHVFVPNSF | 1.117 | |
68–78 | NFTFVLSPMYP | 1.144 | |
153–159 | LGYCAAT | 1.111 | |
124–139 | WYVPIDSPGLRLVSFM | 1.105 | |
193–199 | PDTVVTT | 1.1096 |
Pathway ID | KRGG Pathway | Downregulated Genes | Upregulated Genes |
---|---|---|---|
ko04151 | PI3K–Akt signaling pathway | ITGA8, ITGA7, EPHA2, COL9A2, ITGB3, ITGB4, ITGB6, TNR, GNG2, CSF3R, PIK3R3, PDGFB, OSMR, FN1, CDKN1A, GNG10, TNC, LAMC2, PIK3AP1, THBS1, PPP2R2B | GYS2, PPP2R2C |
ko04010 | MAPK signaling pathway | NFKB2, FOS, MRAS, JUND, FLNC, MAP3K12, JUN, PDGFB, PTPN5, FLNB, LOC107055388, HSPA2, TGFB1, TGFB2, DUSP10, PRKCB, HSPA8, DUSP8, DUSP4 | CD36, GYS2, PPP2R2C |
ko04060 | Cytokine–cytokine receptor interaction | BMP7, TNFRSF21, CSF3R, PDGFB, OSMR, IL8L2, TNFRSF8, TGFB1, TGFB2, TNFSF15, CCL4, CXCL14, LOC10705392 | |
ko04024 | cAMP signaling pathway | FOS, JUN, PIK3R3, PTGER2, SOX9, HCN2, ATP2B4 | NPY, GABBRR2, CAMK4 |
ko04350 | TGF-beta signaling pathway | NBL1, BMP7, SMAD6, TGFB1, TGFB2, CDKN2B, ID4, ID1, GDF6, THBS | |
ko04630 | Jak–STAT signaling pathway | CISH, CSF3R, PIK3R3, OSMR, CDKN1A, SOCS3, SOCS2, PIM1, STAT3 | |
ko04668 | TNF signaling pathway | FOS, CEBPB, EDN1, JUN, PIK3R3, MLKL, PTGS2, SOCS3 | |
ko04620 | Toll-like receptor signaling pathway | FOS, JUN, PIK3R3, IL8L2, CCL4 | |
ko04310 | Wnt signaling pathway | CTBP2, JUN, WNT5A, APC2, PRKCB | |
ko04621 | NOD-like receptor signaling pathway | RIPK3, IL8L2 | |
ko046222 | RIG-I-like receptor signaling pathway | IL8L2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Xie, Z.; Wei, Y.; Xie, Z.; Wu, A.; Luo, S.; Xie, L.; Li, M.; Zhang, Y. The Knob Domain of the Fiber-1 Protein Affects the Replication of Fowl Adenovirus Serotype 4. Microorganisms 2024, 12, 2265. https://doi.org/10.3390/microorganisms12112265
Li X, Xie Z, Wei Y, Xie Z, Wu A, Luo S, Xie L, Li M, Zhang Y. The Knob Domain of the Fiber-1 Protein Affects the Replication of Fowl Adenovirus Serotype 4. Microorganisms. 2024; 12(11):2265. https://doi.org/10.3390/microorganisms12112265
Chicago/Turabian StyleLi, Xiaofeng, Zhixun Xie, You Wei, Zhiqin Xie, Aiqiong Wu, Sisi Luo, Liji Xie, Meng Li, and Yanfang Zhang. 2024. "The Knob Domain of the Fiber-1 Protein Affects the Replication of Fowl Adenovirus Serotype 4" Microorganisms 12, no. 11: 2265. https://doi.org/10.3390/microorganisms12112265
APA StyleLi, X., Xie, Z., Wei, Y., Xie, Z., Wu, A., Luo, S., Xie, L., Li, M., & Zhang, Y. (2024). The Knob Domain of the Fiber-1 Protein Affects the Replication of Fowl Adenovirus Serotype 4. Microorganisms, 12(11), 2265. https://doi.org/10.3390/microorganisms12112265