Pectobacterium carotovorum Subsp. brasiliense Causing Soft Rot in Eggplant in Xinjiang, China
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and Strain Isolation
2.2. Biochemical Characterization
2.3. 16S rRNA Gene Sequence Analysis
2.4. Multilocus Sequence Analysis
2.5. Pathogenicity and Host Range Test
3. Results
3.1. Symptoms of Infected Eggplant Plants and Bacterial Isolation
3.2. Pathogenicity Assay
3.3. 16S rRNA Gene Analysis
3.4. Multilocus Sequence Analysis
3.5. Results of Physiological and Biochemical Analyses
3.6. Host Range Test
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tank, J.; Dhamangaonkar, B.; Ukale, D.U.; Cukkemane, N.; Cukkemane, A.A. Biochemical and microbiological analysis of different organic manures: Their effect on germination of Coriandrum sativum (Cilantro) and Solanum melongena (Eggplant). J. Bioprocess. Biotech. 2017, 7, 295. [Google Scholar] [CrossRef]
- Rao, G.P.; Kumar, M. World status of phytoplasma diseases associated with eggplant. Crop. Prot. 2017, 96, 22–29. [Google Scholar] [CrossRef]
- Ibanga, U.P.; Otobong, U.F.; Anthony, E.O.; Efflong, U.E.; Udo, N.N. Effect of application of palm bunch ash on the growth and yield of eggplant (Solanum melongena L.) in a pineapple orchard. Am. J. Life Sci. 2023, 11, 56–60. [Google Scholar]
- Ates, A.Ç. Investigation of resistance to Verticillium wilt disease (Verticillium dahliae Kleb.) in eggplant genotypes. Plant Prot. Bull. 2020, 60, 5–11. [Google Scholar]
- Mansfield, J.; Genin, S.; Magori, S.; Citovsky, V.; Sriariyanum, M.; Ronald, P.; Dow, M.; Verdier, V.; Beer, S.V.; Machado, M.A. Top 10 plant pathogenic bacteria in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 614–629. [Google Scholar] [CrossRef]
- Peng, J.C.; Wang, P.; Fang, H.R.; Zheng, J.M.; Zhong, C.; Yang, Y.J.; Yu, W.J. Weighted gene co-expression analysis network-based analysis on the candidate pathways and hub genes in eggplant bacterial wilt-resistance: A plant research study. Int. J. Mol. Sci. 2021, 22, 13279. [Google Scholar] [CrossRef]
- Charkowski, A.O. The changing face of bacterial soft-rot diseases. Annu. Rev. Phytopathol. 2018, 56, 269–288. [Google Scholar] [CrossRef]
- Ozturk, M.; Aksoy, H.M.; Potrykus, M.; Lojkowska, E. Genotypic and phenotypic variability of Pectobacterium strains causing blackleg and soft rot on potato in Turkey. Eur. J. Plant Pathol. 2018, 152, 143–155. [Google Scholar] [CrossRef]
- Rivedal, H.M.; Brazil, J.A.; Frost, K.E. Diversity and pathogenicity of Pectobacterium species responsible for causing soft rot and blackleg of potato in the Columbia Basin. Am. J. Potato Res. 2021, 98, 267–284. [Google Scholar] [CrossRef]
- Wang, X.F.; Wei, Z.; Yang, K.M.; Wang, J.N.; Jousset, A.; Xu, Y.C.; Shen, Q.R.; Friman, V. Phage combination therapies for bacterial wilt disease in tomato. Nat. Biotechnol. 2019, 37, 1513–1520. [Google Scholar] [CrossRef]
- Meng, X.L.; Chai, A.L.; Shi, Y.X.; Xie, X.W.; Ma, Z.H.; Li, B.J. Emergence of bacterial soft rot in cucumber caused by Pectobacterium carotovorum subsp. brasiliense in China. Plant Dis. 2017, 101, 279–287. [Google Scholar] [CrossRef]
- Marković, S.; Stanković, S.; Jelušić, A.; Iličić, R.; Kosovac, A.; Poštić, D.; Popović, T. Occurrence and identification of Pectobacterium carotovorum subsp. brasiliensis and Dickeya dianthicola causing blackleg in some potato fields in Serbia. Plant Dis. 2021, 105, 1080–1090. [Google Scholar] [CrossRef]
- Hugouvieux Cotte Pattat, N.; Condemine, G.; Shevchik, V.E. Bacterial pectate lyases, structural and functional diversity. Environ. Microbiol. Rep. 2014, 6, 427–440. [Google Scholar] [CrossRef]
- Waleron, M.; Waleron, K.; Lojkowska, E. First report of Pectobacterium carotovorum subsp. brasiliense causing soft rot on potato and other vegetables in Poland. Plant Dis. 2015, 99, 1271. [Google Scholar] [CrossRef]
- Hu, X.F.; Ying, F.X.; He, Y.B.; Gao, Y.Y.; Chen, H.M.; Chen, J.S. Characterization of Pectobacterium carotovorum subsp. carotovorum causing soft-rot disease on Pinellia ternata in China. Eur. J. Plant Pathol. 2008, 120, 305–310. [Google Scholar] [CrossRef]
- Moraes, A.J.G.; Souza, E.B.; Mariano, R.; Silva, A.M.F.; Lima, N.B.; Peixoto, A.R.; Gama, M.A.S. First report of Pectobacterium aroidearum and Pectobacterium carotovorum subsp. brasiliensis causing soft rot of Cucurbita pepo in Brazil. Plant Dis. 2017, 101, 379. [Google Scholar] [CrossRef]
- Werra, P.D.; Bussereau, F.; Keiser, A.; Ziegler, D. First report of potato blackleg caused by Pectobacterium carotovorum subsp. brasiliense in Switzerland. Plant Dis. 2009, 99, 551. [Google Scholar] [CrossRef]
- Choi, O.; Kim, J. Pectobacterium carotovorum subsp. brasiliense causing soft rot on paprika in Korea. J. Phytopathol. 2013, 161, 125–127. [Google Scholar] [CrossRef]
- Gillis, A.; Santana, M.A.; Rodriguez, M.; Romay, G. First report of bell pepper soft-rot caused by Pectobacterium carotovorum subsp. brasiliense in Venezuela. Plant Dis. 2017, 101, 1671. [Google Scholar] [CrossRef]
- Cariddi, C.; Bubici, G. First report of bacterial pith soft rot caused by Pectobacterium carotovorum subsp. brasiliense on artichoke in Italy. J. Plant Pathol. 2016, 98, 563–568. [Google Scholar]
- Young, J.M.; Saddler, G.S.; Takikawa, Y.; De Boer, S.H.; Vauterin, L.; Gardan, L.; Gvozdyak, R.I.; Stead, D. Names of plant pathogenic bacteria 1864–1995. Rev Plant Pathol. 1996, 75, 721–863. [Google Scholar]
- Gardan, L.; Gouy, C.; Christen, R.; Samson, R. Elevation of three subspecies of Pectobacterium carotovorum to species level: Pectobacterium atrosepticum sp. nov., Pectobacterium betavasculorum sp. nov. and Pectobacterium wasabiae sp. nov. Int. J. Syst. Evol. Microbiol. 2003, 53, 381–391. [Google Scholar] [CrossRef] [PubMed]
- De Boer, S.H.; Verdonck, L.; Vruggink, H.; Harju, P.; Bang, H.O.; De Ley, J. Serological and biochemical variation among potato strains of Erwinia carotovora subsp. atroseptica and their taxonomic relationship to other E. carotovora strains. J. Appl. Bacteriol. 1987, 63, 487–495. [Google Scholar] [CrossRef]
- Alcorn, S.M.; Orum, T.V.; Steigerwalt, A.G.; Foster, J.L.M.; Fogleman, J.C.; Brenner, D.J. Taxonomy and pathogenicity of Erwinia cacticida sp. nov. Int. J. Syst. Bacteriol. 1991, 41, 197–212. [Google Scholar] [CrossRef]
- Gallois, A.; Samson, R.; Ageron, E.; Grimont, P.A.D. Erwinia carotovora subsp. odorifera subsp. nov., associated with odorous soft rot of chicory (Cichorium intybus L.). Int. J. Syst. Bacteriol. 1992, 42, 582–588. [Google Scholar] [CrossRef]
- Nabhan, S.; Boer, S.H.D.; Maiss, E.; Wydra, K. Taxonomic relatedness between Pectobacterium carotovorum subsp. carotovorum, Pectobacterium carotovorum subsp. odoriferum and Pectobacterium carotovorum subsp. brasiliense subsp. nov. J. Appl. Microbiol. 2012, 113, 904–913. [Google Scholar] [CrossRef]
- Ma, B.; Hibbing, M.E.; Kim, H.; Reedy, R.M.; Yedidia, I.; Breuer, J.; Breuer, J.; Glasner, J.D.; Perna, N.T.; Kelman, A. Host range and molecular phylogenies of the soft rot enterobacterial genera Pectobacterium and Dickeya. Phytopathology 2007, 97, 1150–1163. [Google Scholar] [CrossRef]
- Nabhan, S.; Wydra, K.; Linde, M.; Debener, T. The use of two complementary DNA assays, AFLP and MLSA, for epidemic and phylogenetic studies of pectolytic enterobacterial strains with focus on the heterogeneous species Pectobacterium carotovorum. Plant Pathol. 2012, 61, 498–508. [Google Scholar] [CrossRef]
- Glasner, J.D.; Marquez-Villavicencio, M.; Kim, H.S.; Jahn, C.E.; Ma, B.; Biehl, B.S.; Rissman, A.I.; Mole, B. Niche-specificity and the variable fraction of the Pectobacterium pan-genome. Mol. Plant-Microbe. Interact. 2008, 21, 1549–1560. [Google Scholar] [CrossRef]
- Duarte, V.; De Boer, S.H.; Ward, L.D.; De Oliveira, A.M.R. Characterization of atypical Erwinia carotovora strains causing blackleg of potato in Brazil. J. Appl. Microbiol. 2004, 96, 535–545. [Google Scholar] [CrossRef]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Nei, M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [PubMed]
- Waleron, M.; Waleron, K.; Lojkowska, E. Genotypic characterisation of the Erwinia genus by PCR-RFLP analysis of rpoS gene. Plant Prot. Sci. 2002, 38, 288–290. [Google Scholar] [CrossRef]
- van der Merwe, J.J.; Coutinho, T.A.; Korsten, L.; van der Waals, J.E. Pectobacterium carotovorum subsp. brasiliensis causing blackleg on potatoes in South Africa. Eur. J. Plant Pathol. 2010, 126, 175–185. [Google Scholar] [CrossRef]
- Kwon, J.; Jee, H. Soft rot of eggplant (Solarium melongena) caused by Choanephora cucurbitarum in Korea. Mycobiology 2005, 33, 163–165. [Google Scholar] [CrossRef]
- Golkhandan, E.; Kamaruzaman, S.; Sariah, M.; Abidin, M.A.Z.; Nazerian, E.; Yassoralipour, A. First report of soft rot disease caused by Pectobacterium wasabiae on sweet potato, tomato, and eggplant in Malaysia. Plant Dis. 2013, 97, 685. [Google Scholar] [CrossRef]
- Vieira, J.; Câmara, M.; Bezerra, J.; Motta, C.; Machado, A.R. First report of Gilbertella persicaria causing soft rot in eggplant fruit in Brazil. Plant Dis. 2018, 102, 1172. [Google Scholar] [CrossRef]
- Garcia-Estrada, R.S.; Cruz-Lachica, I.; Osuna-García, L.A.; Márquez-Zequera, I. First report of eggplant fruit rot caused by Phytophthora nicotianae in Mexico. Plant Dis. 2021, 105, 513. [Google Scholar] [CrossRef]
- Khan, A.A.; Furuya, N.; Ura, H.; Matsuyama, N. Rapid identification of Erwinia chrysanthemi isolated from soft rotted eggplant and Phalaenopsis sp. by lipid and fatty acid profiling. J. Fae. Agr. Kyushu Univ. 2000, 44, 257–263. [Google Scholar] [CrossRef]
- Huang, Y.F.; Liu, C.Y.; Wang, H.; Guan, T.S.; Liu, L. Bacterial soft rot of eggplant caused by Pectobacterium carotovorum subsp. carotovorum in China. J. Plant Pathol. 2017, 99, 810. [Google Scholar]
- Queiroz, M.F.; Albuquerque, G.; Gama, M.A.S.; Mariano Rosa, L.R.; Moraes, A.J.G.; Souza, E.B.; Souza, J.B.; Da Paz, C.D.; Peixoto, A.R. First report of soft rot in kale caused by Pectobacterium carotovorum subsp. brasiliensis in Brazil. Plant Dis. 2017, 101, 2144. [Google Scholar] [CrossRef]
- Jaramillo, A.; Huertas, C.A.; Gómez, E.D. First report of bacterial stem rot of tomatoes caused by Pectobacterium carotovorum subsp. brasiliense in Colombia. Plant Dis. 2017, 101, 830. [Google Scholar] [CrossRef]
- Chandrashekar, B.S.; Prasanna Kumar, M.K.; Parivallal, P.B.; Pramesh, D.; Banakar, S.N.; Patil, S.S.; Mahesh, H.B. Host range and virulence diversity of Pectobacterium carotovorum subsp. brasiliense strain RDKLR infecting radish in India, and development of a LAMP-based diagnostics. J. Appl. Microbiol. 2022, 132, 4400–4412. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Name | Primer Sequence | Reference |
---|---|---|---|
acnA | acnA3F | CMAGRGTRTTRATGCARGAYTTTAC | Ma et al., 2007 [27] |
acnA3R | GATCATGGTGGTRTGSGARTCVGT | ||
gapA | gapA326F | ATCTTCCTGACCGACGAAACTGC | Ma et al., 2007 [27] |
gapA845R | ACGTCATCTTCGGTGTAACCCAG | ||
icdA | icdA400F | GGTGGTATCCGTTCTCTGAACG | Ma et al., 2007 [27] |
icdA977R | TAGTCGCCGTTCAGGTTCATACA | ||
mdh | mdh86F | CCCAGCTTCCTTCAGGTTCAGA | Ma et al., 2007 [27] |
mdh628R | CTGCATTCTGAATACGTTTGGTCA | ||
mtlD | mtlD146F | GGCCGGTAATATCGGCCGTGG | Ma et al., 2007 [27] |
mtlD650R | CATTCGCTGAAGGTTTCCACCGT | ||
pgi | pgi815F | TGGGTCGGCGGCCGTTACTC | Ma et al., 2007 [27] |
pgi1396R | TGCCTTCGAATACTTTGAACGGC | ||
proA | proAF1 | CGGYAATGCGGTGATTCTGCG | Ma et al., 2007 [27] |
proAR1 | GGGTACTGACCGCCACTTC | ||
rpoS | rpoS1 | ATGAGCCAAAGTACGCTGAA | Waleron et al., 2002 [33] |
rpoS2 | ACCTGAATCTGACGAACACG |
Characteristic | ESRB-1 | ESRB-2 | ESRB-3 | ESRB-4 |
---|---|---|---|---|
Phosphatase | − | − | − | − |
Acid from α-methyl glucoside | + | + | + | + |
Tolerance of 5% NaCl | + | + | + | + |
Growth at CVP medium | + | + | + | + |
Growth at 37 °C | + | + | + | + |
Acid production from glucose | + | + | + | + |
Reducing substances from sucrose | + | + | + | + |
Acid production from maltose | + | + | + | + |
Utilization of acetic acid | + | + | + | + |
Cellobiose | + | + | + | + |
D-arabitol | + | + | + | + |
2-Deoxyadenosine | − | − | − | − |
D-glucosaminic acid | − | − | − | − |
D-glucuronic acid | − | − | − | − |
D,l-lactic acid | + | + | + | + |
D-melibiose | + | + | + | + |
D-sorbitol | + | + | + | + |
Glucose-1-phosphate | − | − | − | − |
Inosine | − | − | − | − |
L-glutamic acid | − | − | − | − |
Maltose | − | − | − | − |
Succinamic acid | + | + | + | + |
Thymidine | + | + | + | + |
Tween-40 | − | − | − | − |
Tween-80 | − | − | − | − |
Uridine | + | + | + | + |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, W.; Luo, W.; Zhou, J.; Zhu, X.; Xu, J. Pectobacterium carotovorum Subsp. brasiliense Causing Soft Rot in Eggplant in Xinjiang, China. Microorganisms 2023, 11, 2662. https://doi.org/10.3390/microorganisms11112662
He W, Luo W, Zhou J, Zhu X, Xu J. Pectobacterium carotovorum Subsp. brasiliense Causing Soft Rot in Eggplant in Xinjiang, China. Microorganisms. 2023; 11(11):2662. https://doi.org/10.3390/microorganisms11112662
Chicago/Turabian StyleHe, Wei, Wenfang Luo, Junhui Zhou, Xiafen Zhu, and Jianjun Xu. 2023. "Pectobacterium carotovorum Subsp. brasiliense Causing Soft Rot in Eggplant in Xinjiang, China" Microorganisms 11, no. 11: 2662. https://doi.org/10.3390/microorganisms11112662
APA StyleHe, W., Luo, W., Zhou, J., Zhu, X., & Xu, J. (2023). Pectobacterium carotovorum Subsp. brasiliense Causing Soft Rot in Eggplant in Xinjiang, China. Microorganisms, 11(11), 2662. https://doi.org/10.3390/microorganisms11112662