Mycobacterium tuberculosis whiB3 and Lipid Metabolism Genes Are Regulated by Host Induced Oxidative Stress
Abstract
:1. Introduction
2. Materials and Methods
2.1. Strains and Culture Conditions
2.2. Human Macrophage Differentiation
2.3. Bronchoalveolar Cell Culture
2.4. Modulation of NOX Activity in Infected Macrophages
2.5. Macrophage Infection and Treatment under Oxidative Conditions
2.6. Quantification of Macrophage Viability
2.7. ROS Detection in Infected Macrophages
2.8. Stress Conditions in Mycobacterial Culture
2.9. Total RNA Extraction
2.10. Bacterial Gene Expression
2.11. Statistical Analysis
3. Results
3.1. M. tuberculosis whib3 Expression from Pure In Vitro Cultures and after Macrophage Infection
3.2. Effect of ROS on whiB3 and sodA Expression in Intracellular Mycobacteria
3.3. Effect of Oxidants on whiB3 and sodA Expression in Intracellular Mycobacteria
3.4. Effect of Oxidants on Genes Involved in Lipid Metabolism in Intracellular Mycobacteria
3.5. Effect of Oxidizing Conditions on Bacterial Survival and Gene Expression of M. tuberculosis
3.6. The Induction of whiB3 Expression May Be Controlled by Various Transcription Factors
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- World Health Organization. Global Tuberkulosis Report; World Health Organization: Geneva, Switzerland, 2021. [Google Scholar]
- Caño-Muñiz, S.; Anthony, R.; Niemann, S.; Alffenaar, J.W.C. New Approaches and Therapeutic Options for Mycobacterium Tuberculosis in a Dormant State. Clin. Microbiol. Rev. 2017, 31, e00060-17. [Google Scholar] [CrossRef] [PubMed]
- Brugarolas, P.; Movahedzadeh, F.; Wang, Y.; Zhang, N.; Bartek, I.L.; Gao, Y.N.; Voskuil, M.I.; Franzblau, S.G.; He, C. The Oxidation-Sensing Regulator (MosR) Is a New Redox-Dependent Transcription Factor in Mycobacterium Tuberculosis. J. Biol. Chem. 2012, 287, 37703–37712. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, N.D.; Wu, Q.L.; Kong, D.; Puyang, X.; Garg, S.; Husson, R.N. A Mycobacterial Extracytoplasmic Sigma Factor Involved in Survival Following Heat Shock and Oxidative Stress. J. Bacteriol. 1999, 181, 4266–4274. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.Z.; Bhaskar, A.; Upadhyay, S.; Kumari, P.; Rajmani, R.S.; Jain, P.; Singh, A.; Kumar, D.; Bhavesh, N.S.; Nandicoori, V.K. Protein Kinase G Confers Survival Advantage to Mycobacterium Tuberculosis during Latency-like Conditions. J. Biol. Chem. 2017, 292, 16093–16108. [Google Scholar] [CrossRef]
- Singh, N.; Kumar, A. Virulence Factor SenX3 Is the Oxygen-Controlled Replication Switch of Mycobacterium Tuberculosis. Antioxid. Redox Signal. 2015, 22, 603–613. [Google Scholar] [CrossRef]
- Raman, S.; Song, T.; Puyang, X.; Bardarov, S.; Jacobs, J.; Husson, R.N. The Alternative Sigma Factor SigH Regulates Major Components of Oxidative and Heat Stress Responses in Mycobacterium Tuberculosis. J. Bacteriol. 2001, 183, 6119–6125. [Google Scholar] [CrossRef]
- den Hengst, C.D.; Buttner, M.J. Redox Control in Actinobacteria. Biochim. Biophys. Acta-Gen. Subj. 2008, 1780, 1201–1216. [Google Scholar] [CrossRef]
- Cumming, B.M.; Rahman, M.A.; Lamprecht, D.A.; Rohde, K.H.; Saini, V.; Adamson, J.H.; Russell, D.G.; Steyn, A.J.C. Mycobacterium Tuberculosis Arrests Host Cycle at the G1/S Transition to Establish Long Term Infection. PLoS Pathog. 2017, 13, e1006389. [Google Scholar] [CrossRef]
- Singh, A.; Crossman, D.K.; Mai, D.; Guidry, L.; Voskuil, M.I.; Renfrow, M.B.; Steyn, A.J.C. Mycobacterium Tuberculosis WhiB3 Maintains Redox Homeostasis by Regulating Virulence Lipid Anabolism to Modulate Macrophage Response. PLoS Pathog. 2009, 5, e1000545. [Google Scholar] [CrossRef]
- Steyn, A.J.C.; Collins, D.M.; Hondalus, M.K.; Jacobs, W.R.; Pamela Kawakami, R.; Bloom, B.R. Mycobacterium Tuberculosis WhiB3 Interacts with RpoV to Affect Host Survival but Is Dispensable for in Vivo Growth. Proc. Natl. Acad. Sci. USA. 2002, 99, 3147–3152. [Google Scholar] [CrossRef] [Green Version]
- Mehta, M.; Singh, A. Mycobacterium Tuberculosis WhiB3 Maintains Redox Homeostasis and Survival in Response to Reactive Oxygen and Nitrogen Species. Free Radic. Biol. Med. 2019, 131, 50–58. [Google Scholar] [CrossRef] [PubMed]
- Mehta, M.; Rajmani, R.S.; Singh, A. Mycobacterium Tuberculosis WhiB3 Responds to Vacuolar PH-Induced Changes in Mycothiol Redox Potential to Modulate Phagosomal Maturation and Virulence. J. Biol. Chem. 2016, 291, 2888–2903. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Guidry, L.; Narasimhulu, K.V.; Mai, D.; Trombley, J.; Redding, K.E.; Giles, G.I.; Lancaster, J.R.; Steyn, A.J.C. Mycobacterium Tuberculosis WhiB3 Responds to O2 and Nitric Oxide via Its [4Fe-4S] Cluster and Is Essential for Nutrient Starvation Survival. Proc. Natl. Acad. Sci. USA. 2007, 104, 11562–11567. [Google Scholar] [CrossRef] [PubMed]
- Voskuil, M.I.; Bartek, I.L.; Visconti, K.; Schoolnik, G.K. The Response of Mycobacterium Tuberculosis to Reactive Oxygen and Nitrogen Species. Front. Microbiol. 2011, 2, 105. [Google Scholar] [CrossRef] [PubMed]
- Harth, G.; Horwitz, M.A. Export of Recombinant Mycobacterium Tuberculosis Superoxide Dismutase Is Dependent upon Both Information in the Protein and Mycobacterial Export Machinery: A Model for Studying Export of Leaderless Proteins by Pathogenic Mycobacteria. J. Biol. Chem. 1999, 274, 4281–4292. [Google Scholar] [CrossRef] [PubMed]
- Ehrt, S.; Schnappinger, D. Mycobacterium Tuberculosis Virulence: Lipids inside and Out. Nat. Med. 2007, 13, 284–285. [Google Scholar] [CrossRef] [PubMed]
- Mishra, K.C.; De Chastellier, C.; Narayana, Y.; Bifani, P.; Brown, A.K.; Besra, G.S.; Katoch, V.M.; Joshi, B.; Balaji, K.N.; Kremer, L. Functional Role of the PE Domain and Immunogenicity of the Mycobacterium Tuberculosis Triacylglycerol Hydrolase LipY. Infect. Immun. 2008, 76, 127–140. [Google Scholar] [CrossRef]
- Daniel, J.; Maamar, H.; Deb, C.; Sirakova, T.D.; Kolattukudy, P.E. Mycobacterium Tuberculosis Uses Host Triacylglycerol to Accumulate Lipid Droplets and Acquires a Dormancy-Like Phenotype in Lipid-Loaded Macrophages. PLoS Pathog. 2011, 7, e1002093. [Google Scholar] [CrossRef]
- Pham, T.V.; Murkin, A.S.; Moynihan, M.M.; Harris, L.; Tyler, P.C.; Shetty, N.; Sacchettini, J.C.; Huang, H.-l.; Meek, T.D. Mechanism-Based Inactivator of Isocitrate Lyases 1 and 2 from Mycobacterium Tuberculosis. Proc. Natl. Acad. Sci. USA. 2017, 114, 7617–7622. [Google Scholar] [CrossRef]
- McKinney, J.D.; Höner Zu Bentrup, K.; Muñoz-Elias, E.J.; Miczak, A.; Chen, B.; Chan, W.T.; Swenson, D.; Sacchettini, J.C.; Jacobs, W.R.; Russell, D.G. Persistence of Mycobacterium Tuberculosis in Macrophages and Mice Requires the Glyoxylate Shunt Enzyme Isocitrate Lyase. Nature 2000, 406, 735–738. [Google Scholar] [CrossRef]
- Smith, C.V.; Huang, C.C.; Miczak, A.; Russell, D.G.; Sacchettini, J.C.; Höner zu Bentrup, K. Biochemical and Structural Studies of Malate Synthase from Mycobacterium Tuberculosis. J. Biol. Chem. 2003, 278, 1735–1743. [Google Scholar] [CrossRef] [PubMed]
- Bøyum, A. Isolation of Lymphocytes, Granulocytes and Macrophages. Scand. J. Immunol. 1976, 5, 9–15. [Google Scholar] [CrossRef] [PubMed]
- Juarez, E.; Nuñez, C.; Sada, E.; Ellner, J.J.; Schwander, S.K.; Torres, M. Differential Expression of Toll-like Receptors on Human Alveolar Macrophages and Autologous Peripheral Monocytes. Respir. Res. 2010, 11, 2. [Google Scholar] [CrossRef] [PubMed]
- Wahl, L.M.; Wahl, S.M.; Smythies, L.E.; Smith, P.D. Isolation of Human Monocyte Populations. Curr. Protoc. Immunol. 2005, 70, 7.6A. [Google Scholar] [CrossRef] [PubMed]
- Cosentino-Gomes, D.; Rocco-Machado, N.; Meyer-Fernandes, J.R. Cell Signaling through Protein Kinase C Oxidation and Activation. Int. J. Mol. Sci. 2012, 13, 10697. [Google Scholar] [CrossRef]
- Li, Y.; Trush, M.A. Diphenyleneiodonium, an NAD(P)H Oxidase Inhibitor, Also Potently Inhibits Mitochondrial Reactive Oxygen Species Production. Biochem. Biophys. Res. Commun. 1998, 253, 295–299. [Google Scholar] [CrossRef]
- Guzmán-Beltrán, S.; Rubio-Badillo, M.Á.; Juárez, E.; Hernández-Sánchez, F.; Torres, M. Nordihydroguaiaretic Acid (NDGA) and α-Mangostin Inhibit the Growth of Mycobacterium Tuberculosis by Inducing Autophagy. Int. Immunopharmacol. 2016, 31, 149–157. [Google Scholar] [CrossRef]
- Hia, F.; Chionh, Y.H.; Pang, Y.L.J.; De Mott, M.S.; McBee, M.E.; Dedon, P.C. Mycobacterial RNA Isolation Optimized for Non-Coding RNA: High Fidelity Isolation of 5S RRNA from Mycobacterium Bovis BCG Reveals Novel Post-Transcriptional Processing and a Complete Spectrum of Modified Ribonucleosides. Nucleic Acids Res. 2015, 43, e32. [Google Scholar] [CrossRef]
- Rastogi, S.; Agarwal, P.; Krishnan, M.Y. Use of an Adipocyte Model to Study the Transcriptional Adaptation of Mycobacterium Tuberculosis to Store and Degrade Host Fat. Int. J. mycobacteriol. 2016, 5, 92–98. [Google Scholar] [CrossRef]
- Câmara, A.S.; Horjales, E. Computer Simulations Reveal Changes in the Conformational Space of the Transcriptional Regulator MosR upon the Formation of a Disulphide Bond and in the Collective Motions That Regulate Its DNA-Binding Affinity. PLoS ONE 2018, 13, e0192826. [Google Scholar] [CrossRef] [Green Version]
- Manganelli, R.; Voskuil, M.I.; Schoolnik, G.K.; Dubnau, E.; Gomez, M.; Smith, I. Role of the Extracytoplasmic-Function Sigma Factor Sigma(H) in Mycobacterium Tuberculosis Global Gene Expression. Mol. Microbiol. 2002, 45, 365–374. [Google Scholar] [CrossRef] [PubMed]
- Mahatha, A.C.; Mal, S.; Majumder, D.; Saha, S.; Ghosh, A.; Basu, J.; Kundu, M. RegX3 Activates WhiB3 Under Acid Stress and Subverts Lysosomal Trafficking of Mycobacterium Tuberculosis in a WhiB3-Dependent Manner. Front. Microbiol. 2020, 11, 572433. [Google Scholar] [CrossRef]
- Walburger, A.; Koul, A.; Ferrari, G.; Nguyen, L.; Prescianotto-Baschong, C.; Huygen, K.; Klebl, B.; Thompson, C.; Bacher, G.; Pieters, J. Protein Kinase G from Pathogenic Mycobacteria Promotes Survival within Macrophages. Science 2004, 304, 1800–1804. [Google Scholar] [CrossRef] [PubMed]
- Banaiee, N.; Jacobs, W.R.; Ernst, J.D. Regulation of Mycobacterium Tuberculosis WhiB3 in the Mouse Lung and Macrophages. Infect. Immun. 2006, 74, 6449–6457. [Google Scholar] [CrossRef]
- Geiman, D.E.; Raghunand, T.R.; Agarwal, N.; Bishai, W.R. Differential Gene Expression in Response to Exposure to Antimycobacterial Agents and Other Stress Conditions among Seven Mycobacterium Tuberculosis WhiB-like Genes. Antimicrob. Agents Chemother. 2006, 50, 2836–2841. [Google Scholar] [CrossRef] [PubMed]
- Molle, V.; Palframan, W.J.; Findlay, K.C.; Buttner, M.J. WhiD and WhiB, Homologous Proteins Required for Different Stages of Sporulation in Streptomyces Coelicolor A3(2). J. Bacteriol. 2000, 182, 1286–1295. [Google Scholar] [CrossRef]
- Crack, J.C.; Den Hengst, C.D.; Jakimowicz, P.; Subramanian, S.; Johnson, M.K.; Buttner, M.J.; Thomson, A.J.; Le Brun, N.E. Characterization of [4Fe-4S]-Containing and Cluster-Free Forms of Streptomyces WhiD. Biochemistry 2009, 48, 12252–12264. [Google Scholar] [CrossRef]
- Lee, J.S.; Krause, R.; Schreiber, J.; Mollenkopf, H.J.; Kowall, J.; Stein, R.; Jeon, B.Y.; Kwak, J.Y.; Song, M.K.; Patron, J.P.; et al. Mutation in the Transcriptional Regulator PhoP Contributes to Avirulence of Mycobacterium Tuberculosis H37Ra Strain. Cell Host Microbe 2008, 3, 97–103. [Google Scholar] [CrossRef]
- Prasad, A.; Manoharan, R.R.; Sedlářová, M.; Pospíšil, P. Free Radical-Mediated Protein Radical Formation in Differentiating Monocytes. Int. J. Mol. Sci. 2021, 22, 9963. [Google Scholar] [CrossRef]
- Cumming, B.M.; Lamprecht, D.A.; Wells, R.M.; Saini, V.; Mazorodze, J.H.; Steyn, A.J.C. The Physiology and Genetics of Oxidative Stress in Mycobacteria. Microbiol. Spectr. 2014, 2, 2–3. [Google Scholar] [CrossRef] [Green Version]
- Liao, D.; Fan, Q.; Bao, L. The Role of Superoxide Dismutase in the Survival of Mycobacterium Tuberculosis in Macrophages. Jpn. J. Infect. Dis. 2013, 66, 480–488. [Google Scholar] [CrossRef] [PubMed]
- Gago, G.; Diacovich, L.; Gramajo, H. Lipid Metabolism and Its Implication in Mycobacteria–Host Interaction. Curr. Opin. Microbiol. 2018, 41, 36–42. [Google Scholar] [CrossRef] [PubMed]
- Iona, E.; Pardini, M.; Mustazzolu, A.; Piccaro, G.; Nisini, R.; Fattorini, L.; Giannoni, F. Mycobacterium Tuberculosis Gene Expression at Different Stages of Hypoxia-Induced Dormancy and upon Resuscitation. J. Microbiol. 2016, 54, 565–572. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez, J.G.; Hernández, A.C.; Helguera-Repetto, C.; Ayala, D.A.; Guadarrama-Medina, R.; Anzóla, J.M.; Bustos, J.R.; Zambrano, M.M.; González-y-Merchand, J.; García, M.J.; et al. Global Adaptation to a Lipid Environment Triggers the Dormancy-Related Phenotype of Mycobacterium Tuberculosis. MBio 2014, 5, e01125-14. [Google Scholar] [CrossRef]
- Neyrolles, O.; Hernández-Pando, R.; Pietri-Rouxel, F.; Fornès, P.; Tailleux, L.; Payán, J.A.B.; Pivert, E.; Bordat, Y.; Aguilar, D.; Prévost, M.C.; et al. Is Adipose Tissue a Place for Mycobacterium Tuberculosis Persistence? PLoS ONE 2006, 1, e43. [Google Scholar] [CrossRef] [PubMed]
- Garton, N.J.; Christensen, H.; Minnikin, D.E.; Adegbola, R.A.; Barer, M.R. Intracellular Lipophilic Inclusions of Mycobacteria in Vitro and in Sputum. Microbiology 2002, 148, 2951–2958. [Google Scholar] [CrossRef] [PubMed]
- Garton, N.J.; Waddell, S.J.; Sherratt, A.L.; Lee, S.M.; Smith, R.J.; Senner, C.; Hinds, J.; Rajakumar, K.; Adegbola, R.A.; Besra, G.S.; et al. Cytological and Transcript Analyses Reveal Fat and Lazy Persister-like Bacilli in Tuberculous Sputum. PLoS Med. 2008, 5, 0634–0645. [Google Scholar] [CrossRef]
- Kapoor, N.; Pawar, S.; Sirakova, T.D.; Deb, C.; Warren, W.L.; Kolattukudy, P.E. Human Granuloma in Vitro Model, for TB Dormancy and Resuscitation. PLoS ONE 2013, 8, e53657. [Google Scholar] [CrossRef]
- Caire-Brändli, I.B.; Papadopoulos, A.; Malaga, W.; Marais, D.; Canaan, S.; Thilo, L.; De Chastelliera, C. Reversible Lipid Accumulation and Associated Division Arrest of Mycobacterium Avium in Lipoprotein-Induced Foamy Macrophages May Resemble Key Events during Latency and Reactivation of Tuberculosis. Infect. Immun. 2014, 82, 476–490. [Google Scholar] [CrossRef]
- Vandal, O.H.; Nathan, C.F.; Ehrt, S. Acid Resistance in Mycobacterium Tuberculosis. J. Bacteriol. 2009, 191, 4714–4721. [Google Scholar] [CrossRef] [Green Version]






| Target | Sequences | Reference |
|---|---|---|
| whiB3 | F: tggactcatcgatgttcttcc | This work |
| R: tagggctcaccgacctctaa | ||
| lip-Y | F: gtattagccgctgccgagga | [30] |
| R: gataccgctggcgaattcactct | ||
| tgs-1 | F: aacgaagaccagttattcgagc | [30] |
| R: ctcatactttcatcggagagcc | ||
| icl-1 | F: cggatcaacaacgcactgca | [30] |
| R: ttctgcagctcgtagacgtt | ||
| sodA | F: acaccttgccagacctgga | This work |
| R: cgccctttacgtaggtggc | ||
| rRNA 16S | F: ggtgcgagcgttgtccgg | This work |
| R: cgcccgcacgctcacagtta |
| Location | Promotor | Sequence * |
|---|---|---|
| −25 | MosR (Rv1049) | atacg tgtag ctaca cgagc |
| −91 | WhiB3 (Rv3416) | ttagg cgtac tcaca gcatg |
| consensus sequence | g tgtan ntaca c |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Barrientos, O.M.; Langley, E.; González, Y.; Cabello, C.; Torres, M.; Guzmán-Beltrán, S. Mycobacterium tuberculosis whiB3 and Lipid Metabolism Genes Are Regulated by Host Induced Oxidative Stress. Microorganisms 2022, 10, 1821. https://doi.org/10.3390/microorganisms10091821
Barrientos OM, Langley E, González Y, Cabello C, Torres M, Guzmán-Beltrán S. Mycobacterium tuberculosis whiB3 and Lipid Metabolism Genes Are Regulated by Host Induced Oxidative Stress. Microorganisms. 2022; 10(9):1821. https://doi.org/10.3390/microorganisms10091821
Chicago/Turabian StyleBarrientos, Omar M., Elizabeth Langley, Yolanda González, Carlos Cabello, Martha Torres, and Silvia Guzmán-Beltrán. 2022. "Mycobacterium tuberculosis whiB3 and Lipid Metabolism Genes Are Regulated by Host Induced Oxidative Stress" Microorganisms 10, no. 9: 1821. https://doi.org/10.3390/microorganisms10091821
APA StyleBarrientos, O. M., Langley, E., González, Y., Cabello, C., Torres, M., & Guzmán-Beltrán, S. (2022). Mycobacterium tuberculosis whiB3 and Lipid Metabolism Genes Are Regulated by Host Induced Oxidative Stress. Microorganisms, 10(9), 1821. https://doi.org/10.3390/microorganisms10091821

