Assays for Identification and Differentiation of Brucella Species: A Review
Abstract
1. Introduction
2. Genotyping
3. Conventional PCR
4. Loop-Mediated Isothermal Amplification (LAMP)
5. Real-Time PCR
6. Restriction Fragment Length Polymorphism (RFLP)
7. Multilocus Sequence Analysis/Typing (MLSA/MLST)
8. Ligase Chain Reaction (LCR)
9. Multiple Locus VNTR Analysis (MLVA)
10. Recommendations and Suggested Workflow
11. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- OIE—World Organisation for Animal Health. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Available online: http://www.oie.int/manual-of-diagnostic-tests-and-vaccines-for-terrestrial-animals/ (accessed on 16 February 2018).
- WHO. Brucellosis in Humans and Animals. Available online: http://www.who.int/csr/resources/publications/deliberate/WHO_CDS_EPR_2006_7/en/ (accessed on 14 February 2018).
- Nicoletti, P. Brucellosis in Animals. In Madkour’s Brucellosis; Springer: Berlin/Heidelberg, Germany, 2001; pp. 267–275. ISBN 978-3-540-67272-2. [Google Scholar]
- Brucellosis—Symptoms and Causes. Available online: http://www.mayoclinic.org/diseases-conditions/brucellosis/symptoms-causes/syc-20351738 (accessed on 6 February 2018).
- Franco, M.P.; Mulder, M.; Gilman, R.H.; Smits, H.L. Human Brucellosis. Lancet Infect. Dis. 2007, 7, 775–786. [Google Scholar] [CrossRef]
- Siadat, S.D.; Salmani, A.S.; Aghasadeghi, M.R. Brucellosis Vaccines: An Overview. Zoonosis 2012, 143–166. [Google Scholar] [CrossRef]
- Potter, M.E. Chapter 15—Brucellosis. In Foodborne Infections and Intoxications, 4th ed.; Food Science and Technology; Academic Press: San Diego, CA, USA, 2013; pp. 239–250. ISBN 978-0-12-416041-5. [Google Scholar]
- Busch, L.A.; Parker, R.L. Brucellosis in the United States. J. Infect. Dis. 1972, 125, 289–294. [Google Scholar] [CrossRef]
- Pedersen, K.; Quance, C.R.; Robbe-Austerman, S.; Piaggio, A.J.; Bevins, S.N.; Goldstein, S.M.; Gaston, W.D.; DeLiberto, T.J. Identification of Brucella suis from Feral Swine in Selected States in the USA. J. Wildl. Dis. 2014, 50, 171–179. [Google Scholar] [CrossRef]
- Brower, A.; Okwumabua, O.; Massengill, C.; Muenks, Q.; Vanderloo, P.; Duster, M.; Homb, K.; Kurth, K. Investigation of the Spread of Brucella canis via the US Interstate Dog Trade. Int. J. Infect. Dis. 2007, 11, 454–458. [Google Scholar] [CrossRef][Green Version]
- Bano, Y.; Lone, S.A. Brucellosis: An Economically Important Infection. J. Med. Microbiol. Diagn. 2015, 4, 208. [Google Scholar] [CrossRef]
- Sing, A. Zoonoses—Infections Affecting Humans and Animals: Focus on Public Health Aspects; Springer: Cham, Switzerland, 2014; ISBN 978-94-017-9457-2. [Google Scholar]
- Alton, G.G.; Forsyth, J.R.L. Brucella. In Medical Microbiology; Baron, S., Ed.; University of Texas Medical Branch at Galveston: Galveston, TX, USA, 1996; ISBN 978-0-9631172-1-2. [Google Scholar]
- Jiménez de Bagüés, M.P.; Terraza, A.; Gross, A.; Dornand, J. Different Responses of Macrophages to Smooth and Rough Brucella Spp.: Relationship to Virulence. Infect. Immun. 2004, 72, 2429–2433. [Google Scholar] [CrossRef]
- Guzmán-Verri, C.; González-Barrientos, R.; Hernández-Mora, G.; Morales, J.-A.; Baquero-Calvo, E.; Chaves-Olarte, E.; Moreno, E. Brucella ceti and Brucellosis in Cetaceans. Front. Cell. Infect. Microbiol. 2012, 2, 3. [Google Scholar] [CrossRef]
- Brucella. Available online: http://www.bacterio.net/brucella.html (accessed on 17 January 2018).
- Brucella in Taxonomy. Available online: http://www.uniprot.org/taxonomy/?query=brucella&sort=score (accessed on 19 February 2018).
- Atluri, V.L.; Xavier, M.N.; de Jong, M.F.; den Hartigh, A.B.; Tsolis, R.M. Interactions of the Human Pathogenic Brucella Species with Their Hosts. Annu. Rev. Microbiol. 2011, 65, 523–541. [Google Scholar] [CrossRef]
- Scholz, H.C.; Revilla-Fernández, S.; Dahouk, S.A.; Hammerl, J.A.; Zygmunt, M.S.; Cloeckaert, A.; Koylass, M.; Whatmore, A.M.; Blom, J.; Vergnaud, G.; et al. Brucella Vulpis Sp. Nov., Isolated from Mandibular Lymph Nodes of Red Foxes (Vulpes vulpes). Int. J. Syst. Evol. Microbiol. 2016, 66, 2090–2098. [Google Scholar] [CrossRef]
- Tiller, R.V.; Gee, J.E.; Frace, M.A.; Taylor, T.K.; Setubal, J.C.; Hoffmaster, A.R.; De, B.K. Characterization of Novel Brucella Strains Originating from Wild Native Rodent Species in North Queensland, Australia. Appl. Environ. Microbiol. 2010, 76, 5837–5845. [Google Scholar] [CrossRef]
- Eisenberg, T.; Hamann, H.-P.; Kaim, U.; Schlez, K.; Seeger, H.; Schauerte, N.; Melzer, F.; Tomaso, H.; Scholz, H.C.; Koylass, M.S.; et al. Isolation of Potentially Novel Brucella Spp. from Frogs. Appl. Environ. Microbiol. 2012, 78, 3753–3755. [Google Scholar] [CrossRef]
- Eisenberg, T.; Riße, K.; Schauerte, N.; Geiger, C.; Blom, J.; Scholz, H.C. Isolation of a Novel “atypical” Brucella Strain from a Bluespotted Ribbontail Ray (Taeniura lymma). Antonie Van Leeuwenhoek 2017, 110, 221–234. [Google Scholar] [CrossRef]
- Host Immune Responses to the Intracellular Bacteria Brucella: Does the Bacteria Instruct the Host to Facilitate Chronic Infection? Available online: https://www.researchgate.net/publication/6465964_Host_Immune_Responses_to_the_Intracellular_Bacteria_Brucella_Does_the_Bacteria_Instruct_the_Host_to_Facilitate_Chronic_Infection (accessed on 20 February 2018).
- Garin-Bastuji, B.; Mick, V.; Carrou, G.L.; Allix, S.; Perrett, L.L.; Dawson, C.E.; Groussaud, P.; Stubberfield, E.J.; Koylass, M.; Whatmore, A.M. Examination of Taxonomic Uncertainties Surrounding Brucella abortus Bv. 7 by Phenotypic and Molecular Approaches. Appl. Environ. Microbiol. 2014, 80, 1570–1579. [Google Scholar] [CrossRef]
- Whatmore, A.M.; Dawson, C.; Groussaud, P.; Koylass, M.S.; King, A.; Shankster, S.J.; Sohn, A.H.; Probert, W.S.; McDonald, W.L. Marine Mammal Brucella Genotype Associated with Zoonotic Infection. Emerg. Infect. Dis. 2008, 14, 517–518. [Google Scholar] [CrossRef]
- Jiménez de Bagüés, M.P.; Iturralde, M.; Arias, M.A.; Pardo, J.; Cloeckaert, A.; Zygmunt, M.S. The New Strains Brucella inopinata BO1 and Brucella Species 83–210 Behave Biologically Like Classic Infectious Brucella Species and Cause Death in Murine Models of Infection. J. Infect. Dis. 2014, 210, 467–472. [Google Scholar] [CrossRef]
- Barquero-Calvo, E.; Baker, K.S.; Amuy, E.; Chaves-Olarte, E.; Thomson, N.R.; Moreno, E.; Guzman-Verri, C.; Suárez-Esquivel, M.; Ruiz-Villalobos, N.; Jiménez-Rojas, C.; et al. Brucella neotomae Infection in Humans, Costa Rica. Emerg. Infect. Dis. J. 2017, 23. [Google Scholar] [CrossRef]
- Whatmore, A.M. Current Understanding of the Genetic Diversity of Brucella, an Expanding Genus of Zoonotic Pathogens. Infect. Genet. Evol. 2009, 9, 1168–1184. [Google Scholar] [CrossRef]
- Durmuş, S.; Çakır, T.; Guthke, R.; Nikerel, E.; Özgür, A. Computational Systems Biology of Pathogen-Host Interactions; Frontiers Media SA: Lausanne, Switzerland, 2016; ISBN 978-2-88919-821-4. [Google Scholar]
- Pickett, M.J.; Calderone, J.G. Criteria for Identification of Brucella Species. Am. J. Public Health Nations Health 1963, 53, 655–656. [Google Scholar] [CrossRef]
- Smirnova, E.A.; Vasin, A.V.; Sandybaev, N.T.; Klotchenko, S.A.; Plotnikova, M.A.; Chervyakova, O.V.; Sansyzbay, A.R.; Kiselev, O.I. Current Methods of Human and Animal Brucellosis Diagnostics. Adv. Infect. Dis. 2013, 3, 177. [Google Scholar] [CrossRef]
- Araj, G.F. Update on Laboratory Diagnosis of Human Brucellosis. Int. J. Antimicrob. Agents 2010, 36 (Suppl. S1), S12–S17. [Google Scholar] [CrossRef] [PubMed]
- Geresu, M.A.; Kassa, G.M. A Review on Diagnostic Methods of Brucellosis. J. Vet. Sci. Technol. 2016, 7, 3. [Google Scholar] [CrossRef]
- Al Dahouk, S.; Tomaso, H.; Nöckler, K.; Neubauer, H.; Frangoulidis, D. Laboratory-Based Diagnosis of Brucellosis—A Review of the Literature. Part I: Techniques for Direct Detection and Identification of Brucella Spp. Clin. Lab. 2003, 49, 487–505. [Google Scholar]
- Corbel, M.J. Brucellosis: An Overview. Emerg. Infect. Dis. 1997, 3, 213–221. [Google Scholar] [CrossRef]
- Rouzic, N.; Desmier, L.; Cariou, M.-E.; Gay, E.; Foster, J.T.; Williamson, C.H.; Schmitt, F.; Le Henaff, M.; Le Coz, A.; Lorléac’h, A. First Case of Brucellosis Caused by an Amphibian-Type Brucella. Clin. Infect. Dis. 2021, 72, e404–e407. [Google Scholar] [CrossRef]
- Ocampo-Sosa, A.A.; García-Lobo, J.M. Demonstration of IS711 Transposition in Brucella ovis and Brucella pinnipedialis. BMC Microbiol. 2008, 8, 17. [Google Scholar] [CrossRef]
- Cloeckaert, A.; Bernardet, N.; Koylass, M.S.; Whatmore, A.M.; Zygmunt, M.S. Novel IS711 Chromosomal Location Useful for Identification of Marine Mammal Brucella Genotype ST27, which Is Associated with Zoonotic Infection. J. Clin. Microbiol. 2011, 49, 3954–3959. [Google Scholar] [CrossRef]
- Rajashekara, G.; Glasner, J.D.; Glover, D.A.; Splitter, G.A. Comparative Whole-Genome Hybridization Reveals Genomic Islands in Brucella Species. J. Bacteriol. 2004, 186, 5040–5051. [Google Scholar] [CrossRef]
- Chain, P.S.G.; Comerci, D.J.; Tolmasky, M.E.; Larimer, F.W.; Malfatti, S.A.; Vergez, L.M.; Aguero, F.; Land, M.L.; Ugalde, R.A.; Garcia, E. Whole-Genome Analyses of Speciation Events in Pathogenic Brucellae. Infect. Immun. 2005, 73, 8353–8361. [Google Scholar] [CrossRef]
- Van Belkum, A.; Scherer, S.; van Alphen, L.; Verbrugh, H. Short-Sequence DNA Repeats in Prokaryotic Genomes. Microbiol. Mol. Biol. Rev. 1998, 62, 275–293. [Google Scholar] [CrossRef]
- Yeramian, E.; Buc, H. Tandem Repeats in Complete Bacterial Genome Sequences: Sequence and Structural Analyses for Comparative Studies. Res. Microbiol. 1999, 150, 745–754. [Google Scholar] [CrossRef]
- Bennett, P. Demystified…: Microsatellites. Mol. Pathol. 2000, 53, 177–183. [Google Scholar] [CrossRef] [PubMed]
- Foster, J.T.; Beckstrom-Sternberg, S.M.; Pearson, T.; Beckstrom-Sternberg, J.S.; Chain, P.S.G.; Roberto, F.F.; Hnath, J.; Brettin, T.; Keim, P. Whole-Genome-Based Phylogeny and Divergence of the Genus Brucella. J. Bacteriol. 2009, 191, 2864–2870. [Google Scholar] [CrossRef] [PubMed]
- Foster, J.T.; Price, L.B.; Beckstrom-Sternberg, S.M.; Pearson, T.; Brown, W.D.; Kiesling, D.M.; Allen, C.A.; Liu, C.M.; Beckstrom-Sternberg, J.; Roberto, F.F.; et al. Genotyping of Brucella Species Using Clade Specific SNPs. BMC Microbiol. 2012, 12, 110. [Google Scholar] [CrossRef] [PubMed]
- Tan, K.-K.; Tan, Y.-C.; Chang, L.-Y.; Lee, K.W.; Nore, S.S.; Yee, W.-Y.; Mat Isa, M.N.; Jafar, F.L.; Hoh, C.-C.; AbuBakar, S. Full Genome SNP-Based Phylogenetic Analysis Reveals the Origin and Global Spread of Brucella melitensis. BMC Genom. 2015, 16, 93. [Google Scholar] [CrossRef] [PubMed]
- Baily, G.G.; Krahn, J.B.; Drasar, B.S.; Stoker, N.G. Detection of Brucella melitensis and Brucella abortus by DNA Amplification. J. Trop. Med. Hyg. 1992, 95, 271–275. [Google Scholar]
- Rijpens, N.P.; Jannes, G.; Van Asbroeck, M.; Rossau, R.; Herman, L.M. Direct Detection of Brucella Spp. in Raw Milk by PCR and Reverse Hybridization with 16S-23S RRNA Spacer Probes. Appl. Environ. Microbiol. 1996, 62, 1683–1688. [Google Scholar] [CrossRef]
- Bricker, B.J.; Ewalt, D.R.; MacMillan, A.P.; Foster, G.; Brew, S. Molecular Characterization of Brucella Strains Isolated from Marine Mammals. J. Clin. Microbiol. 2000, 38, 1258–1262. [Google Scholar] [CrossRef]
- Romero, C.; Gamazo, C.; Pardo, M.; López-Goñi, I. Specific Detection of Brucella DNA by PCR. J. Clin. Microbiol. 1995, 33, 615–617. [Google Scholar] [CrossRef]
- Leal-Klevezas, D.S.; Martínez-Vázquez, I.O.; López-Merino, A.; Martínez-Soriano, J.P. Single-Step PCR for Detection of Brucella Spp. from Blood and Milk of Infected Animals. J. Clin. Microbiol. 1995, 33, 3087–3090. [Google Scholar] [CrossRef]
- Baddour, M.M.; Alkhalifa, D.H. Evaluation of Three Polymerase Chain Reaction Techniques for Detection of Brucella DNA in Peripheral Human Blood. Can. J. Microbiol. 2008, 54, 352–357. [Google Scholar] [CrossRef] [PubMed]
- Bricker, B.J.; Halling, S.M. Differentiation of Brucella abortus Bv. 1, 2, and 4, Brucella melitensis, Brucella ovis, and Brucella suis Bv. 1 by PCR. J. Clin. Microbiol. 1994, 32, 2660–2666. [Google Scholar] [CrossRef] [PubMed]
- Bricker, B.J.; Halling, S.M. Enhancement of the Brucella AMOS PCR Assay for Differentiation of Brucella abortus Vaccine Strains S19 and RB51. J. Clin. Microbiol. 1995, 33, 1640–1642. [Google Scholar] [CrossRef]
- Ewalt, D.R.; Bricker, B.J. Identification and Differentiation of Brucella abortus Field and Vaccine Strains by BaSS-PCR. In PCR Detection of Microbial Pathogens; Humana Press: Totowa, NJ, USA, 2003; pp. 97–108. [Google Scholar]
- Bricker, B.J.; Ewalt, D.R.; Olsen, S.C.; Jensen, A.E. Evaluation of the Brucella Abortus Species—Specific Polymerase Chain Reaction Assay, an Improved Version of the Brucella AMOS Polymerase Chain Reaction Assay for Cattle. J. Vet. Diagn. Investig. 2003, 15, 374–378. [Google Scholar] [CrossRef] [PubMed]
- Ocampo-Sosa, A.A.; Agüero-Balbín, J.; García-Lobo, J.M. Development of a New PCR Assay to Identify Brucella abortus Biovars 5, 6 and 9 and the New Subgroup 3b of Biovar 3. Vet. Microbiol. 2005, 110, 41–51. [Google Scholar] [CrossRef] [PubMed]
- Huber, B.; Scholz, H.C.; Lucero, N.; Busse, H.-J. Development of a PCR Assay for Typing and Subtyping of Brucella Species. Int. J. Med. Microbiol. 2009, 299, 563–573. [Google Scholar] [CrossRef]
- García-Yoldi, D.; Marín, C.M.; de Miguel, M.J.; Muñoz, P.M.; Vizmanos, J.L.; López-Goñi, I. Multiplex PCR Assay for the Identification and Differentiation of All Brucella Species and the Vaccine Strains Brucella abortus S19 and RB51 and Brucella melitensis Rev1. Clin. Chem. 2006, 52, 779–781. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Steer, M.J. OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animals: Mammals, Birds and Bees. Biol. Stand. Comm. 2012, 1, 1–19. [Google Scholar]
- López-Goñi, I.; García-Yoldi, D.; Marín, C.M.; de Miguel, M.J.; Barquero-Calvo, E.; Guzmán-Verri, C.; Albert, D.; Garin-Bastuji, B. New Bruce-Ladder Multiplex PCR Assay for the Biovar Typing of Brucella suis and the Discrimination of Brucella suis and Brucella canis. Vet. Microbiol. 2011, 154, 152–155. [Google Scholar] [CrossRef]
- Kang, S.-I.; Her, M.; Kim, J.W.; Kim, J.-Y.; Ko, K.Y.; Ha, Y.-M.; Jung, S.C. Advanced Multiplex PCR Assay for Differentiation of Brucella Species. Appl. Environ. Microbiol. 2011, 77, 6726–6728. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-Mediated Isothermal Amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef] [PubMed]
- Ohtsuki, R.; Kawamoto, K.; Kato, Y.; Shah, M.M.; Ezaki, T.; Makino, S.-I. Rapid Detection of Brucella Spp. by the Loop-Mediated Isothermal Amplification Method. J. Appl. Microbiol. 2008, 104, 1815–1823. [Google Scholar] [CrossRef] [PubMed]
- Song, L.; Li, J.; Hou, S.; Li, X.; Chen, S. Establishment of Loop-Mediated Isothermal Amplification (LAMP) for Rapid Detection of Brucella Spp. and Application to Milk and Blood Samples. J. Microbiol. Methods 2012, 90, 292–297. [Google Scholar] [CrossRef]
- Soleimani, M.; Shams, S.; Majidzadeh-A, K. Developing a Real-Time Quantitative Loop-Mediated Isothermal Amplification Assay as a Rapid and Accurate Method for Detection of Brucellosis. J. Appl. Microbiol. 2013, 115, 828–834. [Google Scholar] [CrossRef]
- Karthik, K.; Rathore, R.; Thomas, P.; Arun, T.R.; Viswas, K.N.; Agarwal, R.K.; Manjunathachar, H.V.; Dhama, K. Loop-Mediated Isothermal Amplification (LAMP) Test for Specific and Rapid Detection of Brucella abortus in Cattle. Vet. Q. 2014, 34, 174–179. [Google Scholar] [CrossRef]
- Kang, S.-I.; Her, M.; Kim, J.-Y.; Lee, J.J.; Lee, K.; Sung, S.-R.; Jung, S.C. Rapid and Specific Identification of Brucella abortus Using the Loop-Mediated Isothermal Amplification (LAMP) Assay. Comp. Immunol. Microbiol. Infect. Dis. 2015, 40, 1–6. [Google Scholar] [CrossRef]
- Prusty, B.R.; Chaudhuri, P.; Chaturvedi, V.K.; Saini, M.; Mishra, B.P.; Gupta, P.K. Visual Detection of Brucella Spp. in Spiked Bovine Semen Using Loop-Mediated Isothermal Amplification (LAMP) Assay. Indian J. Microbiol. 2016, 56, 142–147. [Google Scholar] [CrossRef] [PubMed]
- Redkar, R.; Rose, S.; Bricker, B.; DelVecchio, V. Real-Time Detection of Brucella abortus, Brucella melitensis and Brucella suis. Mol. Cell. Probes 2001, 15, 43–52. [Google Scholar] [CrossRef]
- Newby, D.T.; Hadfield, T.L.; Roberto, F.F. Real-Time PCR Detection of Brucella abortus: A Comparative Study of SYBR Green I, 5′-Exonuclease, and Hybridization Probe Assays. Appl. Environ. Microbiol. 2003, 69, 4753–4759. [Google Scholar] [CrossRef]
- Probert, W.S.; Schrader, K.N.; Khuong, N.Y.; Bystrom, S.L.; Graves, M.H. Real-Time Multiplex PCR Assay for Detection of Brucella Spp., B. abortus, and B. melitensis. J. Clin. Microbiol. 2004, 42, 1290–1293. [Google Scholar] [CrossRef]
- Bounaadja, L.; Albert, D.; Chénais, B.; Hénault, S.; Zygmunt, M.S.; Poliak, S.; Garin-Bastuji, B. Real-Time PCR for Identification of Brucella Spp.: A Comparative Study of IS711, Bcsp31 and per Target Genes. Vet. Microbiol. 2009, 137, 156–164. [Google Scholar] [CrossRef] [PubMed]
- Hinić, V.; Brodard, I.; Thomann, A.; Cvetnić, Ž.; Makaya, P.V.; Frey, J.; Abril, C. Novel Identification and Differentiation of Brucella melitensis, B. abortus, B. suis, B. ovis, B. canis, and B. neotomae Suitable for Both Conventional and Real-Time PCR Systems. J. Microbiol. Methods 2008, 75, 375–378. [Google Scholar] [CrossRef]
- Foster, J.T.; Okinaka, R.T.; Svensson, R.; Shaw, K.; De, B.K.; Robison, R.A.; Probert, W.S.; Kenefic, L.J.; Brown, W.D.; Keim, P. Real-Time PCR Assays of Single Nucleotide Polymorphisms Defining the Major Brucella Clades. J. Clin. Microbiol. 2008, 46, 296–301. [Google Scholar] [CrossRef]
- Fretin, D.; Whatmore, A.M.; Al Dahouk, S.; Neubauer, H.; Garin-Bastuji, B.; Albert, D.; Van Hessche, M.; Ménart, M.; Godfroid, J.; Walravens, K.; et al. Brucella suis Identification and Biovar Typing by Real-Time PCR. Vet. Microbiol. 2008, 131, 376–385. [Google Scholar] [CrossRef] [PubMed]
- Gopaul, K.K.; Koylass, M.S.; Smith, C.J.; Whatmore, A.M. Rapid Identification of Brucella Isolates to the Species Level by Real Time PCR Based Single Nucleotide Polymorphism (SNP) Analysis. BMC Microbiol. 2008, 8, 86. [Google Scholar] [CrossRef]
- Koylass, M.S.; King, A.C.; Edwards-Smallbone, J.; Gopaul, K.K.; Perrett, L.L.; Whatmore, A.M. Comparative Performance of SNP Typing and ‘Bruce-Ladder’ in the Discrimination of Brucella suis and Brucella canis. Vet. Microbiol. 2010, 142, 450–454. [Google Scholar] [CrossRef]
- Gopaul, K.K.; Sells, J.; Bricker, B.J.; Crasta, O.R.; Whatmore, A.M. Rapid and Reliable Single Nucleotide Polymorphism-Based Differentiation of Brucella Live Vaccine Strains from Field Strains. J. Clin. Microbiol. 2010, 48, 1461–1464. [Google Scholar] [CrossRef] [PubMed]
- Winchell, J.M.; Wolff, B.J.; Tiller, R.; Bowen, M.D.; Hoffmaster, A.R. Rapid Identification and Discrimination of Brucella Isolates by Use of Real-Time PCR and High-Resolution Melt Analysis. J. Clin. Microbiol. 2010, 48, 697–702. [Google Scholar] [CrossRef]
- Tong, S.Y.C.; Giffard, P.M. Microbiological Applications of High-Resolution Melting Analysis. J. Clin. Microbiol. 2012, 50, 3418–3421. [Google Scholar] [CrossRef]
- Gopaul, K.K.; Sells, J.; Lee, R.; Beckstrom- Sternberg, S.M.; Foster, J.T.; Whatmore, A.M. Development and Assessment of Multiplex High Resolution Melting Assay as a Tool for Rapid Single-Tube Identification of Five Brucella Species. BMC Res. Notes 2014, 7, 903. [Google Scholar] [CrossRef]
- Girault, G.; Perrot, L.; Mick, V.; Ponsart, C. High-Resolution Melting PCR as Rapid Genotyping Tool for Brucella Species. Microorganisms 2022, 10, 336. [Google Scholar] [CrossRef] [PubMed]
- Cloeckaert, A.; Verger, J.-M.; Grayon, M.; Grépinet, O. Restriction Site Polymorphism of the Genes Encoding the Major 25 KDa and 36 KDa Outer-Membrane Proteins of Brucella. Microbiology 1995, 141, 2111–2121. [Google Scholar] [CrossRef] [PubMed]
- Vizcaíno, N.; Verger, J.-M.; Grayon, M.; Zygmunt, M.S.; Cloeckaert, A. DNA Polymorphism at the Omp-31 Locus of Brucella Spp.: Evidence for a Large Deletion in Brucella abortus, and Other Species-Specific Markers. Microbiology 1997, 143, 2913–2921. [Google Scholar] [CrossRef] [PubMed]
- García-Yoldi, D.; Marín, C.M.; López-Goñi, I. Restriction Site Polymorphisms in the Genes Encoding New Members of Group 3 Outer Membrane Protein Family of Brucella Spp. FEMS Microbiol. Lett. 2005, 245, 79–84. [Google Scholar] [CrossRef] [PubMed]
- Clavareau, C.; Wellemans, V.; Walravens, K.; Tryland, M.; Verger, J.-M.; Grayon, M.; Cloeckaert, A.; Letesson, J.-J.; Godfroid, J. Phenotypic and Molecular Characterization of a Brucella Strain Isolated from a Minke Whale (Balaenoptera acutorostrata). Microbiology 1998, 144, 3267–3273. [Google Scholar] [CrossRef][Green Version]
- Whatmore, A.M.; Perrett, L.L.; MacMillan, A.P. Characterisation of the Genetic Diversity of Brucella by Multilocus Sequencing. BMC Microbiol. 2007, 7, 34. [Google Scholar] [CrossRef]
- Chen, Y.; Zhen, Q.; Wang, Y.; Xu, J.; Sun, Y.; Li, T.; Gao, L.; Guo, F.; Wang, D.; Yuan, X.; et al. Development of an Extended Multilocus Sequence Typing for Genotyping of Brucella Isolates. J. Microbiol. Methods 2011, 86, 252–254. [Google Scholar] [CrossRef]
- Maio, E.; Begeman, L.; Bisselink, Y.; van Tulden, P.; Wiersma, L.; Hiemstra, S.; Ruuls, R.; Gröne, A.; Roest, H.-I.-J.; Willemsen, P.; et al. Identification and Typing of Brucella Spp. in Stranded Harbour Porpoises (Phocoena phocoena) on the Dutch Coast. Vet. Microbiol. 2014, 173, 118–124. [Google Scholar] [CrossRef]
- Ma, J.-Y.; Wang, H.; Zhang, X.-F.; Xu, L.-Q.; Hu, G.-Y.; Jiang, H.; Zhao, F.; Zhao, H.-Y.; Piao, D.-R.; Qin, Y.-M.; et al. MLVA and MLST Typing of Brucella from Qinghai, China. Infect. Dis. Poverty 2016, 5, 21. [Google Scholar] [CrossRef]
- Whatmore, A.M.; Koylass, M.S.; Muchowski, J.; Edwards-Smallbone, J.; Gopaul, K.K.; Perrett, L.L. Extended Multilocus Sequence Analysis to Describe the Global Population Structure of the Genus Brucella: Phylogeography and Relationship to Biovars. Front. Microbiol. 2016, 7, 2049. [Google Scholar] [CrossRef] [PubMed]
- Wattiau, P.; Whatmore, A.M.; van Hessche, M.; Godfroid, J.; Fretin, D. Nucleotide Polymorphism-Based Single-Tube Test for Robust Molecular Identification of All Currently Described Brucella Species. Available online: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3187137/ (accessed on 4 June 2019).
- Burnham, C.-A.D. Automation and Emerging Technology in Clinical Microbiology. In Clinics in Laboratory Medicine; E-Book; Elsevier Health Sciences: Amsterdam, The Netherlands, 2013; ISBN 978-0-323-18861-6. [Google Scholar]
- Bricker, B.J.; Ewalt, D.R.; Halling, S.M. Brucella “HOOF-Prints”: Strain Typing by Multi-Locus Analysis of Variable Number Tandem Repeats (VNTRs). BMC Microbiol. 2003, 3, 15. [Google Scholar] [CrossRef] [PubMed]
- Whatmore, A.M.; Shankster, S.J.; Perrett, L.L.; Murphy, T.J.; Brew, S.D.; Thirlwall, R.E.; Cutler, S.J.; MacMillan, A.P. Identification and Characterization of Variable-Number Tandem-Repeat Markers for Typing of Brucella Spp. J. Clin. Microbiol. 2006, 44, 1982–1993. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Le Flèche, P.; Jacques, I.; Grayon, M.; Al Dahouk, S.; Bouchon, P.; Denoeud, F.; Nöckler, K.; Neubauer, H.; Guilloteau, L.A.; Vergnaud, G. Evaluation and Selection of Tandem Repeat Loci for a Brucella MLVA Typing Assay. BMC Microbiol. 2006, 6, 9. [Google Scholar] [CrossRef] [PubMed]
- Al Dahouk, S.; Flèche, P.L.; Nöckler, K.; Jacques, I.; Grayon, M.; Scholz, H.C.; Tomaso, H.; Vergnaud, G.; Neubauer, H. Evaluation of Brucella MLVA Typing for Human Brucellosis. J. Microbiol. Methods 2007, 69, 137–145. [Google Scholar] [CrossRef]
- García-Yoldi, D.; Fleche, P.L.; Miguel, M.J.D.; Muñoz, P.M.; Blasco, J.M.; Cvetnic, Z.; Marín, C.M.; Vergnaud, G.; López-Goñi, I. Comparison of Multiple-Locus Variable-Number Tandem-Repeat Analysis with Other PCR-Based Methods for Typing Brucella suis Isolates. J. Clin. Microbiol. 2007, 45, 4070–4072. [Google Scholar] [CrossRef]
- Smits, H.L.; Espinosa, B.; Castillo, R.; Hall, E.; Guillen, A.; Zevaleta, M.; Gilman, R.H.; Melendez, P.; Guerra, C.; Draeger, A.; et al. MLVA Genotyping of Human Brucella Isolates from Peru. Trans. R. Soc. Trop. Med. Hyg. 2009, 103, 399–402. [Google Scholar] [CrossRef]
- Jiang, H.; Mao, L.; Zhao, H.; Li, L.; Piao, D.; Yao, W.; Cui, B. MLVA Typing and Antibiotic Susceptibility of Brucella Human Isolates from Liaoning, China. Trans. R. Soc. Trop. Med. Hyg. 2010, 104, 796–800. [Google Scholar] [CrossRef]
- Kılıç, S.; Ivanov, I.N.; Durmaz, R.; Bayraktar, M.R.; Ayaşlıoğlu, E.; Uyanık, M.H.; Alışkan, H.; Yaşar, E.; Bayramoğlu, G.; Arslantürk, A.; et al. Multiple-Locus Variable-Number Tandem-Repeat Analysis Genotyping of Human Brucella Isolates from Turkey. J. Clin. Microbiol. 2011, 49, 3276–3283. [Google Scholar] [CrossRef]
- Tay, B.Y.; Ahmad, N.; Hashim, R.; Mohamed Zahidi, J.; Thong, K.L.; Koh, X.P.; Mohd Noor, A. Multiple-Locus Variable-Number Tandem-Repeat Analysis (MLVA) Genotyping of Human Brucella Isolates in Malaysia. BMC Infect. Dis. 2015, 15, 220. [Google Scholar] [CrossRef]
- De Santis, R.; Ciammaruconi, A.; Faggioni, G.; D’Amelio, R.; Marianelli, C.; Lista, F. Lab on a Chip Genotyping for Brucella spp. Based on 15-Loci Multi Locus VNTR Analysis. BMC Microbiol. 2009, 9, 66. [Google Scholar] [CrossRef]
- De Santis, R.; Ciammaruconi, A.; Faggioni, G.; Fillo, S.; Gentile, B.; Di Giannatale, E.; Ancora, M.; Lista, F. High Throughput MLVA-16 Typing for Brucella Based on the Microfluidics Technology. BMC Microbiol. 2011, 11, 60. [Google Scholar] [CrossRef] [PubMed]
- Garofolo, G.; Ancora, M.; Di Giannatale, E. MLVA-16 Loci Panel on Brucella Spp. Using Multiplex PCR and Multicolor Capillary Electrophoresis. J. Microbiol. Methods 2013, 92, 103–107. [Google Scholar] [CrossRef] [PubMed]
- Huynh, L.Y.; Ert, M.N.V.; Hadfield, T.; Probert, W.S.; Bellaire, B.H.; Dobson, M.; Burgess, R.J.; Weyant, R.S.; Popovic, T.; Zanecki, S.; et al. Multiple Locus Variable Number Tandem Repeat (VNTR) Analysis (MLVA) of Brucella spp. Identifies Species-Specific Markers and Insights into Phylogenetic Relationships. In National Institute of Allergy and Infectious Diseases, NIH; Georgiev, V.S., Western, K.A., McGowan, J.J., Eds.; Humana Press: Totowa, NJ, USA, 2008; pp. 47–54. [Google Scholar]
- Christensen, D.R.; Hartman, L.J.; Loveless, B.M.; Frye, M.S.; Shipley, M.A.; Bridge, D.L.; Richards, M.J.; Kaplan, R.S.; Garrison, J.; Baldwin, C.D. Detection of Biological Threat Agents by Real-Time PCR: Comparison of Assay Performance on the RAPID, the LightCycler, and the Smart Cycler Platforms. Clin. Chem. 2006, 52, 141–145. [Google Scholar] [CrossRef] [PubMed]
- Sidamonidze, K.; Ramishvili, M.; Kalandadze, I.; Tsereteli, D.; Nikolich, M. Epidemiology and Molecular Typing of Brucella Strains Circulating in Georgia. Georgian Med. News 2015, 247, 58–63. [Google Scholar]
| # | Species | Colony Phenotype | Authors and Year of Report | Biovar | Preferential Host(s)/Source | Human Pathogenicity |
|---|---|---|---|---|---|---|
| 1 | B. melitensis | Smooth | Hughes, 1893 | 1–3 | Sheep, goat | High |
| 2 | B. abortus | Smooth | Bang, 1897 | 1–6, 9 | Cattle | High |
| 3 | B. suis | Smooth | Traum, 1914 | 1, 3 | Pig | High |
| 2 | Wild boar, hare | Moderate | ||||
| 4 | Reindeer, caribou | High | ||||
| 5 | Rodent | None | ||||
| 4 | B. ovis | Rough | Buddle, 1956 | - | Sheep | None |
| 5 | B. neotomae | Smooth | Stoenner and Lackman, 1957 | - | Desert wood rat | Moderate |
| 6 | B. canis | Rough | Carmichael and Bruner, 1968 | - | Dog | Moderate |
| 7 | B. ceti | Smooth | Foster et al., 2007 | - | Cetacean | Moderate |
| 8 | B. pinnipedialis | Smooth | Foster et al., 2007 | - | Seal | Moderate |
| 9 | B. microti | Smooth | Sholtz et al., 2008 | - | Vole, fox, soil | No data |
| 10 | B. inopinata | Smooth | Sholtz et al., 2010 | - | Human | Moderate |
| 11 | B. papionis | Smooth | Whatmore et al., 2014 | - | Baboon | No data |
| 12 | B. vulpis | Smooth | Sholtz et al., 2016 | - | Red fox | No data |
| # | Genus | # | Genus | # | Genus | # | Genus | # | Genus |
|---|---|---|---|---|---|---|---|---|---|
| 1 | Acinetobacter | 15 | Campylobacter | 29 | Francisella | 43 | Neisseria | 57 | Rhodococcus |
| 2 | Actinobacillus | 16 | Candida | 30 | Haemophilus | 44 | Nicoletella | 58 | Rhodospirillum |
| 3 | Actinomyces | 17 | Capnocytophaga | 31 | Helicobacter | 45 | Ochrobactrum | 59 | Roseomonas |
| 4 | Aeromonas | 18 | Cardiobacterium | 32 | Histophilus | 46 | Oligella | 60 | Salmonella |
| 5 | Afipia | 19 | Chlamydia | 33 | Kingella | 47 | Paenochrobactrum | 61 | Serratia |
| 6 | Agrobacterium | 20 | Citrobacter | 34 | Klebsiella | 48 | Paracoccus | 62 | Shigella |
| 7 | Arcanobacterium | 21 | Clostridium | 35 | Lactobacillus | 49 | Pasteurella | 63 | Sinorhizobium |
| 8 | Arcobacter | 22 | Corynebacterium | 36 | Listeria | 50 | Phyllobacterium | 64 | Staphylococcus |
| 9 | Bacillus | 23 | Coxiella | 37 | Mannheimia | 51 | Proteus | 65 | Stenotrophomonas |
| 10 | Bartonella | 24 | Edwardsiella | 38 | Mesorhizobium | 52 | Pseudochrobactrum | 66 | Streptococcus |
| 11 | Bordetella | 25 | Eikenella | 39 | Moraxella | 53 | Pseudomonas | 67 | Vibrio |
| 12 | Bradyrhizobium | 26 | Enterobacter | 40 | Mycobacterium | 54 | Psychrobacter | 68 | Wolbachia |
| 13 | Brevibacillus | 27 | Enterococcus | 41 | Mycoplana | 55 | Ralstonia | 69 | Xanthomonas |
| 14 | Burkholderia | 28 | Escherichia | 42 | Mycoplasma | 56 | Rhizobium | 70 | Yersinia |
| Index | Assays, Authors | Primer/Probe | Sequence (5′-3′) | Target | Encoded Product | Restriction Enzymes Used |
|---|---|---|---|---|---|---|
| A21 | PCR-RFLP, Cloeckaert et al. [84] | 25A | GGACCGCGCAAAACGTAATT | omp25 | Outer membrane proteins | AluI, BanI, BglII, ClaI, EcoRI, HaeIII, HinfI, KpnI, NcoI, PstI, PvuII, StyI, TaqI |
| 25B | ACCGGATGCCTGAAATCCTT | |||||
| 2aA | GGCTATTCAAAATTCTGGCG | omp2a | ||||
| 2aB | ATCGATTCTCACGCTTTCGT | |||||
| 2bA | CCTTCAGCCAAATCAGAATG | omp2b | ||||
| 2bB | GGTCAGCATAAAAAGCAAGC | |||||
| A22 | PCR-RFLP, Vizcaino et al. [85] | 31st | TGACAGACTTTTTCGCCGAA | omp31 | 31 kDa Outer-membrane proteins | AvaII, BanI, HaeII, HaeIII, KpnI, PvuII, RsaI, SalI, Sau3AI, StyI |
| 31ter | CATTCAGGACAATTCCCGCC | |||||
| A23 | PCR-RFLP, García-Yoldi et al. [86] | 22F | CGCGCTGATATCGACATGAC | omp22 | Outer-membrane proteins | DdeI, Hpy188I, DdeI, HinfI, DdeI, BsmI, HinfI, EcoRV, and other enzymes |
| 22R | CCCGGCTGTTACATATGCTG | |||||
| 25cdF | CCGCCTGCTGTGTCCTGTTT | omp25cd | ||||
| 25cdR | GGCCGCGAAATAGACCAGAA | |||||
| 25bF1 | CGGGCCGCTTTTTTACTGTT | omp25b | ||||
| 25bR1 | GTGCGCCGCCGTTCTAATTC | |||||
| 31bF | CGTCGCCTTCCTGTCATC | omp31b | ||||
| 31bR | GCCGCAGTTCAATGATGT |
| Assays, Authors | Primer Pair | Oligo Type | Sequence (5′-3′) | Gene/Locus | Encoded Product | Amplicon Size |
|---|---|---|---|---|---|---|
| MLSA-9 assay, Whatmore et al. [88] | 1 | F-primer | YGCCAAGCGCGTCATCGT | gap | Glyceraldehydes 3-phosphate dehydrogenase | 589 bp |
| R-primer | GCGGYTGGAGAAGCCCCA | |||||
| 2 | F-primer | GACCATCGACGTGCCGGG | aroA | 3-phosphoshikimate 1-carboxyvinyltransferase | 565 bp | |
| R-primer | YCATCAKGCCCATGAATTC | |||||
| 3 | F-primer | TATGGAAMAGATCGGCGG | glk | Glucokinase | 475 bp | |
| R-primer | GGGCCTTGTCCTCGAAGG | |||||
| 4 | F-primer | CGTCTGGTCGAATATCTGG | dnaK | Chaperone protein | 470 bp | |
| R-primer | GCGTTTCAATGCCGAGCGA | |||||
| 5 | F-primer | ATGATTTCATCCGATCAGGT | gyrB | DNA gyrase B subunit | 469 bp | |
| R-primer | CTGTGCCGTTGCATTGTC | |||||
| 6 | F-primer | GCGCGCMTGGTATGGCG | trpE | Anthranilate synthase | 486 bp | |
| R-primer | CKCSCCGCCATAGGCTTC | |||||
| 7 | F-primer | GCGGGTTTCAAATGCTTGGA | cobQ | Cobyric acid synthase | 422 bp | |
| R-primer | GGCGTCAATCATGCCAGC | |||||
| 8 | F-primer | ATGCGCACTCTTAAGTCTC | omp25 | 25 kDa outer-membrane protein | 490 bp | |
| R-primer | GCCSAGGATGTTGTCCGT | |||||
| 9 | F-primer | CAACTACTCTGTTGACCCGA | int-hyp | Upstream and extreme 5′ of hypothetical protein (BruAb1_1395) | 430 bp | |
| R-primer | GCAGCATCATAGCGACGGA | |||||
| MLSA-21 assay, Whatmore et al. [92] (only 12 new primers are shown) | 10 | F-primer | GGTGCTGTTCACGCTGGAA | prpE | Propionate-CoA ligase | 468 bp |
| R-primer | AGGTTTTCGCAGGCGGCGAA | |||||
| 11 | F-primer | TGTGTTCGGCAAGCCTTTG | caiA | Acyl-CoA dehydrogenase | 449 bp | |
| R-primer | GGTCAAAAGACGTGCCACA | |||||
| 12 | F-primer | CGTCACTTCCTGGATCATTTC | csdB | Cysteine desulfhydrase | 487 bp | |
| R-primer | GCCACCGACGCTTATGAGAA | |||||
| 13 | F-primer | CCTCGTAAAGCGCCTTCC | soxA | Sarcosine oxidase alpha subunit | 486 bp | |
| R-primer | TGTTCGATGCCTCCACATTGG | |||||
| 14 | F-primer | TCAACCGGATGAAGGAAGTC | leuA | 2-isopropylmalate synthase | 482 bp | |
| R-primer | CCCTCGATAGTCTTGGTGACA | |||||
| 15 | F-primer | ATCGCCCGTTCGGTGAC | mviM | Glucose-fructose oxidoreductase precursor | 447 bp (size variants identified at these loci) | |
| R-primer | TGTTCGCCGTCCTTGTCC | |||||
| 16 | F-primer | CGACCATGTCAATATGAGCC | fumC | Fumarate hydratase C | 452 bp | |
| R-primer | GATATCGTTGGCGATCTTGAA | |||||
| 17 | F-primer | CGTGAAATAACCTGATCTCAC | fbaA | Fructose-bisphosphate aldolase | 458 bp | |
| R-primer | CATGCCGGTTTCAAGCGAAC | |||||
| 18 | F-primer | TTTCAGTGCGCTCGAACAG | ddlA | D-alanine-D-alanine ligase A | 553 bp | |
| R-primer | GTTCTTCAATGATGAGATTAAA | |||||
| 19 | F-primer | GTGGGCGTGCAGCCTTTCG | putA | Proline dehydrogenase | 527 bp | |
| R-primer | CCTGTGTGAGTACGAGCGG | |||||
| 20 | F-primer | ACATCCAAGCTGACCGAC | mutL | DNA mismatch repair protein | 549 bp | |
| R-primer | TCCCGTGCGATCACATCCGA | |||||
| 21 | F-primer | GAAGGCCGCATCCCACTG | acnA | Aconitate hydratase | 490 bp | |
| R-primer | GCGGCGAGGCAAGGTAAT |
| Index | Assays, Authors | Primer/Probe | Sequence (5′-3′) | Target | Encoded Product | Amplicon Size |
|---|---|---|---|---|---|---|
| A26 | LCR assay, Wattiau et al. [93] | UR a | GACGATGAGTCCTGAGTAA | — | N/A | — |
| UF b | CCGAGATGTACCGCTATCGT | — | N/A | — | ||
| cUR c | TTACTCAGGACTCATCCTC | — | N/A | — | ||
| PLP-A | GCCGACAAGATCACGCCCA-cUR-AA-UF-CTGGGCATCTGCGCG | glk-1403G | glucokinase | 73 bp | ||
| PLP-B | GACACGCCCTTCGATGCGT-cUR-AA-UF-AGAATTTGCTCGCCGGC | glk-1344G | glucokinase | 75 bp | ||
| PLP-C | CCAGACGGGCGCCAAG-cUR-AA-UF-CATACGCTTGCCAATTATTTCCA | trpE-2858A | anthranilate synthase | 78 bp | ||
| PLP-D | TAGCCAAGGTAAAGACCGGTATAGCC-cUR-AA-UF-GGCCTTGTTCCAGCCA | omp25-3627A | 25 kDa outer-membrane protein | 81 bp | ||
| PLP-E | AAGCCTCGCTGGATATTGATGGC-cUR-TT-UF-ATTATCTGGCTGAAGGGCTGA | cobQ-3445A | cobyric acid synthase | 83 bp | ||
| PLP-F | GCGGCGTTTATCTTTCGGGTAGCTA-cUR-AA-UF-GCTCATTTTCATGGCGCATA | glk-1557A | glucokinase | 84 bp | ||
| PLP-G | ACCCGCACCGGCCTG-cUR-AA-UF-TGATACTACTATGCAATGTGCTGATGAACCCA | aroA-677A | 3-phosphoshikimate 1-carboxyvinyltransferase | 86 bp | ||
| PLP-H | CATCGACCTGAAGAACGACAAGC-cUR-TT-UF-TATCCGAGTTCAAGAAGGAAAGTGA | dnaK-1654A | chaperone protein | 87 bp | ||
| PLP-I | GCCTTCAATAGCGCGCGC-cUR-AA-UF-CGTCGCGTTAGACAGCTCATGGCCACCCGCC | ptsP-1677G | phosphoenolpyruvate-protein phosphotransferase | 88 bp | ||
| PLP-J | CACCAGCGGGCCGGA-cUR-AA-UF-TAGTCACATATCATGCTATGAAATCCACATCGGGCA | cobQ-3224A | cobyric acid synthase | 90 bp | ||
| PLP-K | TTCTCGATCGCGGGC-cUR-AA-UF-GGTTCGCTTACGTTGCATAGTGCTCACCCACAAGGAAG | pyrH-817G | uridylate kinase | 92 bp | ||
| PLP-L | ACCAGAACCACTTCGTCAATTTCG-cUR-AA-UF-ATCCGGTCTCATCGCTGAATGGTCATGCCGCCA | dnaK-1928T | chaperone protein | 96 bp | ||
| PLP-M | GTTTCGATCCTGCTGGTCGATCA-cUR-T-UF-ATGGTCGCCTATACTTATATCAAAGGTGGCTGAGGGA | trpE-2796A | anthranilate synthase | 99 bp | ||
| PLP-N | CTGGAAGTTCCAGCCAGCAAACG-cUR-AA-UF-CGATCCGATTACAGGCCGATCCGTATACGATCTGGTCCTT | omp25-3715A | 25 kDa outer-membrane protein | 102 bp | ||
| PLP-O | ACTGTCCGCAAGCTTCAAGC-cUR-TT-UF-AAAATTTAACGTTCCTAAAGCTGAGTCTGCCCGGCCATTATGGTG | IS711 | transposasa | 104 bp | ||
| PLP-P | ATGAATGCCGTCAGCGCG-cUR-TT-UF-ATTTGACGAACGTATGCCGCTTAACTCAAATCATCCACCGAAGTTGGATGTTA | rpoB-265A | DNA-directed RNA polymerase beta chain | 110 bp |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kurmanov, B.; Zincke, D.; Su, W.; Hadfield, T.L.; Aikimbayev, A.; Karibayev, T.; Berdikulov, M.; Orynbayev, M.; Nikolich, M.P.; Blackburn, J.K. Assays for Identification and Differentiation of Brucella Species: A Review. Microorganisms 2022, 10, 1584. https://doi.org/10.3390/microorganisms10081584
Kurmanov B, Zincke D, Su W, Hadfield TL, Aikimbayev A, Karibayev T, Berdikulov M, Orynbayev M, Nikolich MP, Blackburn JK. Assays for Identification and Differentiation of Brucella Species: A Review. Microorganisms. 2022; 10(8):1584. https://doi.org/10.3390/microorganisms10081584
Chicago/Turabian StyleKurmanov, Berzhan, Diansy Zincke, Wanwen Su, Ted L. Hadfield, Alim Aikimbayev, Talgat Karibayev, Maxat Berdikulov, Mukhit Orynbayev, Mikeljon P. Nikolich, and Jason K. Blackburn. 2022. "Assays for Identification and Differentiation of Brucella Species: A Review" Microorganisms 10, no. 8: 1584. https://doi.org/10.3390/microorganisms10081584
APA StyleKurmanov, B., Zincke, D., Su, W., Hadfield, T. L., Aikimbayev, A., Karibayev, T., Berdikulov, M., Orynbayev, M., Nikolich, M. P., & Blackburn, J. K. (2022). Assays for Identification and Differentiation of Brucella Species: A Review. Microorganisms, 10(8), 1584. https://doi.org/10.3390/microorganisms10081584

