Heterologous Expression of the Pathogen-Specific LIC11711 Gene in the Saprophyte L. biflexa Increases Bacterial Binding to Laminin and Plasminogen
Abstract
:1. Introduction
2. Results
2.1. P32LIC11711 Genetic Fusion and Plasmid Construction
2.2. Heterologous Expression of LIC11711 under lipL32 Promoter in L. biflexa
2.3. LIC11711 Localization in L. biflexa by ELISA
2.4. L. biflexa-LIC11711 Adhesion to Lam
2.5. L. biflexa-LIC11711 Shows Enhanced Binding to Plg/Pla System
2.6. Heterologous Expression of LIC11711 in L. biflexa Is Not Sufficient to Provide Serum Resistance
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Culture Conditions
4.2. Genetic Fusion and Plasmid Construction
4.3. L. biflexa Transformation
4.4. RNA Extraction and Real-Time Reverse Transcriptase Quantitative PCR (RT-qPCR)
4.5. Polyclonal Antiserum Production
4.6. Validation of LIC11711 Expression in L. biflexa by Western Blotting
4.7. LIC11711 Localization in L. biflexa by ELISA Using Intact and Lysed Cells
4.8. Binding Assays
4.9. Pla Generation by L. biflexa-LIC11711-Bound Plg
4.10. Serum Resistance Assay
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Ethics Approval
References
- Costa, F.; Hagan, J.E.; Calcagno, J.; Kane, M.; Torgerson, P.; Martinez-Silveira, M.S.; Stein, C.; Abela-Ridder, B.; Ko, A.I. Global Morbidity and Mortality of Leptospirosis: A Systematic Review. PLoS Negl. Trop. Dis. 2015, 9, e0003898. [Google Scholar] [CrossRef] [PubMed]
- Goarant, C. Leptospirosis: Risk factors and management challenges in developing countries. Res. Rep. Trop. Med. 2016, 7, 49–62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Levett, P.N. Leptospirosis. Clin. Microbiol. Rev. 2001, 14, 296–326. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bharti, A.R.; Nally, J.E.; Ricaldi, J.N.; Matthias, M.A.; Diaz, M.M.; Lovett, M.A.; Levett, P.N.; Gilman, R.H.; Willig, M.R.; Gotuzzo, E.; et al. Leptospirosis: A zoonotic disease of global importance. Lancet Infect. Dis. 2003, 3, 757–771. [Google Scholar] [CrossRef]
- Gouveia, E.L.; Metcalfe, J.; de Carvalho, A.L.; Aires, T.S.; Villasboas-Bisneto, J.C.; Queirroz, A.; Santos, A.C.; Salgado, K.; Reis, M.G.; Ko, A.I. Leptospirosis-associated severe pulmonary hemorrhagic syndrome, Salvador, Brazil. Emerg. Infect. Dis. 2008, 14, 505–508. [Google Scholar] [CrossRef]
- Cinco, M. New insights into the pathogenicity of leptospires: Evasion of host defences. New Microbiol. 2010, 33, 283–292. [Google Scholar]
- Vieira, M.L.; Fernandes, L.G.; Domingos, R.F.; Oliveira, R.; Siqueira, G.H.; Souza, N.M.; Teixeira, A.R.; Atzingen, M.V.; Nascimento, A.L. Leptospiral extracellular matrix adhesins as mediators of pathogen-host interactions. FEMS Microbiol. Lett. 2014, 352, 129–139. [Google Scholar] [CrossRef] [Green Version]
- Fernandes, L.G.; Siqueira, G.H.; Teixeira, A.R.; Silva, L.P.; Figueredo, J.M.; Cosate, M.R.; Vieira, M.L.; Nascimento, A.L. Leptospira spp.: Novel insights into host-pathogen interactions. Vet. Immunol. Immunopathol. 2016, 176, 50–57. [Google Scholar] [CrossRef]
- Saint Girons, I.; Bourhy, P.; Ottone, C.; Picardeau, M.; Yelton, D.; Hendrix, R.W.; Glaser, P.; Charon, N. The LE1 bacteriophage replicates as a plasmid within Leptospira biflexa: Construction of an L. biflexa-Escherichia coli shuttle vector. J. Bacteriol. 2000, 182, 5700–5705. [Google Scholar] [CrossRef] [Green Version]
- Pappas, C.J.; Benaroudj, N.; Picardeau, M. A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains. Appl. Environ. Microbiol. 2015, 81, 3176–3181. [Google Scholar] [CrossRef] [Green Version]
- Bourhy, P.; Louvel, H.; Saint Girons, I.; Picardeau, M. Random insertional mutagenesis of Leptospira interrogans, the agent of leptospirosis, using a mariner transposon. J. Bacteriol. 2005, 187, 3255–3258. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Murray, G.L.; Morel, V.; Cerqueira, G.M.; Croda, J.; Srikram, A.; Henry, R.; Ko, A.I.; Dellagostin, O.A.; Bulach, D.M.; Sermswan, R.W.; et al. Genome-wide transposon mutagenesis in pathogenic Leptospira species. Infect. Immun. 2009, 77, 810–816. [Google Scholar] [CrossRef] [Green Version]
- Bauby, H.; Saint Girons, I.; Picardeau, M. Construction and complementation of the first auxotrophic mutant in the spirochaete Leptospira meyeri. Microbiology 2003, 149, 689–693. [Google Scholar] [CrossRef] [Green Version]
- Fernandes, L.G.V.; Guaman, L.P.; Vasconcellos, S.A.; Heinemann, M.B.; Picardeau, M.; Nascimento, A.L.T.O. Gene silencing based on RNA-guided catalytically inactive Cas9 (dCas9): A new tool for genetic engineering in Leptospira. Sci. Rep. 2019, 9, 1839. [Google Scholar] [CrossRef] [PubMed]
- Adler, B. Pathogenesis of leptospirosis: Cellular and molecular aspects. Vet. Microbiol. 2014, 172, 353–358. [Google Scholar] [CrossRef] [PubMed]
- Malmström, J.; Beck, M.; Schmidt, A.; Lange, V.; Deutsch, E.W.; Aebersold, R. Proteome-wide cellular protein concentrations of the human pathogen Leptospira interrogans. Nature 2009, 460, 762–765. [Google Scholar] [CrossRef] [Green Version]
- Figueira, C.P.; Croda, J.; Choy, H.A.; Haake, D.A.; Reis, M.G.; Ko, A.I.; Picardeau, M. Heterologous expression of pathogen-specific genes ligA and ligB in the saprophyte Leptospira biflexa confers enhanced adhesion to cultured cells and fibronectin. BMC Microbiol. 2011, 11, 129. [Google Scholar] [CrossRef] [Green Version]
- Zhang, L.; Zhang, C.; Ojcius, D.M.; Sun, D.; Zhao, J.; Lin, X.; Li, L.; Yan, J. The mammalian cell entry (Mce) protein of pathogenic Leptospira species is responsible for RGD motif-dependent infection of cells and animals. Mol. Microbiol. 2012, 83, 1006–1023. [Google Scholar] [CrossRef]
- Toma, C.; Murray, G.L.; Nohara, T.; Mizuyama, M.; Koizumi, N.; Adler, B.; Suzuki, T. Leptospiral outer membrane protein LMB216 is involved in enhancement of phagocytic uptake by macrophages. Cell. Microbiol. 2014, 16, 1366–1377. [Google Scholar] [CrossRef] [PubMed]
- Picardeau, M.; Bulach, D.M.; Bouchier, C.; Zuerner, R.L.; Zidane, N.; Wilson, P.J.; Creno, S.; Kuczek, E.S.; Bommezzadri, S.; Davis, J.C.; et al. Genome sequence of the saprophyte Leptospira biflexa provides insights into the evolution of Leptospira and the pathogenesis of leptospirosis. PLoS ONE 2008, 3, e1607. [Google Scholar] [CrossRef] [Green Version]
- Faine, S.; Adler, B.; Bolin, C.; Perolat, P. Leptospira and Leptospirosis, 2nd ed.; MediSci: Melbourne, Australia, 1999; p. 272. [Google Scholar]
- Louvel, H.; Picardeau, M. Genetic manipulation of Leptospira biflexa. Curr. Protoc. Microbiol. 2007, Unit 12E, 4. [Google Scholar] [CrossRef]
- Adhikarla, H.; Wunder, E.A.; Mechaly, A.E.; Mehta, S.; Wang, Z.; Santos, L.; Bisht, V.; Diggle, P.; Murray, G.; Adler, B.; et al. Lvr, a Signaling System That Controls Global Gene Regulation and Virulence in Pathogenic. Front. Cell. Infect. Microbiol. 2018, 8, 45. [Google Scholar] [CrossRef] [PubMed]
- Fouts, D.E.; Matthias, M.A.; Adhikarla, H.; Adler, B.; Amorim-Santos, L.; Berg, D.E.; Bulach, D.; Buschiazzo, A.; Chang, Y.-F.; Galloway, R.L.; et al. What Makes a Bacterial Species Pathogenic?Comparative Genomic Analysis of the Genus Leptospira. PLoS Negl. Trop. Dis. 2016, 10, e0004403. [Google Scholar] [CrossRef] [Green Version]
- Kochi, L.T.; Fernandes, L.G.V.; Souza, G.O.; Vasconcellos, S.A.; Heinemann, M.B.; Romero, E.C.; Kirchgatter, K.; Nascimento, A.L.T.O. The interaction of two novel putative proteins of Leptospira interrogans with E-cadherin, plasminogen and complement components with potential role in bacterial infection. Virulence 2019, 10, 734–753. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haake, D.A.; Chao, G.; Zuerner, R.L.; Barnett, J.K.; Barnett, D.; Mazel, M.; Matsunaga, J.; Levett, P.N.; Bolin, C.A. The leptospiral major outer membrane protein LipL32 is a lipoprotein expressed during mammalian infection. Infect. Immun 2000, 68, 2276–2285. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ballard, S.A.; Go, M.; Segers, R.P.; Adler, B. Molecular analysis of the dnaK locus of Leptospira interrogans serovar Copenhageni. Gene 1998, 216, 21–29. [Google Scholar] [CrossRef]
- Vieira, M.L.; Vasconcellos, S.A.; Gonçales, A.P.; de Morais, Z.M.; Nascimento, A.L. Plasminogen acquisition and activation at the surface of leptospira species lead to fibronectin degradation. Infect. Immun. 2009, 77, 4092–4101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Picardeau, M. Toolbox of Molecular Techniques for Studying Leptospira spp. Curr. Top. Microbiol. Immunol. 2018, 415, 141–162. [Google Scholar] [CrossRef] [PubMed]
- Atzingen, M.V.; Barbosa, A.S.; De Brito, T.; Vasconcellos, S.A.; de Morais, Z.M.; Lima, D.M.; Abreu, P.A.; Nascimento, A.L. Lsa21, a novel leptospiral protein binding adhesive matrix molecules and present during human infection. BMC Microbiol. 2008, 8, 70. [Google Scholar] [CrossRef] [Green Version]
- Domingos, R.F.; Fernandes, L.G.; Romero, E.C.; de Morais, Z.M.; Vasconcellos, S.A.; Nascimento, A.L. Novel Leptospira interrogans protein Lsa32 is expressed during infection and binds laminin and plasminogen. Microbiology 2015, 161, 851–864. [Google Scholar] [CrossRef]
- Oliveira, R.; de Morais, Z.M.; Gonçales, A.P.; Romero, E.C.; Vasconcellos, S.A.; Nascimento, A.L. Characterization of novel OmpA-like protein of Leptospira interrogans that binds extracellular matrix molecules and plasminogen. PLoS ONE 2011, 6, e21962. [Google Scholar] [CrossRef] [Green Version]
- Ljungh, A.; Moran, A.P.; Wadström, T. Interactions of bacterial adhesins with extracellular matrix and plasma proteins: Pathogenic implications and therapeutic possibilities. FEMS Immunol. Med. Microbiol. 1996, 16, 117–126. [Google Scholar] [CrossRef]
- Collen, D.; Lijnen, H.R. The fibrinolytic system in man. Crit. Rev. Oncol. Hematol. 1986, 4, 249–301. [Google Scholar] [CrossRef]
- Vieira, M.L.; Nascimento, A.L. Interaction of spirochetes with the host fibrinolytic system and potential roles in pathogenesis. Crit. Rev. Microbiol. 2016, 42, 573–587. [Google Scholar] [CrossRef]
- Cavenague, M.F.; Teixeira, A.F.; Filho, A.S.; Souza, G.O.; Vasconcellos, S.A.; Heinemann, M.B.; Nascimento, A.L.T.O. Characterization of a novel protein of Leptospira interrogans exhibiting plasminogen, vitronectin and complement binding properties. Int. J. Med. Microbiol. 2019, 309, 116–129. [Google Scholar] [CrossRef] [PubMed]
- Siqueira, G.H.; Teixeira, A.F.; Fernandes, L.G.; de Souza, G.O.; Kirchgatter, K.; Romero, E.C.; Vasconcellos, S.A.; Vieira, M.L.; Nascimento, A.L. The recombinant LIC10508 is a plasma fibronectin, plasminogen, fibrinogen and C4BP-binding protein of Leptospira interrogans. Pathog. Dis. 2016, 74, ftv118. [Google Scholar] [CrossRef] [Green Version]
- Fernandes, L.G.; Vieira, M.L.; Kirchgatter, K.; Alves, I.J.; de Morais, Z.M.; Vasconcellos, S.A.; Romero, E.C.; Nascimento, A.L. OmpL1 is an extracellular matrix- and plasminogen-interacting protein of Leptospira spp. Infect. Immun. 2012, 80, 3679–3692. [Google Scholar] [CrossRef] [Green Version]
- Vieira, M.L.; Atzingen, M.V.; Oliveira, R.; Mendes, R.S.; Domingos, R.F.; Vasconcellos, S.A.; Nascimento, A.L. Plasminogen binding proteins and plasmin generation on the surface of Leptospira spp.: The contribution to the bacteria-host interactions. J. Biomed. Biotechnol. 2012, 2012, 758513. [Google Scholar] [CrossRef] [Green Version]
- Santos, J.V.; Pereira, P.R.M.; Fernandes, L.G.V.; Siqueira, G.H.; de Souza, G.O.; Souza Filho, A.; Vasconcellos, S.A.; Heinemann, M.B.; Chapola, E.G.B.; Nascimento, A.L.T.O. Binding of human plasminogen by the lipoprotein LipL46 of Leptospira interrogans. Mol. Cell. Probes 2018, 37, 12–21. [Google Scholar] [CrossRef]
- Vieira, M.L.; Alvarez-Flores, M.P.; Kirchgatter, K.; Romero, E.C.; Alves, I.J.; de Morais, Z.M.; Vasconcellos, S.A.; Chudzinski-Tavassi, A.M.; Nascimento, A.L.T.O. Interaction of Leptospira interrogans with human proteolytic systems enhances dissemination through endothelial cells and protease levels. Infect. Immun. 2013, 81, 1764–1774. [Google Scholar] [CrossRef] [Green Version]
- Caimano, M.J.; Sivasankaran, S.K.; Allard, A.; Hurley, D.; Hokamp, K.; Grassmann, A.A.; Hinton, J.C.; Nally, J.E. A model system for studying the transcriptomic and physiological changes associated with mammalian host-adaptation by Leptospira interrogans serovar Copenhageni. PLoS Pathog. 2014, 10, e1004004. [Google Scholar] [CrossRef]
- Adler, B.; Lo, M.; Seemann, T.; Murray, G.L. Pathogenesis of leptospirosis: The influence of genomics. Vet. Microbiol. 2011, 153, 73–81. [Google Scholar] [CrossRef]
- Castiblanco-Valencia, M.M.; Fraga, T.R.; Silva, L.B.; Monaris, D.; Abreu, P.A.; Strobel, S.; Józsi, M.; Isaac, L.; Barbosa, A.S. Leptospiral immunoglobulin-like proteins interact with human complement regulators factor H, FHL-1, FHR-1, and C4BP. J. Infect. Dis. 2012, 205, 995–1004. [Google Scholar] [CrossRef] [PubMed]
- Siqueira, G.H.; Atzingen, M.V.; de Souza, G.O.; Vasconcellos, S.A.; Nascimento, A.L. Leptospira interrogans Lsa23 protein recruits plasminogen, factor H and C4BP from normal human serum and mediates C3b and C4b degradation. Microbiology 2016, 162, 295–308. [Google Scholar] [CrossRef]
- Castiblanco-Valencia, M.M.; Fraga, T.R.; Breda, L.C.; Vasconcellos, S.A.; Figueira, C.P.; Picardeau, M.; Wunder, E.; Ko, A.I.; Barbosa, A.S.; Isaac, L. Acquisition of negative complement regulators by the saprophyte Leptospira biflexa expressing LigA or LigB confers enhanced survival in human serum. Immunol. Lett. 2016, 173, 61–68. [Google Scholar] [CrossRef]
- Siqueira, G.H.; de Souza, G.O.; Heinemann, M.B.; Vasconcellos, S.A.; Nascimento, A.L.T.O. The role of Lsa23 to mediate the interaction of Leptospira interrogans with the terminal complement components pathway. Microb. Pathog. 2017, 112, 182–189. [Google Scholar] [CrossRef]
- Ellinghausen, H.C.; McCullough, W.G. Nutrition of leptospira pomona and growth of 13 other serotypes: A serum-free medium employing oleic albumin complex. Am. J. Vet. Res. 1965, 26, 39–44. [Google Scholar]
- Demarre, G.; Guérout, A.M.; Matsumoto-Mashimo, C.; Rowe-Magnus, D.A.; Marlière, P.; Mazel, D. A new family of mobilizable suicide plasmids based on broad host range R388 plasmid (IncW) and RP4 plasmid (IncPalpha) conjugative machineries and their cognate Escherichia coli host strains. Res. Microbiol. 2005, 156, 245–255. [Google Scholar] [CrossRef]
- Kammann, M.; Laufs, J.; Schell, J.; Gronenborn, B. Rapid insertional mutagenesis of DNA by polymerase chain reaction (PCR). Nucleic Acids Res. 1989, 17, 5404. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Picardeau, M. Virulence of the zoonotic agent of leptospirosis: Still terra incognita? Nat. Rev. Microbiol. 2017, 15, 297–307. [Google Scholar] [CrossRef] [PubMed]
Oligonucleotide | Sequence (5′→3′) | Restriction Site |
---|---|---|
P32 F | GAGCTCGAACAAGAAAGAGTCAGAG | SacI |
P32-lic11711 R | GGATTTTGATTTTATAGCCGACATAGACTCTCCTTAGTTAG | |
lic11711 R | GCGGCCGCTTATTTTCTGCGAATCACTTC | NotI |
pMaOri F | AGTGACACAGGAACACTTAACG | |
pMaOri R | TATATTCTGTCCACATTTGTGG | |
qPCRlic11711 F | AAAGGGGGAGACGTTTTGAT | |
qPCRlic11711 R | CGTTTCAAATGCTCCCGTAT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kochi, L.T.; Fernandes, L.G.V.; Nascimento, A.L.T.O. Heterologous Expression of the Pathogen-Specific LIC11711 Gene in the Saprophyte L. biflexa Increases Bacterial Binding to Laminin and Plasminogen. Pathogens 2020, 9, 599. https://doi.org/10.3390/pathogens9080599
Kochi LT, Fernandes LGV, Nascimento ALTO. Heterologous Expression of the Pathogen-Specific LIC11711 Gene in the Saprophyte L. biflexa Increases Bacterial Binding to Laminin and Plasminogen. Pathogens. 2020; 9(8):599. https://doi.org/10.3390/pathogens9080599
Chicago/Turabian StyleKochi, Leandro Toshio, Luis Guilherme Virgílio Fernandes, and Ana Lucia Tabet Oller Nascimento. 2020. "Heterologous Expression of the Pathogen-Specific LIC11711 Gene in the Saprophyte L. biflexa Increases Bacterial Binding to Laminin and Plasminogen" Pathogens 9, no. 8: 599. https://doi.org/10.3390/pathogens9080599