Effects of Body Condition and Ectoparasitism on Host–Pathogen Interactions of Heteromyid Rodents
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Approval and Informed Consent
2.2. Study Area and Samples
- (a)
- Ejido Villa Luz is situated in the northern region of APFFMS. Within the ejido, various anthropogenic activities occur, including agriculture, livestock grazing, and even tourism. This area is part of the municipality of Juárez, Chihuahua, and comprises 619 households with a population of 1577 residents [20].
- (b)
- Rancho Las Palmas is within the influence area of the APFFMS, as it is situated adjacent to the southeastern part of the protected area. This ranch, dedicated primarily to cattle, is privately owned, with restricted human mobility, and there are only two houses in the area [20].
- (c)
- Finally, Ejido Ley Seis de Enero is situated in the northern part of the state of Chihuahua, 125 km west of APFFMS. It falls within the municipality of Ascensión, Chihuahua, and comprises 297 households with a population of 671 residents [20].

2.3. Trapping and Sampling
2.4. Rodent Euthanasia and Necropsy
2.5. Ectoparasite Identification
2.6. DNA Extraction from Ectoparasites and Rodent Blood and Organ Samples
2.7. PCR Amplification and Sequencing
| Pathogen | Oligonucleotide Sequence (5′-3′) | PCR Protocol | Reference |
|---|---|---|---|
| Rickettsia spp. | gltAF: GCAAGTATCGGTGAGGATGTAAT gltAR: GCTTCCTTAAAATTCAATAAATCAGGAT | Initial denaturation: 95 °C for 5 min, followed by 35 cycles, each consisting of: 95 °C for 30 s, 58 °C for 30 s, 65 °C for 45 s, and final extension at 72 °C for 7 min. | [31] |
| Yersinia pestis (pla) | Yp1: ATCTTACTTTCCGTGAGAAG Yp2: CTTGGATGTTGAGCTTCCTA | Initial denaturation 95 °C for 5 min, followed by 35 cycles, each consisting of 95 °C for 1 min, 56 °C for 1 min, 72 °C for 1 min, and final extension at 72 °C for 10 min. | [30] |
| Francisella tularensis (fopA) | FNA7L-F: CTTGAGTCTTATGTTTCGGCATGTGAATAG FNB1L-R: CCAACTAATTGGTTGTACTGTACAGCGAAG | Initial denaturation 94 °C for 5 min, followed by 20 cycles, each consisting of 95 °C for 10 s, 62 °C for 10 s, 72 °C for 10 s, and final extension at 72 °C for 5 min. | [32] |
2.8. Data Analysis and Ectoparasite and Rodent Statistical Model
3. Results
3.1. Host Rodent Species
3.2. Presence and Morphological Identification of Ectoparasites Found in Rodents
3.3. Prevalence of Tick-Borne Pathogens in Rodents
3.4. Prevalence of Tick-Borne Pathogens on Ectoparasites
3.5. Intrinsic and Extrinsic Factors Related to Pathogen Infection
3.6. Ectoparasite and Rodent Statistitcal Model
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dahmana, H.; Granjon, L.; Diagne, C.; Davoust, B.; Fenollar, F.; Mediannikov, O. Rodents as Hosts of Pathogens and Related Zoonotic Disease Risk. Pathogens 2020, 9, 202. [Google Scholar] [CrossRef] [PubMed]
- Han, B.A.; Schmidt, J.P.; Bowden, S.E.; Drake, J.M. Rodent reservoirs of future zoonotic diseases. Proc. Natl. Acad. Sci. USA 2015, 112, 7039–7044. [Google Scholar] [CrossRef] [PubMed]
- Capizzi, D.; Bertolino, S.; Mortelliti, A. Rating the rat: Global patterns and research priorities in impacts and management of rodent pests. Mammal. Rev. 2014, 44, 148–162. [Google Scholar] [CrossRef]
- Panti-May, J.A.; Hernández-Betancourt, S.F.; Torres-Castro, M.A.; Machaín-William, C.; Cigarroa-Toledo, N. Population Characteristics of Human-Commensal Rodents Present in Households from Mérida, Yucatán, México. J. Parasite Biodivers. 2016, 5. [Google Scholar] [CrossRef]
- Rubio, A.V.; Ávila-Flores, R.; Suzán, G. Responses of small mammals to habitat fragmentation: Epidemiological considerations for rodent-borne hantaviruses in the Americas. EcoHealth 2014, 11, 526–533. [Google Scholar] [CrossRef]
- García-Peña, G.E.; Rubio, A.V.; Mendoza, H.; Fernández, M.; Milholland, M.T.; Aguirre, A.A.; Suzán, G.; Zambrana-Torrelio, C. Land-use change and rodent-borne diseases: Hazards on the shared socioeconomic pathways. Philos. Trans. R. Soc. B Biol. Sci. 2021, 376, 20200362. [Google Scholar] [CrossRef]
- Paull, S.H.; Song, S.; McClure, K.M.; Sackett, L.C.; Kilpatrick, A.M.; Johnson, P.T. From superspreaders to disease hotspots: Linking transmission across hosts and space. Front. Ecol. Environ. 2012, 10, 75–82. [Google Scholar] [CrossRef]
- Ferrari, N.; Rosà, R.; Pugliese, A.; Hudson, P.J. The role of sex in parasite dynamics: Model simulations on transmission of Heligmosomoides polygyrus in populations of yellow-necked mice. Apodemus flavicollis. Intern. J. Parasitol. 2007, 37, 341–349. [Google Scholar] [CrossRef]
- Hawlena, H.; Abramsky, Z.; Krasnov, B.R. Ultimate mechanisms of age-biased flea parasitism. Oecologia 2007, 154, 601–609. [Google Scholar] [CrossRef]
- Eads, D.A.; Hoogland, J.L. Factors that affect parasitism of black-tailed prairie dogs by fleas. Ecosphere 2016, 7, e01372. [Google Scholar] [CrossRef]
- Linardi, P.M.; Krasnov, B.R. Patterns of diversity and abundance of fleas and mites in the Neotropics: Host-related, parasite-related and environment-related factors. Med. Vet. Entomol. 2013, 27, 49–58. [Google Scholar] [CrossRef] [PubMed]
- Sánchez, C.A.; Becker, D.J.; Teitelbaum, C.S.; Barriga, P.; Brown, L.M.; Majewska, A.A.; Hall, R.J.; Altizer, S. On the relationship between body condition and parasite infection in wildlife: A review and meta-analysis. Ecol. Lett. 2018, 21, 1869–1884. [Google Scholar] [CrossRef] [PubMed]
- Miljević, M.; Čabrilo, B.; Budinski, I.; Rajičić, M.; Bajić, B.; Bjelić-Čabrilo, O.; Blagojević, J. Host–Parasite Relationship—Nematode Communities in Populations of Small Mammals. Animals 2022, 12, 2617. [Google Scholar] [CrossRef] [PubMed]
- Vital-García, C.; Beristain-Ruíz, D.M.; Acosta, R.; Marta, C.I.P.; Gatica-Colima, A.B.; Aristizabal, J.F.; Valdez-Rubio, A.; Escudero-Fragosso, C.; Martínez-Calderas, J.M. Ecological factors shaping ectoparasite communities on heteromyid rodents at Médanos de Samalayuca. Parasitol. Res. 2024, 123, 85. [Google Scholar] [CrossRef] [PubMed]
- Sackett, L.C. Does the host matter? Variable influence of host traits on parasitism rates. Intern. J. Parasitol. 2018, 48, 27–39. [Google Scholar] [CrossRef]
- Mendoza, H.; López-Pérez, A.M.; Rubio, A.V.; Barrón-Rodríguez, J.J.; Mazari-Hiriart, M.; Pontifes, P.A.; Dirzo, R.; Suzán, G. Association between anthropization and rodent reservoirs of zoonotic pathogens in Northwestern Mexico. PLoS ONE 2024, 19, e0298976. [Google Scholar] [CrossRef]
- Krasnov, B.R.; Khokhlova, I.S.; Fielden, L.J.; Burdelova, N.V. Effect of air temperature and humidity on the survival of pre-imaginal stages of two flea species (Siphonaptera: Pulicidae). J. Med. Entomol. 2021, 38, 629–637. [Google Scholar] [CrossRef]
- Kosoy, M.; Reynolds, P.; Bai, Y.; Sheff, K.; Enscore, R.E.; Montenieri, J.; Ettestad, P.; Gage, K. Small-scale die-offs in woodrats support long-term maintenance of plague in the US southwest. Vector-Borne Zoonotic Dis. 2017, 17, 635–644. [Google Scholar] [CrossRef]
- Phillips, P.L.; Welch, J.B.; Kramer, M. Development of a spatially targeted field sampling technique for the southern cattle tick, Rhipicephalus microplus, by mapping whitetailed deer, Odocoileus virginianus, habitat in South Texas. J. Insect Sci. 2014, 14, 88. [Google Scholar] [CrossRef]
- INEGI. 2020. Available online: https://www.inegi.org.mx/programas/ccpv/2020/default.html (accessed on 10 November 2024).
- Álvarez Castañeda, S.T.; Álvarez, T.; González-Ruiz, N. Guía para Identificar los Mamíferos de México en Campo y Laboratorio; Catálogo de la Biblioteca del Congreso de EE.UU; Pandora Impresores: New York, NY, USA, 2015. [Google Scholar]
- Harkness, J.E.; Turner, P.V.; VandeWoude, S.; Wheler, C.L. Harkness and Wagner’s Biology and Medicine of Rabbits and Rodents; John Wiley & Sons: Hoboken, NJ, USA, 2010. [Google Scholar]
- Quintero, J.C.; Londoño, A.F.; Díaz, F.J.; Agudelo-Flórez, P.; Arboleda, M.; Rodas, J.D. Ecoepidemiology of rickettsial infection in rodents, ectoparasites and humans in northeastern Antioquia, Colombia. Biomédica 2013, 33, 38–51. [Google Scholar]
- Yunker, C.E.; Keirans, J.E.; Clifford, C.M.; Easton, E.R. Dermacentor ticks (Acari: 49 Ixodoidea: Ixodidae) of the New World: A scanning electron microscope atlas. Proc. Entomol. Soc. Wash. 1986, 88, 609–627. [Google Scholar]
- Hoskins, J.D. Ixodid and argasid ticks keys to their identification. Vet. Clin. N. Am. Small Anim. Pract. 1991, 21, 185–197. [Google Scholar] [CrossRef]
- Acosta, R.; Morrone, J.J. Clave ilustrada para la identificación de los taxones supraespecíficos de Siphonaptera de México. Acta Zool. Mex. 2003, 89, 39–53. [Google Scholar] [CrossRef]
- Acosta, R.; Morrone, J.J. Phylogenetics of the tribe Phalacropsyllini (Siphonaptera: Ctenophthalmidae: Neopsyllinae) based on molecular and morphological evidence. Zootaxa 2013, 3630, 333–346. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Miura, K.; Higashiura, Y.; Maeto, K. Evaluation of easy, non-destructive methods of DNA extraction from minute insects. Appl. Entomol. Zool. 2017, 52, 349–352. [Google Scholar] [CrossRef]
- Roux, V.; Rydkina, E.; Eremeeva, M.; Raoult, D. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. Int. J. Syst. Bacteriol. 1997, 47, 252–261. [Google Scholar] [CrossRef]
- Hinnebusch, J.; Schwan, T.G. New method for plague surveillance using polymerase chain reaction to detect Yersinia pestis in fleas. J. Clin. Microbiol. 1993, 31, 1511–1514. [Google Scholar] [CrossRef]
- Labruna, M.B.; Whitworth, T.; Horta, M.C.; Bouyer, D.H.; McBride, J.W.; Pinter, A.; Popov, V.; Gennari, S.M.; Walker, D.H. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic. J. Clin. Microbiol. 2004, 42, 90–98. [Google Scholar] [CrossRef]
- Fulop, M.; Leslie, D.; Titball, R. A rapid, highly sensitive method for the detection of Francisella tularensis in clinical samples using the polymerase chain reaction. Am. J. Trop. Med. Hyg. 1996, 54, 364–366. [Google Scholar] [CrossRef]
- Peig, J.; Green, A.J. New perspectives for estimating body condition from mass/length data: The scaled mass index as an alternative method. Oikos 2009, 118, 1883–1891. [Google Scholar] [CrossRef]
- Cayuela, L.; De la Cruz, M. Análisis de Datos Ecológicos en R; Mundiprensa: Madrid, Spain, 2022. [Google Scholar]
- Fielding, A.H.; Bell, J.F. A review of methods for the assessment of prediction errors in conservation presence/absence models. Environ. Conserv. 1997, 24, 38–49. [Google Scholar] [CrossRef]
- Jiménez-Valverde, A.; Acevedo, P.; Barbosa, A.M.; Lobo, J.M.; Real, R. Discrimination capacity in species distribution models depends on the representativeness of the environmental domain. Glob. Ecol. Biogeogr. 2013, 22, 508–516. [Google Scholar] [CrossRef]
- Harrell, F., Jr. Hmisc: Harrell Miscellaneous. R Package Version 5.1-0. Available online: https://CRAN.R-project.org/package=Hmisc (accessed on 10 November 2024).
- Robin, X.; Turck, N.; Hainard, A.; Tiberti, N.; Lisacek, F.; Sanchez, J.C.; Müller, M. pROC: An open-source package for R and S+ to analyze and compare ROC curves. BMC Bioinform. 2011, 12, 77. [Google Scholar] [CrossRef] [PubMed]
- Ferrari, S.L.P.; Cribari-Neto, F. Beta Regression for Modelling Rates and Proportions. J. Appl. Stat. 2004, 31, 799–815. [Google Scholar] [CrossRef]
- Smithson, M.; Verkuilen, J. A Better Lemon Squeezer? Maximum-Likelihood Regression with Beta-Distributed Dependent Variables. Psychol. Methods 2006, 11, 54–71. [Google Scholar] [CrossRef]
- Zuur, A.F.; Ieno, E.N.; Walker, N.J.; Saveliev, A.A.; Smith, G.M. Mixed Effects Models and Extensions in Ecology with R; Springer Science & Business Media: New York, NY, USA, 2010. [Google Scholar]
- Cook, R.D.; Weisberg, S. Residuals and Influence in Regression; Chapman and Hall: New York, NY, USA, 1982. [Google Scholar]
- Lenth, R.V. R Package Emmeans: Estimated Marginal Means, Aka Least-Squares Means. R Package Version 1.7.5. 2022. Available online: https://CRAN.R-project.org/package=emmeans (accessed on 10 November 2024).
- Wickham, H. ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2016. [Google Scholar]
- Asiry, K.A.; Fetoh, B.e.l.-S. Occurrence of ectoparasitic arthropods associated with rodents in Hail region northern Saudi Arabia. Environ. Sci. Pollut. Res. Int. 2014, 21, 10120–10128. [Google Scholar] [CrossRef]
- Khosravani, M. The fauna and perspective of Rodentia ectoparasites in Iran relying on their roles within public health and veterinary characteristics. J. Parasit. Dis. 2018, 42, 1–18. [Google Scholar] [CrossRef]
- Acosta, R.; Hastriter, M.W. A review of the flea genus Phalacropsylla Rothschild, 1915 (Siphonaptera, Ctenophthalmidae, Neopsyllinae, Phalacropsyllini) with new host and distributional records. Zookeys 2017, 675, 27–43. [Google Scholar] [CrossRef][Green Version]
- Soares, H.S.; Barbieri, A.R.M.; Martins, T.F.; Minervino, A.H.H.; de Lima, J.T.R.; Marcili, A.; Gennari, S.M.; Labruna, M.B. Ticks and rickettsial infection in the wildlife of two regions of the Brazilian Amazon. Exp. Appl. Acarol. 2015, 65, 125–140. [Google Scholar] [CrossRef]
- Kobayashi, A.; Iwasaki, H. Human feet bitten by multiple brown dog ticks, Rhipicephalus sanguineus. IDCases 2017, 9, 8. [Google Scholar] [CrossRef]
- Beristain-Ruiz, D.M.; Garza-Hernández, J.A.; Figueroa-Millán, J.V.; Lira-Amaya, J.J.; Quezada-Casasola, A.; Ordoñez-López, S.; Laredo-Tiscareño, S.V.; Alvarado-Robles, B.; Castillo-Luna, O.R.; Floriano-López, A.; et al. Possible Association between Selected Tick-Borne Pathogen Prevalence and Rhipicephalus sanguineus sensu lato Infestation in Dogs from Juarez City (Chihuahua), Northwest Mexico-US Border. Pathogens 2022, 11, 552. [Google Scholar] [CrossRef] [PubMed]
- Fernández-González, A.M.; Kosoy, M.Y.; Rubio, A.V.; Graham, C.B.; Montenieri, J.A.; Osikowicz, L.M.; Bai, Y.; Acosta-Gutiérrez, R.; Ávila-Flores, R.; Gage, K.L.; et al. Molecular survey of Bartonella species and Yersinia pestis in rodent fleas (Siphonaptera) from Chihuahua, Mexico. J. Med. Entomol. 2016, 53, 199–205. [Google Scholar] [CrossRef] [PubMed]
- Strong, R.P.; Tyzzer, E.E.; Sellards, A.W. Oroya fever: Second report. J. Am. Med. Assoc. 1995, 64, 806–808. [Google Scholar] [CrossRef]
- Light, J.E.; Hafner, M.S. Phylogenetics and host associations of Fahrenholzia sucking lice (Phthiraptera: Anoplura). Syst. Entomol. 2007, 32, 359–370. [Google Scholar] [CrossRef]
- Falcón-Ordaz, J.; Acosta, R.; Fernández, J.A.; Lira-Guerrero, G. Helmintos y sifonápteros parásitos de cinco especies de roedores en localidades de la Cuenca Oriental, en el centro de México. Acta Zool. Mex. 2012, 28, 287–304. [Google Scholar] [CrossRef]
- Riner, A.J.; Rudd, J.L.; Clifford, D.L.; Cypher, B.L.; Foley, J.E.; Foley, P. Comparison of Flea (Siphonaptera) Burdens on the Endangered San Joaquin Kit Fox (Vulpes macrotis mutica (Carnivora, Canidae)) Inhabiting Urban and Nonurban Environments in Central Valley, California. J. Med. Entomol. 2018, 55, 995–1001. [Google Scholar] [CrossRef]
- Shultz, L.; López-Pérez, A.M.; Jasuja, R.; Helman, S.; Prager, K.; Tokuyama, A.; Quinn, N.; Bucklin, D.; Rudd, J.; Clifford, D.; et al. Vector-Borne Disease in Wild Mammals Impacted by Urban Expansion and Climate Change. Ecohealth 2023, 20, 286–299. [Google Scholar] [CrossRef]
- Azad, A.F.; Radulovic, S.; Higgins, J.A.; Noden, B.H.; Troyer, J.M. Flea-borne rickettsioses: Ecologic considerations. Emerg. Infect. Dis. 1997, 3, 319–327. [Google Scholar] [CrossRef]
- Stevenson, H.L.; Bai, Y.; Kosoy, M.Y.; Montenieri, J.A.; Lowell, J.L.; Chu, M.C.; Gage, K.L. Detection of novel Bartonella strains and Yersinia pestis in prairie dogs and their fleas (Siphonaptera: Ceratophyllidae and Pulicidae) using multiplex polymerase chain reaction. J. Med. Entomol. 2003, 40, 329–337. [Google Scholar] [CrossRef]
- Friggens, M.M.; Parmenter, R.R.; Boyden, M.; Ford, P.L.; Gage, K.; Keim, P. Flea abundance, diversity, and plague in Gunnison’s prairie dogs (Cynomys gunnisoni) and their burrows in montane grasslands in northern New Mexico. J. Wildl. Dis. 2010, 46, 356–367. [Google Scholar] [CrossRef]
- White, L.M.; Gifford, S.J.; Kaufman, G.; Gese, E.; Peyton, M.A.; Parmenter, R.R.; Cain, J.W. Seroprevalence, Blood Chemistry, and Patterns of Canine Parvovirus, Distemper Virus, Plague, and Tularemia in Free-Ranging Coyotes (Canis latrans) in Northern New Mexico, USA. J. Wildl. Dis. 2024, 60, 14–25. [Google Scholar] [CrossRef] [PubMed]
- Farlow, J.; Wagner, D.M.; Dukerich, M.; Stanley, M.; Chu, M.; Kubota, K.; Petersen, J.; Keim, P. Francisella tularensis in the United States. Emerg. Infect. Dis. 2005, 11, 1835–1841. [Google Scholar] [CrossRef] [PubMed]
- Cuesy, M. Caracterización del Microbioma Bacteriano en Base a la Región 16S rDNA y su Asociación con Patógenos de Importancia Médica en Garrapatas de Hospederos Silvestres del Norte de la República Mexicana. Ph.D. Thesis, Universidad Autónoma de Nuevo León, Nuevo León, Mexico, 2021. [Google Scholar]
- Radzijevskaja, J.; Kaminskienė, E.; Lipatova, I.; Mardosaitė-Busaitienė, D.; Balčiauskas, L.; Stanko, M.; Paulauskas, A. Prevalence and diversity of Rickettsia species in ectoparasites collected from small rodents in Lithuania. Parasit. Vectors 2018, 11, 375. [Google Scholar] [CrossRef] [PubMed]
- Ehlers, J.; Krüger, A.; Rakotondranary, S.J.; Ratovonamana, R.Y.; Poppert, S.; Ganzhorn, J.U.; Tappe, D. Molecular detection of Rickettsia spp., Borrelia spp., Bartonella spp. and Yersinia pestis in ectoparasites of endemic and domestic animals in southwest Madagascar. Acta Trop. 2020, 205, 105339. [Google Scholar] [CrossRef]
- Špitalská, E.; Kraljik, J.; Miklisová, D.; Boldišová, E.; Sparagano, O.A.E.; Stanko, M. Circulation of Rickettsia species and rickettsial endosymbionts among small mammals and their ectoparasites in Eastern Slovakia. Parasitol. Res. 2020, 119, 2047–2057. [Google Scholar] [CrossRef]
- Haikukutu, L.; Lyaku, J.R.; Lyimo, C.M.; Eiseb, S.J.; Makundi, R.H.; Olayemi, A.; Wilhelm, K.; Müller-Klein, N.; Schmid, D.W.; Fleischer, R.; et al. Immunogenetics, sylvatic plague and its vectors: Insights from the pathogen reservoir Mastomys natalensis in Tanzania. Immunogenetics 2023, 75, 517–530. [Google Scholar] [CrossRef]
- Weyna, A.A.W.; Andreasen, V.A.; Burrell, C.E.; Kunkel, M.R.; Radisic, R.; Goodwin, C.C.; Fenton, H.; Dugovich, B.S.; Poulson, R.L.; Ruder, M.G.; et al. Causes of morbidity and mortality in wild cottontail rabbits in the eastern United States, 2013–2022. J Vet. Diagn. Investig. 2024, 36, 655–665. [Google Scholar] [CrossRef]
- Presley, S.J. Interspecific aggregation of ectoparasites on bats: Importance of hosts as habitats supersedes interspecific interactions. Oikos 2011, 120, 832–841. [Google Scholar] [CrossRef]
- Boyard, C.; Vourc’h, G.; Barnouin, J. The relationship between Ixodes ricinus and small mammal species at the woodland–pastureinterface. Exp. Appl. Acarol. 2008, 44, 61–76. [Google Scholar] [CrossRef]
- Harrison, A.; Scantlebury, M.; Montgomery, W.I. Body mass and sex biased parasitism in wood mice Apodemus sylvaticus. Oikos 2010, 119, 1099–1104. [Google Scholar] [CrossRef]
- Rafalinirina, H.A.; Aivelo, T.; Wright, P.C.; Randrianasy, J. Comparison of parasitic infections and body condition in rufous mouse lemurs (Microcebus rufus) at Ranomafana National Park, southeast Madagascar. Madag. Conser Dev. 2015, 10, 60–66. [Google Scholar] [CrossRef][Green Version]
- Bize, P.; Jeanneret, C.; Klopfenstein, A.; Roulin, A. What makes a host profitable? Parasites balance host nutritive resources against immunity. Am. Nat. 2008, 171, 107–118. [Google Scholar] [CrossRef] [PubMed]
- Carrascal, L.M.; Senar, J.C.; Mozetich, I.; Fransec, U.; Jordi, D. Interactions among environmental stress, body condition, nutritional status, and dominance in Great Tits. Ornithology 1998, 115, 727–738. [Google Scholar] [CrossRef][Green Version]
- Gosler, A.; Carruthers, T. Body reserves and social dominance in the Great Tit Parus major in relation to winter weather in southwest Ireland. J. Avian Biol. 1999, 30, 447–459. [Google Scholar] [CrossRef]
- Altizer, S.; Nunn, C.L.; Thrall, P.H.; Gittleman, J.L.; Antonovics, J.; Cunningham, A.A.; Dobson, A.P.; Ezenwa, V.; Jones, K.E.; Pedersen, A.B.; et al. Social organization and parasite risk in mammals: Integrating theory and empirical studies. Annu. Rev. Ecol. Evol. Syst. 2023, 34, 517–547. [Google Scholar] [CrossRef]
- Lorange, E.A.; Race, B.L.; Sebbane, F.; Joseph Hinnebusch, B. Poor vector competence of fleas and the evolution of hypervirulence in Yersinia pestis. J. Infect. Dis. 2005, 191, 1907–1912. [Google Scholar] [CrossRef]
- Kavaliers, M.; Ossenkopp, K.P.; Choleris, E. Pathogens, odors, and disgust in rodents. Neurosci. Biobehav. Rev. 2020, 119, 281–293. [Google Scholar] [CrossRef]
- Hawlena, H.; Bashary, D.; Abramsky, Z.; Krasnov, B.R. Benefits, Costs and constraints of anti-parasitic grooming in adult and juvenile rodents. Ethology 2007, 113, 394–402. [Google Scholar] [CrossRef]
- Hart, B.L.; Hart, L.A. How mammals stay healthy in nature: The evolution of behaviours to avoid parasites and pathogens. Philos. Trans. R. Soc. B Biol. Sci. 2018, 373, 20170205. [Google Scholar] [CrossRef]





| Rodent Species | First Season | Second Season | Total | ||||
|---|---|---|---|---|---|---|---|
| Las Palmas | Villa Luz | Ley Seis de Enero | Las Palmas | Villa Luz | Ley Seis de Enero | ||
| D. merriami | 31 | 9 | 13 | 26 | 14 | 13 | 106 (49.76%) |
| D. ordii | 1 | 5 | - | 1 | 1 | - | 8 (3.75%) |
| D. spectabilis | 1 | - | - | 1 | - | 1 | 3 (1.18%) |
| Ch. hispidus | 1 | 12 | - | 11 | 2 | 21 | 47 (22.06%) |
| Ch. eremicus | - | - | 4 | 2 | 6 | 15 | 27 (12.67%) |
| P. flavus | 1 | 9 | - | 9 | - | - | 19 (8.92%) |
| P. flavescens | 1 | 2 | - | - | - | - | 3 (1.40%) |
| Total | 90 | 123 | 213 (100%) | ||||
| Rodent Species | Prevalence (Infested Animals) | R. Sanguineus | M. Altipecten | M. Dipodomys | Fahrenholzia spp. |
|---|---|---|---|---|---|
| D. merriami | 39.6% (42/106) | 12% (48) | 27% (62) | 16% (32) | 2% (4) |
| D. ordii | 37.5% (3/8) | - | 38% (3) | 25% (3) | - |
| D. spectabilis | 33.3% (1/3) | - | 33% (4) | 33% (2) | - |
| C. hispidus | 48.9% (23/47) | 28% (52) | 4% (2) | 2% (2) | - |
| C. eremicus | 40.7% (11/27) | 19% (15) | - | 7% (1) | - |
| P. flavus | 47.3% (9/19) | 26% (19) | 11% (2) | 16% (3) | - |
| P. flavescens | 0% (0/3) | - | - | 33% (1) | - |
| Total | 42% (89/213) | 16.9% (134) | 17.3% (73) | 12.6% (43) | 0.9% (4) |
| Contrast | Estimate | Z-Value | Res. Dev | p | AUC | |
|---|---|---|---|---|---|---|
| Intercept | −2.11 | 0.78 | ||||
| Sample | blood:spleen | 0.25 | 0.37 | 86.84 | * | |
| blood:liver | 17.24 | 0.01 | ||||
| Infested | Inf:non-inf | −0.91 | 84.58 |
| Variable | Estimate | Std. Error | Z-Value | p-Value | |
|---|---|---|---|---|---|
| Intercept | Fahrehnholzia spp.:C. eremicus | −3.39 | 0.55 | −6.146 | *** |
| Ectoparasite | M_altipecten | 1.28 | 0.45 | 2.844 | ** |
| M_dipodomys | 1.54 | 0.44 | 3.469 | *** | |
| R_sanguineus | 0.76 | 0.46 | 1.636 | 0.10 | |
| Rodent | C_hispidus | 0.08 | 0.59 | 0.143 | 0.89 |
| D_merriami | 0.87 | 0.55 | 1.585 | 0.11 | |
| D_ordii | 0.70 | 0.56 | 1.262 | 0.21 | |
| D_spectabilis | 0.75 | 0.56 | 1.353 | 0.18 | |
| P_flavescens | 0.07 | 0.59 | 0.111 | 0.91 | |
| P_flavus | 0.71 | 0.56 | 1.273 | 0.20 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Beristain-Ruiz, D.M.; Márquez-Chacón, A.K.; Vital-García, C.; Figueroa-Millán, J.V.; Lira-Amaya, J.J.; Aristizabal, J.F.; Olivas-Sánchez, M.P.; Gatica-Colima, A.B.; Martínez-Calderas, J.M.; Quezada-Casasola, A.; et al. Effects of Body Condition and Ectoparasitism on Host–Pathogen Interactions of Heteromyid Rodents. Pathogens 2024, 13, 1085. https://doi.org/10.3390/pathogens13121085
Beristain-Ruiz DM, Márquez-Chacón AK, Vital-García C, Figueroa-Millán JV, Lira-Amaya JJ, Aristizabal JF, Olivas-Sánchez MP, Gatica-Colima AB, Martínez-Calderas JM, Quezada-Casasola A, et al. Effects of Body Condition and Ectoparasitism on Host–Pathogen Interactions of Heteromyid Rodents. Pathogens. 2024; 13(12):1085. https://doi.org/10.3390/pathogens13121085
Chicago/Turabian StyleBeristain-Ruiz, Diana M., Ana K. Márquez-Chacón, Cuauhcihuatl Vital-García, Julio V. Figueroa-Millán, José J. Lira-Amaya, John F. Aristizabal, Martha P. Olivas-Sánchez, Ana B. Gatica-Colima, Jesús M. Martínez-Calderas, Andrés Quezada-Casasola, and et al. 2024. "Effects of Body Condition and Ectoparasitism on Host–Pathogen Interactions of Heteromyid Rodents" Pathogens 13, no. 12: 1085. https://doi.org/10.3390/pathogens13121085
APA StyleBeristain-Ruiz, D. M., Márquez-Chacón, A. K., Vital-García, C., Figueroa-Millán, J. V., Lira-Amaya, J. J., Aristizabal, J. F., Olivas-Sánchez, M. P., Gatica-Colima, A. B., Martínez-Calderas, J. M., Quezada-Casasola, A., Alvarado-Robles, B., & Alonso-Mendoza, V. M. (2024). Effects of Body Condition and Ectoparasitism on Host–Pathogen Interactions of Heteromyid Rodents. Pathogens, 13(12), 1085. https://doi.org/10.3390/pathogens13121085

