Development, Optimization, and Validation of a Quantitative PCR Assay for Borrelia burgdorferi Detection in Tick, Wildlife, and Human Samples
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and Preparation
2.2. DNA Extraction
2.3. Primer Design
Target | Type of PCR | Primer Name | Sequence (5′ → 3′) | Hybridization Temperature (°C) | Amplicon Length (bp) | Source of the Primers |
---|---|---|---|---|---|---|
Borrelia species | qPCR 1 | ospA forward | GAACCAGACTTGAATACACAGGA | 61 | 98 | Designed for this study |
ospA reverse | TTCAGCAGTTAGAGTTCCTTCA | |||||
flaB forward | CAATCAGGTAACGGCACATATTC | 61 | 80 | |||
flaB reverse | CTATTAATTTCGTCTGTAAGTTGCTC | |||||
Two rounds of conventional PCR and outer round of semi-nested PCR 2 | outer ospA forward | CAAGAGCAGACGGAACC | 52.5 | 190 | ||
outer ospA reverse | AGTTCAACTGAAACTTCCC | |||||
outer flaB forward | GTAAGAATGAAGGAATTGGC | 52.5 | 204 | |||
outer flaB reverse | AGGCTGCATTCCAAGCTC | |||||
Inner round of semi-nested PCR 3 | ospA forward | GAACCAGACTTGAATACACAGGA | 53.5 | 178 | ||
outer ospA reverse | AGTTCAACTGAAACTTCCC | |||||
flaB forward | CAATCAGGTAACGGCACATATTC | 61 | 180 | |||
outer flaB reverse | AGGCTGCATTCCAAGCTC | |||||
Nested PCR 4 | outer ospC forward | GTAATAATTCAGGGAAAGATGG | 51 | 654 | ||
outer ospC reverse | CAGCACCTTTAGTTTTAGTACC | |||||
inner ospC forward | CTAATGCGGTTTTACTTGCTG | 56 | 331 | |||
inner ospC reverse | GTTTTTAAAATGGCTTCTTTTGC | |||||
Diverse animals | Conventional PCR 5 | CO1 forward | GGTCAACAAATCATAAAGATATTGG | 45 (5 cycles) 51 (35 cycles) | 710 | Folmer et al. (1994) [105] |
CO1 reverse | TAAACTTCAGGGTGACCAAAAAATCA |
2.4. Validation and Optimization of the qPCR Assay
2.5. Testing of Tick Samples, Wildlife Tissues, Human Tissues, and BSK-H Cultures Derived from Human Samples
2.6. DNA Sequencing
3. Results
3.1. Validation and Optimization Results of the Borrelia qPCR Assay
3.2. PCR Testing on Tick, Wildlife, and Human Samples
3.2.1. Quantitative PCR Testing on Tick Samples
3.2.2. PCR Testing of Wildlife Samples
3.2.3. Quantitative PCR Testing of Human Samples
3.3. Sanger Confirmation of Amplified Products
4. Discussion
4.1. Value of Optimized and Validated Tools for Direct Borrelia Detection
4.2. Detection of Borrelia in Ticks
4.3. Detection of Borrelia in Wildlife
4.4. Detection of Borrelia in Culture-Amplified Human Lyme Cultures
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Baneth, G. Tick-Borne Infections of Animals and Humans: A Common Ground. Int. J. Parasitol. 2014, 44, 591–596. [Google Scholar] [CrossRef] [PubMed]
- Knapp, K.L.; Rice, N.A. Human Coinfection with Borrelia burgdorferi and Babesia microti in the United States. J. Parasitol. Res. 2015, 2015, 587131. [Google Scholar] [CrossRef] [PubMed]
- Hoversten, K.; Bartlett, M.A. Diagnosis of a Tick-Borne Coinfection in a Patient with Persistent Symptoms Following Treatment for Lyme Disease. BMJ Case Rep. 2018, 2018, bcr2018225342. [Google Scholar] [CrossRef] [PubMed]
- Boyer, P.H.; Lenormand, C.; Jaulhac, B.; Talagrand-Reboul, E. Human Co-Infections between Borrelia burgdorferi s.l. and Other Ixodes-Borne Microorganisms: A Systematic Review. Pathogens 2022, 11, 282. [Google Scholar] [CrossRef]
- Rocha, S.C.; Velásquez, C.V.; Aquib, A.; Al-Nazal, A.; Parveen, N. Transmission Cycle of Tick-Borne Infections and Co-Infections, Animal Models and Diseases. Pathogens 2022, 11, 1309. [Google Scholar] [CrossRef]
- Cumming, G.S.; Van Vuuren, D.P. Will Climate Change Affect Ectoparasite Species Ranges? Glob. Ecol. Biogeogr. 2006, 15, 486–497. [Google Scholar] [CrossRef]
- Ogden, N.H.; Maarouf, A.; Barker, I.K.; Bigras-Poulin, M.; Lindsay, L.R.; Morshed, M.G.; O’Callaghan, C.J.; Ramay, F.; Waltner-Toews, D.; Charron, D.F. Climate Change and the Potential for Range Expansion of the Lyme Disease Vector Ixodes Scapularis in Canada. Int. J. Parasitol. 2006, 36, 63–70. [Google Scholar] [CrossRef]
- Porretta, D.; Mastrantonio, V.; Amendolia, S.; Gaiarsa, S.; Epis, S.; Genchi, C.; Bandi, C.; Otranto, D.; Urbanelli, S. Effects of Global Changes on the Climatic Niche of the Tick Ixodes ricinus Inferred by Species Distribution Modelling. Parasit. Vectors 2013, 6, 271. [Google Scholar] [CrossRef]
- Sonenshine, D.E. Range Expansion of Tick Disease Vectors in North America: Implications for Spread of Tick-Borne Disease. Int. J. Environ. Res. Public. Health 2018, 15, 478. [Google Scholar] [CrossRef]
- McCoy, K.D.; Toty, C.; Dupraz, M.; Tornos, J.; Gamble, A.; Garnier, R.; Descamps, S.; Boulinier, T. Climate Change in the Arctic: Testing the Poleward Expansion of Ticks and Tick-Borne Diseases. Glob. Chang. Biol. 2023, 29, 1729–1740. [Google Scholar] [CrossRef]
- Rosenberg, R.; Lindsey, N.P.; Fischer, M.; Gregory, C.J.; Hinckley, A.F.; Mead, P.S.; Paz-Bailey, G.; Waterman, S.H.; Drexler, N.A.; Kersh, G.J.; et al. Vital Signs: Trends in Reported Vectorborne Disease Cases—United States and Territories, 2004–2016. Morb. Mortal. Wkly. Rep. (MMWR) 2018, 67, 496–501. [Google Scholar] [CrossRef] [PubMed]
- Madison-Antenucci, S.; Kramer, L.D.; Gebhardt, L.L.; Kauffman, E. Emerging Tick-Borne Diseases. Clin. Microbiol. Rev. 2020, 33, 10–128. [Google Scholar] [CrossRef] [PubMed]
- Rochlin, I.; Toledo, A. Emerging Tick-Borne Pathogens of Public Health Importance: A Mini-Review. J. Med. Microbiol. 2020, 69, 781–791. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Sun, B.; Lou, Y. Dynamics of a Periodic Tick-Borne Disease Model with Co-Feeding and Multiple Patches. J. Math. Biol. 2021, 82, 27. [Google Scholar] [CrossRef]
- Ackleh, A.S.; Veprauskas, A. Modeling the Invasion and Establishment of a Tick-Borne Pathogen. Ecol. Modell. 2022, 467, 109915. [Google Scholar] [CrossRef]
- de la Fuente, J.; Estrada-Peña, A.; Rafael, M.; Almazán, C.; Bermúdez, S.; Abdelbaset, A.E.; Kasaija, P.D.; Kabi, F.; Akande, F.A.; Ajagbe, D.O.; et al. Perception of Ticks and Tick-Borne Diseases Worldwide. Pathogens 2023, 12, 1258. [Google Scholar] [CrossRef]
- Kiryluk, H.D.; Beard, C.B.; Holcomb, K.M. The Use of Environmental Data in Descriptive and Predictive Models of Vector-Borne Disease in North America. J. Med. Entomol. 2024, 61, 595–602. [Google Scholar] [CrossRef]
- Tito, M.H.; Arifuzzaman, M.; Rahman, M.S.; Khan, S.; Chohan, M.S.; Nasrin, A. Predictive Modeling of Global Vector-Borne Diseases: Leveraging Machine Learning for Intervention Strategies. In Proceedings of the 2024 ASU International Conference in Emerging Technologies for Sustainability and Intelligent Systems (ICETSIS), Manama, Bahrain, 28–29 January 2024; pp. 1027–1031. [Google Scholar]
- Rudenko, N.; Golovchenko, M.; Grubhoffer, L.; Oliver, J.H. Updates on Borrelia burgdorferi Sensu Lato Complex with Respect to Public Health. Ticks Tick. Borne Dis. 2011, 2, 123–128. [Google Scholar] [CrossRef]
- Cutler, S.J.; Ruzic-Sabljic, E.; Potkonjak, A. Emerging Borreliae—Expanding beyond Lyme Borreliosis. Mol. Cell Probes 2017, 31, 22–27. [Google Scholar] [CrossRef]
- Randolph, S.E.; Gem, L.; Nuttall, P.A. Co-Feeding Ticks: Epidemiological Significance for Tick-Borne Pathogen Transmission. Parasitol Today 1996, 12, 472–479. [Google Scholar] [CrossRef]
- Voordouw, M.J. Co-Feeding Transmission in Lyme Disease Pathogens. Parasitology 2015, 142, 290–302. [Google Scholar] [CrossRef] [PubMed]
- Belli, A.; Sarr, A.; Rais, O.; Rego, R.O.M.; Voordouw, M.J. Ticks Infected via Co-Feeding Transmission Can Transmit Lyme Borreliosis to Vertebrate Hosts. Sci. Rep. 2017, 7, 5006. [Google Scholar] [CrossRef] [PubMed]
- Kirsch, M.; Ruben, F.L.; Steere, A.C.; Duray, P.H.; Norden, C.W.; Winkelstein, A. Fatal Adult Respiratory Distress Syndrome in a Patient with Lyme Disease. JAMA 1988, 259, 2737–2739. [Google Scholar] [CrossRef] [PubMed]
- Butler, T. The Jarisch-Herxheimer Reaction after Antibiotic Treatment of Spirochetal Infections: A Review of Recent Cases and Our Understanding of Pathogenesis. Am. J. Trop. Med. Hyg. 2017, 96, 46–52. [Google Scholar] [CrossRef] [PubMed]
- Wan, D.; Blakely, C.; Branscombe, P.; Suarez-Fuster, L.; Glover, B.; Baranchuk, A. Lyme Carditis and High-Degree Atrioventricular Block. Am. J. Cardiol. 2018, 121, 1102–1104. [Google Scholar] [CrossRef]
- Sapi, E.; Kasliwala, R.S.; Ismail, H.; Torres, J.P.; Oldakowski, M.; Markland, S.; Gaur, G.; Melillo, A.; Eisendle, K.; Liegner, K.B.; et al. The Long-Term Persistence of Borrelia burgdorferi Antigens and DNA in the Tissues of a Patient with Lyme Disease. Antibiotics 2019, 8, 183. [Google Scholar] [CrossRef]
- Marx, G.E.; Leikauskas, J.; Lindstrom, K.; Mann, E.; Reagan-Steiner, S.; Matkovic, E.; Read, J.S.; Kelso, P.; Kwit, N.A.; Hinckley, A.F.; et al. Fatal Lyme Carditis in New England: Two Case Reports. Ann. Intern. Med. 2020, 172, 222–224. [Google Scholar] [CrossRef]
- Semproni, M.; Rusk, R.; Wuerz, T. Fatal Lyme Carditis Presenting as Fluctuating High-Grade Atrioventricular Block. CMAJ 2020, 192, E574–E577. [Google Scholar] [CrossRef]
- Cabello, F.C.; Godfrey, H.P.; Newman, S.A. Hidden in Plain Sight: Borrelia burgdorferi and the Extracellular Matrix. Trends Microbiol. 2007, 15, 350–354. [Google Scholar] [CrossRef]
- Hyde, J.A. Borrelia burgdorferi Keeps Moving and Carries on: A Review of Borrelial Dissemination and Invasion. Front. Immunol. 2017, 8, 114. [Google Scholar] [CrossRef]
- Burgdorfer, W.; Barbour, A.G.; Hayes, S.F.; Péter, O.; Aeschlimann, A. Erythema Chronicum Migrans—A Tickborne Spirochetosis. Acta Trop. 1983, 40, 79–83. [Google Scholar] [PubMed]
- Steere, A.C.; Bartenhagen, N.H.; Craft, J.E.; Hutchinson, G.J.; Newman, J.H.; Rahn, D.W.; Sigal, L.H.; Spieler, P.N.; Stenn, K.S.; Malawista, S.E. The Early Clinical Manifestations of Lyme Disease. Ann. Intern. Med. 1983, 99, 76–82. [Google Scholar] [CrossRef] [PubMed]
- Cooke, W. Complications of Lyme Borreliosis. Annu. Rev. Med. 1992, 43, 93–103. [Google Scholar] [CrossRef] [PubMed]
- Smith, R.P.; Schoen, R.T.; Rahn, D.W.; Sikand, V.K.; Nowakowski, J.; Parenti, D.L.; Holman, M.S.; Persing, D.H.; Steere, A.C. Clinical Characteristics and Treatment Outcome of Early Lyme Disease in Patients With Microbiologically Confirmed Erythema Migrans. Infect. Dis. Clin. Pract. 2002, 11, 170–171. [Google Scholar] [CrossRef]
- Tibbles, C.D.; Edlow, J.A. Does This Patient Have Erythema Migrans? JAMA 2007, 297, 2617–2627. [Google Scholar] [CrossRef]
- Vasudevan, B.; Chatterjee, M. Lyme Borreliosis and Skin. Indian. J. Dermatol. 2013, 58, 167–174. [Google Scholar] [CrossRef]
- Schotthoefer, A.M.; Green, C.B.; Dempsey, G.; Horn, E.J. The Spectrum of Erythema Migrans in Early Lyme Disease: Can We Improve Its Recognition? Cureus 2022, 14, e30673. [Google Scholar] [CrossRef]
- Kimsey, R.B.; Spielman, A. Motility of Lyme Disease Spirochetes in Fluids as Viscous as the Extracellular Matrix. J. Inect Dis. 1990, 162, 1205–1208. [Google Scholar] [CrossRef]
- Gebbia, J.A.; Coleman, J.L.; Benach, J.L. Borrelia Spirochetes Upregulate Release and Activation of Matrix Metalloproteinase Gelatinase B (MMP-9) and Collagenase 1 (MMP-1) in Human Cells. Infect. Immun. 2001, 69, 456–462. [Google Scholar] [CrossRef]
- Craven, D.E.; Jones, R. Lyme Neuroborreliosis: Manifestations of a Rapidly Emerging Zoonosis. Am. J. Neuroradiol. 2009, 30, 1079–1087. [Google Scholar] [CrossRef]
- Stanek, G.; Wormser, G.P.; Gray, J.; Strle, F. Lyme Borreliosis. Lancet 2012, 379, 461–473. [Google Scholar] [CrossRef] [PubMed]
- Dorward, D.W.; Fischer, E.R.; Brooks, D.M. Invasion and Cytopathic Killing of Human Lymphocytes by Spirochetes Causing Lyme Disease. Clin. Infect. Dis. 1997, 25, S2–S8. [Google Scholar] [CrossRef] [PubMed]
- Embers, M.E.; Ramamoorthy, R.; Philipp, M.T. Survival Strategies of Borrelia burgdorferi, the Etiologic Agent of Lyme Disease. Microbes Infect. 2004, 6, 312–318. [Google Scholar] [CrossRef] [PubMed]
- Elsner, R.A.; Hastey, C.J.; Olsen, K.J.; Baumgarth, N. Suppression of Long-Lived Humoral Immunity Following Borrelia burgdorferi Infection. PLoS Pathog. 2015, 11, e1004976. [Google Scholar] [CrossRef] [PubMed]
- Tracy, K.E.; Baumgarth, N. Borrelia burgdorferi Manipulates Innate and Adaptive Immunity to Establish Persistence in Rodent Reservoir Hosts. Front. Immunol. 2017, 8, 116. [Google Scholar] [CrossRef]
- Pausa, M.; Pellis, V.; Cinco, M.; Piero, G.; Presani, G.; Perticarari, S.; Tedesco, F. Serum-Resistant Strains of Borrelia burgdorferi Evade Complement-Mediated Killing by Expressing a CD59-Like Complement Inhibitory Molecule. J. Immunol. 2021, 170, 3214–3222. [Google Scholar] [CrossRef]
- de Taeye, S.W.; Kreuk, L.; van Dam, A.P.; Hovius, J.W.; Schuijt, T.J. Complement Evasion by Borrelia Burgdorferi: It Takes Three to Tango. Trends Parasitol. 2013, 29, 119–128. [Google Scholar] [CrossRef]
- Elsner, R.A.; Hastey, C.J.; Baumgarth, N. CD4+ T Cells Promote Antibody Production but Not Sustained Affinity Maturation during Borrelia burgdorferi Infection. Infect. Immun. 2015, 83, 48–56. [Google Scholar] [CrossRef]
- Snydman, D.R.; Schenkein, D.P.; Berardi, V.P.; Lastavica, C.C.; Pariser, K.M. Borrelia burgdorferi in Joint Fluid in Chronic Lyme Arthritis. Ann. Intern. Med. 1986, 104, 798–800. [Google Scholar] [CrossRef]
- Rasley, A.; Anguita, J.; Marriott, I. Borrelia burgdorferi Induces Inflammatory Mediator Production by Murine Microglia. J. Neuroimmunol. 2002, 130, 22–31. [Google Scholar] [CrossRef]
- Aucott, J.N.; Yang, T.; Yoon, I.; Powell, D.; Geller, S.A.; Rebman, A.W. Risk of Post-Treatment Lyme Disease in Patients with Ideally-Treated Early Lyme Disease: A Prospective Cohort Study. Int. J. Infect. Dis. 2022, 116, 230–237. [Google Scholar] [CrossRef] [PubMed]
- Feder, H.; Hunt, M. Pitfalls in the Diagnosis and Management of Lyme Disease. JAMA 1995, 274, 66–68. [Google Scholar] [CrossRef] [PubMed]
- Aucott, J.; Morrison, C.; Munoz, B.; Rowe, P.C.; Schwarzwalder, A.; West, S.K. Diagnostic Challenges of Early Lyme Disease: Lessons from a Community Case Series. BMC Infect. Dis. 2009, 9, 79. [Google Scholar] [CrossRef] [PubMed]
- Aucott, J.N.; Seifter, A. Misdiagnosis of Early Lyme Disease as the Summer Flu. Orthop. Rev. 2011, 3, 14. [Google Scholar] [CrossRef]
- Donta, S.T. Issues in the Diagnosis and Treatment of Lyme Disease. Open Neurol. J. 2012, 6, 140–145. [Google Scholar] [CrossRef]
- Hinckley, A.F.; Connally, N.P.; Meek, J.I.; Johnson, B.J.; Kemperman, M.M.; Feldman, K.A.; White, J.L.; Mead, P.S. Lyme Disease Testing by Large Commercial Laboratories in the United States. Clin. Infect. Dis. 2014, 59, 676–681. [Google Scholar] [CrossRef]
- Nelson, C.A.; Saha, S.; Kugeler, K.J.; Delorey, M.J.; Shankar, M.B.; Hinckley, A.F.; Mead, P.S. Incidence of Clinician-Diagnosed Lyme Disease, United States, 2005–2010. Emerg. Infect. Dis. 2015, 21, 1625–1631. [Google Scholar] [CrossRef]
- Hirsch, A.G.; Herman, R.J.; Rebman, A.; Moon, K.A.; Aucott, J.; Heaney, C.; Schwartz, B.S. Obstacles to Diagnosis and Treatment of Lyme Disease in the USA: A Qualitative Study. BMJ Open 2018, 8, e021367. [Google Scholar] [CrossRef]
- Lloyd, V.K.; Hawkins, R.G. Under-Detection of Lyme Disease in Canada. Healthcare 2018, 6, 125. [Google Scholar] [CrossRef]
- Moritz, R.L.; Bobe, J.R.; Jutras, B.L.; Horn, E.J.; Embers, M.E.; Marconi, R.T.; Aucott, J.; Ma, A.; Keesing, F.; Lewis, K. Recent Progress in Lyme Disease and Remaining Challenges. Front. Med. 2021, 8, 666554. [Google Scholar] [CrossRef]
- Dressler, F.; Whalen, J.A.; Reinhardt, B.N.; Steere, A.C. Western Blotting in the Serodiagnosis of Lyme Disease. J. Infect. Dis. 1993, 167, 392–400. [Google Scholar] [CrossRef] [PubMed]
- Schutzer, S.; Coyle, P.; Belman, A.; Golightly, M.; Drulle, J. Sequestration of Antibody to Borrelia burgdorferi in Immune Complexes in Seronegative Lyme Disease. Lancet 1990, 335, 312–315. [Google Scholar] [CrossRef] [PubMed]
- Waddell, L.A.; Greig, J.; Mascarenhas, M.; Harding, S.; Lindsay, R.; Ogden, N. The Accuracy of Diagnostic Tests for Lyme Disease in Humans, a Systematic Review and Meta-Analysis of North American Research. PLoS ONE 2016, 11, e0168613. [Google Scholar] [CrossRef] [PubMed]
- Ryan, M.F.; Thorn, C. Lyme Carditis in an Immunocompromised Patient. Case Rep. Emerg. Med. 2013, 2013, 380734. [Google Scholar] [CrossRef] [PubMed]
- Wagemakers, A.; Visser, M.C.; de Wever, B.; Hovius, J.W.; van de Donk, N.W.C.J.; Hendriks, E.J.; Peferoen, L.; Muller, F.F.; Ang, C.W. Case Report: Persistently Seronegative Neuroborreliosis in an Immunocompromised Patient. BMC Infect. Dis. 2018, 18, 362. [Google Scholar] [CrossRef]
- Basile, E.J.; Smoot, M.; Hanna, M.E.; Ijaz, Z.; Keeley, E.C. A Rare Presentation of Lyme Disease in an Immunocompromised Patient. Cureus 2024, 16, e58605. [Google Scholar] [CrossRef]
- Sillanpää, H.; Lahdenne, P.; Sarvas, H.; Arnež, M.; Steere, A.; Peltomaa, M.; Seppälä, I. Immune Responses to Borrelial VlsE IR6 Peptide Variants. Int. J. Med. Microbiol. 2007, 297, 45–52. [Google Scholar] [CrossRef]
- Mavin, S.; Milner, R.M.; Evans, R.; Chatterton, J.M.W.; Joss, A.W.L.; Ho-Yen, D.O. The Use of Local Isolates in Western Blots Improves Serological Diagnosis of Lyme Disease in Scotland. J. Med. Microbiol. 2007, 56, 47–51. [Google Scholar] [CrossRef]
- Molins, C.R.; Sexton, C.; Young, J.W.; Ashton, L.V.; Pappert, R.; Beard, C.B.; Schriefer, M.E. Collection and Characterization of Samples for Establishment of a Serum Repository for Lyme Disease Diagnostic Test Development and Evaluation. J. Clin. Microbiol. 2014, 52, 3755–3762. [Google Scholar] [CrossRef]
- Cook, M.J.; Puri, B.K. Commercial Test Kits for Detection of Lyme Borreliosis: A Meta-Analysis of Test Accuracy. Int. J. Gen. Med. 2016, 9, 427–440. [Google Scholar] [CrossRef]
- Valasek, M.A.; Repa, J.J. The Power of Real-Time PCR. Am. J. Physiol. -Adv. Physiol. Educ. 2005, 29, 151–159. [Google Scholar] [CrossRef] [PubMed]
- Navarro, E.; Serrano-Heras, G.; Castaño, M.J.; Solera, J. Real-Time PCR Detection Chemistry. Clin. Chim. Acta 2015, 439, 231–250. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.; et al. The Need for Transparency and Good Practices in the QPCR Literature. Nat. Methods 2013, 10, 1063–1067. [Google Scholar] [CrossRef]
- Burkardt, H.J. Standardization and Quality Control of PCR Analyses. Clin. Chem. Lab. Med. 2000, 38, 87–91. [Google Scholar] [CrossRef]
- Lebech, A.-M.; Hansen, K. Detection of Borrelia Burgdorferi DNA in Urine Samples and Cerebrospinal Fluid Samples from Patients with Early and Late Lyme Neuroborreliosis by Polymerase Chain. Reaction. J. Clin. Microbiol. 1992, 30, 1646–1653. [Google Scholar] [CrossRef]
- Goodman, J. Nucleic Acid Detection of Borrelia burgdorferi Infection. In Lyme Disease; Coyle, P., Ed.; Mosby-Year Book Inc.: St. Louis, MO, USA, 1993; pp. 127–135. [Google Scholar]
- Goodman, J.; Bradley, J.; Ross, A.; Goellner, P.; Lagus, A.; Vitale, B.; Berger, B.; Luger, S.; Johnson, R. Bloodstream Invasion in Early Lyme Disease: Results from a Prospective, Controlled, Blinded Study Using Polymerase Chain Reaction. Am. J. Med. 1995, 99, 6–12. [Google Scholar] [CrossRef]
- Schmidt, B.L. PCR in Laboratory Diagnosis of Human. Borrelia burgdorferi Infections. Clin. Microbiol. Rev. 1997, 10, 185–201. [Google Scholar] [CrossRef]
- Tilly, K.; Rosa, P.A.; Stewart, P.E. Biology of Infection with Borrelia burgdorferi. Infect. Dis. Clin. North Am. 2008, 22, 217–234. [Google Scholar] [CrossRef]
- Trevisan, G.; Bonin, S.; Ruscio, M. A Practical Approach to the Diagnosis of Lyme Borreliosis: From Clinical Heterogeneity to Laboratory Methods. Front. Med. 2020, 7, 265. [Google Scholar] [CrossRef]
- Brunet, L.; Spielman, A.; Telford, S. Short Report: Density of Lyme Disease Spirochetes within Deer Ticks Collected from Zoonotic Sites. Am. J. Trop. Med. Hyg. 1995, 53, 300–302. [Google Scholar] [CrossRef] [PubMed]
- Rauter, C.; Oehme, R.; Diterich, I.; Engele, M.; Hartung, T. Distribution of Clinically Relevant Borrelia Genospecies in Ticks Assessed by a Novel, Single-Run, Real-Time PCR. J. Clin. Microbiol. 2002, 40, 36–43. [Google Scholar] [CrossRef] [PubMed]
- Wilhelmsson, P.; Lindblom, P.; Fryland, L.; Ernerudh, J.; Forsberg, P.; Lindgren, P.E. Prevalence, Diversity, and Load of Borrelia Species in Ticks That Have Fed on Humans in Regions of Sweden and Åland Islands, Finland with Different Lyme Borreliosis Incidences. PLoS ONE 2013, 8, e81433. [Google Scholar] [CrossRef] [PubMed]
- Mackay, I.M. Real-Time PCR in the Microbiology Laboratory. Clin. Microbiol. Infect. 2004, 10, 190–212. [Google Scholar] [CrossRef] [PubMed]
- Espy, M.J.; Uhl, J.R.; Sloan, L.M.; Buckwalter, S.P.; Jones, M.F.; Vetter, E.A.; Yao, J.D.C.; Wengenack, N.L.; Rosenblatt, J.E.; Cockerill, F.R.; et al. Erratum: Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing. Clin. Microbiol. Rev. 2006, 19, 595. [Google Scholar] [CrossRef]
- Raymaekers, M.; Smets, R.; Maes, B.; Cartuyvels, R. Checklist for Optimization and Validation of Real-Time PCR Assays. J. Clin. Lab. Anal. 2009, 23, 145–151. [Google Scholar] [CrossRef]
- Maurin, M. Real-Time PCR as a Diagnostic Tool for Bacterial Diseases. Expert. Rev. Mol. Diagn. 2012, 12, 731–754. [Google Scholar] [CrossRef]
- Kralik, P.; Ricchi, M. A Basic Guide to Real Time PCR in Microbial Diagnostics: Definitions, Parameters, and Everything. Front. Microbiol. 2017, 8, 108. [Google Scholar] [CrossRef]
- Wilson, I.G. Inhibition and Facilitation of Nucleic Acid Amplification. Appl. Environ. Microbiol. 1997, 63, 3741–3751. [Google Scholar] [CrossRef]
- Schrader, C.; Schielke, A.; Ellerbroek, L.; Johne, R. PCR Inhibitors—Occurrence, Properties and Removal. J. Appl. Microbiol. 2012, 113, 1014–1026. [Google Scholar] [CrossRef]
- Longo, M.C.; Berninger, M.S.; Hartley, J.L. Use of Uracil DNA Glycosylase to Control Carry-over Contamination in Polymerase Chain Reactions. Gene 1990, 93, 125–128. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Liveris, D.; Mukherjee, P.; Jungnick, S.; Margos, G.; Schwartz, I. Molecular Typing of Borrelia burgdorferi. Curr. Prot. Microbiol. 2015, 34, 12C.5.1–12C.5.31. [Google Scholar] [CrossRef]
- Wang, G.; Iyer, R.; Bittker, S.; Cooper, D.; Wormser, G.P.; Schwartz, I. Assessment of Variations in BSK Culture Medium on Infectivity and Pathogenicity of Borrelia burgdorferi Clinical Isolates. Abstr. General. Meet. Am. Soc. Microbiol. 2004, 104, 196. [Google Scholar]
- Wang, G.; Iyer, R.; Bittker, S.; Cooper, D.; Small, J.; Wormser, G.P.; Schwartz, I. Variations in Barbour-Stoenner-Kelly Culture Medium Modulate Infectivity and Pathogenicity of Borrelia burgdorferi Clinical Isolates. Infect. Immun. 2004, 72, 6702–6706. [Google Scholar] [CrossRef] [PubMed]
- Veinović, G.; Ćakić, S.; Mihaljica, D.; Sukara, R.; Tomanović, S. Comparison of Growth and Morphology of Borrelia burgdorferi Sensu Lato in BSK-H and BSK-II Media Stored for Prolonged Periods. Apmis 2020, 128, 552–557. [Google Scholar] [CrossRef]
- Guérin, M.; Shawky, M.; Zedan, A.; Octave, S.; Avalle, B.; Maffucci, I.; Padiolleau-Lefèvre, S. Lyme Borreliosis Diagnosis: State of the Art of Improvements and Innovations. BMC Microbiol. 2023, 23, 204. [Google Scholar] [CrossRef]
- Berthold, A.; Faucillion, M.-L.; Nilsson, I.; Golovchenko, M.; Lloyd, V.; Bergström, S.; Rudenko, N. Cultivation Methods of Spirochetes from Borrelia burgdorferi Sensu Lato Complexe and Relapsing Fever Borrelia. Jove 2022, 189, e64431. [Google Scholar]
- Lewis, J.; Kirby, A.M.; Harris, K.D.; Filiaggi, C.L.; Foley-Eby, A.; Mann, M.; Lieske, D.; Lloyd, V.K. Monitoring Risk: Tick and Borrelia Burgdorferi Public Participatory Surveillance in the Canadian Maritimes, 2012–2020. Pathogens 2021, 6, 1284. [Google Scholar] [CrossRef]
- Zinck, C.B.; Lloyd, V.K. Borrelia burgdorferi and Borrelia miyamotoi in Atlantic Canadian Wildlife. PLoS ONE 2022, 17, e0262229. [Google Scholar] [CrossRef]
- Middelveen, M.J.; Burke, J.; Sapi, E.; Bandoski, C.; Filush, K.R.; Wang, Y.; Franco, A.; Timmaraju, A.; Schlinger, H.A.; Mayne, P.J.; et al. Culture and Identification of Borrelia Spirochetes in Human Vaginal and Seminal Secretions. F1000Res 2014, 3, 309. [Google Scholar] [CrossRef]
- Middelveen, M.J.; Sapi, E.; Burke, J.; Filush, K.R.; Franco, A.; Fesler, M.C.; Stricker, R.B. Persistent Borrelia Infection in Patients with Ongoing Symptoms of Lyme Disease. Healthcare 2018, 6, 33. [Google Scholar] [CrossRef] [PubMed]
- Thornton, B.; Basu, C. Real-Time PCR (QPCR) Primer Design Using Free Online Software. Biochem. Mol. Biol. Educ. 2011, 39, 145–154. [Google Scholar] [CrossRef] [PubMed]
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA Primers for Amplification of Mitochondrial Cytochrome c Oxidase Subunit I from Diverse Metazoan Invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [PubMed]
- Johnson, R.C.; Schmid, G.P.; Hyde, F.W. Borrelia burgdorferi Sp. Nov.: Etiologic Agent of Lyme Disease. Int. J. Syst. Bacteriol. 1984, 34, 496–497. [Google Scholar] [CrossRef]
- Baranton, G.; Postic, D.; Girons, I.S.; Boerlin, P.; Piffaretti, J.-C.; Assous, M.; Grimonp, P.A.D. Delineation of Borrelia burgdorferi Sensu Stricto, Borrelia Garinii Sp. Nov., and Group VS461 Associated with Lyme Borreliosis. Int. J. Syst. Bacteriol. 1992, 42, 378–383. [Google Scholar] [CrossRef]
- Rudenko, N.; Golovchenko, M.; Hönig, V.; Mallátová, N.; Krbková, L.; Mikulášek, P.; Fedorova, N.; Belfiore, N.M.; Grubhoffer, L.; Lane, R.S.; et al. Detection of Borrelia burgdorferi Sensu Stricto OspC Alleles Associated with Human Lyme Borreliosis Worldwide in Non-Human-Biting Tick Ixodes affinis and Rodent Hosts in Southeastern United States. Appl. Environ. Microbiol. 2013, 79, 1444–1453. [Google Scholar] [CrossRef]
- Rudenko, N.; Golovchenko, M.; Clark, K.; Oliver, J.H.; Grubhoffer, L. Detection of Borrelia burgdorferi Sensu Stricto in Amblyomma Americanum Ticks in the Southeastern United States: The Case of Selective Compatibility. Emerg. Microbes Infect. 2016, 5, 1–3. [Google Scholar] [CrossRef]
- Kang, S.J.; Jang, C.S.; Son, J.M.; Hong, K.W. Comparison of Seven Commercial Taqman Master Mixes and Two Real-Time PCR Platforms Regarding the Rapid Detection of Porcine DNA. Food Sci. Anim. Resour. 2021, 41, 85–94. [Google Scholar] [CrossRef]
- Şen, Z.B.; Kara, N.T. Comparative Analysis of Commercial QPCR Master Mixes for Reliable Plant Telomere Length Measurement by Monochrome Multiplex QPCR. J. Plant Biochem. Biotechnol. 2024, 33, 92–96. [Google Scholar] [CrossRef]
- Okeyo, M.; Hartberger, C.; Margos, G.; Straubinger, R.K.; Sing, A.; Fingerle, V. Comparison of Methods for Economic and Efficient Tick and Borrelia DNA Purification. Ticks Tick. Borne Dis. 2019, 10, 1041–1045. [Google Scholar] [CrossRef]
- Ruiz-villalba, A.; Ruijter, J.M.; Hoff, M.J.B. Van Den Use and Misuse of C q in QPCR Data Analysis and Reporting. Life 2021, 11, 496. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Liveris, D.; Brei, B.; Wu, H.; Falco, R.C.; Fish, D.; Schwartz, I. Real-Time PCR for Simultaneous Detection and Quantification of Borrelia burgdorferi in Field-Collected Ixodes Scapularis Ticks from the Northeastern United States. Appl. Environ. Microbiol. 2003, 69, 4561–4565. [Google Scholar] [CrossRef] [PubMed]
- Jacquet, M.; Genné, D.; Belli, A.; Maluenda, E.; Sarr, A.; Voordouw, M.J. The Abundance of the Lyme Disease Pathogen Borrelia Afzelii Declines over Time in the Tick Vector Ixodes Ricinus. Parasit. Vectors 2017, 10, 257. [Google Scholar] [CrossRef] [PubMed]
- Landesman, W.J.; Mulder, K.; Page Fredericks, L.; Allan, B.F. Cross-Kingdom Analysis of Nymphal-Stage Ixodes scapularis Microbial Communities in Relation to Borrelia burgdorferi Infection and Load. FEMS Microbiol. Ecol. 2019, 95, fiz167. [Google Scholar] [CrossRef] [PubMed]
- Pukhovskaya, N.M.; Morozova, O.V.; Vysochina, N.P.; Belozerova, N.B.; Ivanov, L.I. Prevalence of Borrelia Burgdorferi Sensu Lato and Borrelia miyamotoi in Ixodid Ticks in the Far East of Russia. Int. J. Parasitol. Parasites Wildl. 2019, 8, 192–202. [Google Scholar] [CrossRef]
- Zhong, X.; Nouri, M.; Råberg, L. Colonization and Pathology of Borrelia afzelii in Its Natural Hosts. Ticks Tick. Borne Dis. 2019, 10, 822–827. [Google Scholar] [CrossRef]
- Schwartz, I.; Wormser, G.P.; Schwartz, J.J.; Cooper, D.; Weissensee, P.; Gazumyan, A.; Zimmermann, E.; Goldberg, N.S.; Bitker, S.; Campbell, G.L.; et al. Diagnosis of Early Lyme Disease by Polymerase Chain. Reaction Amplification and Culture of Skin Biopsies from Erythema Migrans Lesions. J. Clin. Microbiol. 1992, 30, 3082–3088. [Google Scholar] [CrossRef]
- Qiagen. DNeasy Blood & Tissue Handbook. 2023. Available online: https://www.scribd.com/document/727832120/HB-2061-004-HB-DNY-Blood-Tissue-0623-WW (accessed on 18 November 2024).
- Elias, A.; Bono, J.; Tilly, K.; Rosa, P. Growth of Infectious and Non-Infectious B. burgdorferi at Different Salt Concentrations. Wien. Klin. Wochenschr. 1998, 110, 863–865. [Google Scholar]
- Heroldova, M.; Nemec, M.; Hubalek, Z. Growth Parameters of Borrelia burgdorferi Sensu Stricto at Various Temperatures. Zentbl. Bakteriol. 1998, 288, 451–455. [Google Scholar] [CrossRef]
- Zückert, W. Laboratory Maintenance of Borrelia burgdorferi. Curr. Protoc. Microbiol. 2007, 4, 12C-1. [Google Scholar] [CrossRef]
- Jutras, B.L.; Chenail, A.M.; Stevenson, B. Changes in Bacterial Growth Rate Govern Expression of the Borrelia burgdorferi OspC and Erp Infection-Associated Surface Proteins. J. Bacteriol. 2013, 195, 757–764. [Google Scholar] [CrossRef] [PubMed]
- Liang, L.; Wang, J.; Schorter, L.; Phong, T.; Trong, N.; Fell, S.; Ulrich, S.; Straubinger, R.K. Rapid Clearance of Borrelia burgdorferi from the Blood Circulation. Parasit. Vectors 2020, 13, 191. [Google Scholar] [CrossRef] [PubMed]
- Bosler, E.M.; Schulze, T.L. The Prevalence and Significance of Borrelia burgdorferi in the Urine of Feral Reservoir Hosts. Zentralblatt Bakteriol. Mikrobiol. Und Hyg. 1986, 263, 40–44. [Google Scholar] [CrossRef] [PubMed]
- Wright, S.D.; Nielsen, S.W. Experimental Infection of the White-Footed Mouse with Borrelia burgdorferi. Am. J. Vet. Res. 1990, 51, 1980–1987. [Google Scholar] [CrossRef]
- Burgess, E.C. Borrelia burgdorferi Infection in Wisconsin Horses and Cows. Ann. N. Y. Acad. Sci. 1988, 539, 235–243. [Google Scholar] [CrossRef]
- Grauer, G.F.; Burgess, E.C.; Cooley, A.J.; Hagee, J.H. Renal lesions associated with Borrelia burgdorferi infection in a dog. J. Am. Vet. Med. Assoc. 1988, 193, 237–239. [Google Scholar] [PubMed]
- Appel, M.J.; Allan, S.; Jacobson, R.H.; Lauderdale, T.L.; Chang, Y.F.; Shin, S.J.; Thomford, J.W.; Todhunter, R.J.; Summers, B.A. Experimental Lyme Disease in Dogs Produces Arthritis and Persistent Infection. J. Infect. Dis. 1993, 167, 651–654. [Google Scholar] [CrossRef]
- Lieske, D.J.; Lloyd, V.K. Combining Public Participatory Surveillance and Occupancy Modelling to Predict the Distributional Response of Ixodes Scapularis to Climate Change. Ticks Tick. Borne Dis. 2018, 9, 695–706. [Google Scholar] [CrossRef]
- Bouchard, C.; Dibernardo, A.; Koffi, J.; Wood, H.; Leighton, P.; Lindsay, L. Increased Risk of Tick-Borne Diseases with Climate and Environmental Changes. Can. Commun. Dis. Rep. 2019, 45, 83–89. [Google Scholar] [CrossRef]
Tick ID | Collection Date | Collection Location | Engorgement Status | Sex and Life Cycle | Host | Tick Attachment Status | Borrelia burgdorferi Testing 1 |
---|---|---|---|---|---|---|---|
T248 | 1 October | NB, CA | Engorged | Adult female | Canis familiaris | Attached | + |
T249 | 1 October | NB, CA | Engorged | Adult female | Canis familiaris | Attached | + |
T260 | 16 October | NB, CA | Highly engorged | Adult female | Canis familiaris | Attached | + |
T264 | 21 October | NB, CA | Highly engorged | Adult female | Canis familiaris | Attached | + |
T266 | 19 October | NB, CA | Engorged | Adult female | Canis familiaris | Attached | + |
T282 | 1 November | NB, CA | Highly engorged | Adult female | Canis familiaris | Attached | + |
T285 | 10 October | NB, CA | Highly engorged | Adult female | Canis familiaris | Attached | + |
T297 | October 2 | NB, CA | Engorged | Adult female | Felis catus | Attached | + |
T299 | 2 November | NB, CA | Highly engorged | Adult female | Canis familiaris | Attached | + |
T306 | 29 October | NB, CA | Engorged | Adult female | Canis familiaris | Unattached | + |
T326 | 10 November | NS, CA | Engorged | Adult female | Homo sapiens | Attached | + |
T375 | 14 November | NB, CA | Highly engorged | Adult female | Canis familiaris | Attached | + |
T383 | 21 November | NS, CA | Engorged | Adult female | Homo sapiens | Attached | + |
T388 | 16 November | NS, CA | Highly engorged | Adult female | Homo sapiens | Attached | + |
T389 | 16 November | NS, CA | Engorged | Adult female | Homo sapiens | Attached | + |
T408 | 21 November | NB, CA | Engorged | Adult female | Equus caballus | Attached | + |
T413 | 18 November | NB, CA | Engorged | Adult female | Canis familiaris | Attached | + |
T424 | 18 November | NB, CA | Engorged | Adult female | Canis familiaris | Attached | + |
T440 | 2 December | NB, CA | Engorged | Adult female | Canis familiaris | Unknown 2 | + |
T441 | 2 December | NB, CA | Engorged | Adult female | Canis familiaris | Unknown 2 | + |
T221 | 30 July | PE, CA | Engorged | Adult female | Felis catus | Attached | - |
T237 | 23 May | NB, CA | Engorged | Adult female | Homo sapiens | Attached | - |
T243 | 30 July | NB, CA | Engorged | Adult female | Canis familiaris | Attached | - |
T252 | 30 September | NB, CA | Engorged | Adult female | Canis familiaris | Attached | - |
T298 | October 2 | NB, CA | Highly engorged | Adult female | Felis catus | Attached | - |
T302 | 27 October | PE, CA | Engorged | Adult female | Canis familiaris | Attached | - |
T303 | 27 October | PE, CA | Engorged | Adult female | Canis familiaris | Attached | - |
T390 | 14 November | NS, CA | Engorged | Adult female | Homo sapiens | Attached | - |
T407 | 24 November | NB, CA | Engorged | Adult female | Canis familiaris | Attached | - |
T414 | 21 November | NB, CA | Engorged | Adult female | Canis familiaris | Attached | - |
T238 | 14 September | NB, CA | Highly engorged | Adult female | Bos taurus | Attached | Ambiguous |
T248 | 1 October | NB, CA | Engorged | Adult female | Canis familiaris | Attached | Ambiguous |
T249 | 1 October | NB, CA | Engorged | Adult female | Canis familiaris | Attached | Ambiguous |
T260 | 16 October | NB, CA | Highly engorged | Adult female | Canis familiaris | Attached | Ambiguous |
T285 | 10 October | NB, CA | Highly engorged | Adult female | Canis familiaris | Attached | Ambiguous |
T294 | 24 October | NB, CA | Highly engorged | Adult female | Canis familiaris | Attached | Ambiguous |
T359 | 13 November | PE, CA | Engorged | Adult female | Canis familiaris | Attached | Ambiguous |
T415 | 24 November | PE, CA | Engorged | Adult female | Canis familiaris | Attached | Ambiguous |
T423 | 28 November | NB, CA | Engorged | Adult female | Canis familiaris | Attached | Ambiguous |
T424 | 18 November | NB, CA | Engorged | Adult female | Canis familiaris | Attached | Ambiguous |
Sample ID 1 | Year of Collection | Source for the Collection | Species | Type of Tissue | Borrelia burgdorferi Testing 1 |
---|---|---|---|---|---|
C3K16 | 2016 | Cat kill | Microtus pennsylvanicus | Kidney | - |
C9K16 | 2016 | Cat kill | Microtus pennsylvanicus | Kidney | - |
C13K16 | 2016 | Cat kill | Microtus pennsylvanicus | Kidney | - |
C30K16 | 2016 | Cat kill | Peromyscus maniculatus | Kidney | - |
C50K16 | 2016 | Cat kill | Microtus pennsylvanicus | Kidney | - |
C54K16 | 2016 | Cat kill | Microtus pennsylvanicus | Kidney | - |
C70K16 | 2016 | Cat kill | Microtus pennsylvanicus | Kidney | - |
C94K16 | 2016 | Cat kill | Microtus pennsylvanicus | Kidney | - |
C99K16 | 2016 | Cat kill | Microtus pennsylvanicus | Kidney | - |
C113L16 | 2016 | Cat kill | Acanthis flammea | Liver | - |
C126K16 | 2016 | Cat kill | Microtus pennsylvanicus | Kidney | - |
C130K16 | 2016 | Cat kill | Microtus pennsylvanicus | Kidney | - |
C6K17 | 2017 | Cat kill | Zapus hudsonius | Kidney | - |
C6L17 | 2017 | Cat kill | Zapus hudsonius | Liver | - |
R1K16 | 2016 | Roadkill | Erethizon dorsatum | Liver | + |
R1L16 | 2016 | Roadkill | Zapus hudsonius | Liver | + |
R6L16 | 2016 | Roadkill | Corvus brachyrhynchos | Liver | + |
C5L16 | 2016 | Cat kill | Microtus pennsylvanicus | Liver | + |
C6K16 | 2016 | Cat kill | Zapus hudsonius | Kidney | + |
C8K16 | 2016 | Cat kill | Zapus hudsonius | Kidney | + |
C50k17 | 2017 | Cat kill | Blarina brevicauda | Kidney | + |
Donor Code 1 | Clinical Diagnosis 2 | Age 3 | Biological Sex | Lyme Serology 2 | Type of Sample | Sample Code 1 |
---|---|---|---|---|---|---|
L2 | Lyme | 62 | F | IgM pos | Genital sample | L2g1 |
IgG neg | Genital sample | L2g2 | ||||
Genital sample | L2g3 | |||||
L3 | Lyme | 65 | F | IFA Ind WB neg | Genital sample | L3g |
Periodontal sample | L3p | |||||
Urine sample | L3u | |||||
L5 | No diagnosis | 75 | F | WB Pos | Skin sample | L5s |
Urine sample | L5u | |||||
L6 | No diagnosis | 44 | M | WB Pos | Periodontal sample | L6p |
L7 | Lyme | 50 | M | WB Ind | Genital sample | L7g |
L12 | Lyme | 54 | F | WB Ind | Genital sample | L12g |
L20 | Suspicion | 63 | F | WB neg | Genital sample | L20g |
L35 | Suspicion | 64 | F | WB neg | Genital sample | L35g |
L37 | No diagnosis | Undisclosed 4 | F | Untested | Genital sample | L37g |
L70 | Suspicion | 80 | F | Untested | Genital sample | L70g |
Suspicion | 58 | F | Untested | Ankle synovial fluid | L72a | |
Genital sample | L72g | |||||
Knee synovial fluid | L72k1 | |||||
Knee synovial fluid | L72k2 | |||||
L73 | Suspicion | 63 | M | Untested | Seminal liquid sample | L73g |
L99 | No diagnosis | 41 | F | Untested | Genital sample | L99g |
L102 | No diagnosis | 53 | F | Untested | Genital sample | L102g |
Urine sample | L102u | |||||
L103 | No diagnosis | 38 | M | Untested | Genital sample | L103g |
C9 | Healthy | 30 | F | Untested | Blood sample | C9b |
C23 | Healthy | 59 | F | Untested | Blood sample | C23b |
C64 | Healthy | 59 | F | Untested | Blood sample | C64b |
C3 | Healthy | 29 | F | Untested | Genital sample | C3g |
C25 | Healthy | 59 | F | Untested | Genital sample | C25g |
C84 | Healthy | 60 | F | Untested | Genital sample | C84g |
Kit or Solution Used | Average DNA Concentration (ng/µL) 1 | Extraction Volume (µL) | Average Quantity (ng) 1 |
---|---|---|---|
AquaGenomic solution (MultiTarget Pharmaceuticals LLC) | 17.40 +/− 23.06 | 50 | 870 +/− 758.75 |
DNeasy Blood & Tissue kits (Qiagen) | 2.12 +/− 1.06 | 200 | 423.3 +/− 163.3 |
PureLink Genomic DNA kits (Thermo Fisher Scientific) | 12.17 +/− 7.86 | 50 | 608.3 +/− 294.4 |
Monarch Genomic DNA purification kit (New England Biolabs) | 4.7 +/− 2.45 | 100 | 470 +/− 180 |
Extracta DNA prep (Quantabio) | 114.4 +/− 21.02 | 200 | 22,876.7 +/− 3271.1 |
ID | Tissue | Species | Nested PCR 1 | Average Cq of qPCR without Pre-Amplification | Average Cq of qPCR with Pre-Amplification | Two Rounds of Conventional PCR 2 | Semi-Nested PCR 2 | ||||
---|---|---|---|---|---|---|---|---|---|---|---|
ospA | flaB | ospA | flaB | ospA | flaB | ospA | flaB | ||||
C3K16 | Microtus pennsylvanicus | Kidney | - | 22.6 | 23.2 | 19.3 | - | - | - | + | - |
C9K16 | Microtus pennsylvanicus | Kidney | - | - | - | - | - | Non- specific | - | No BLAST result 3 | - |
C13K16 | Microtus pennsylvanicus | Kidney | - | - | 33.7 | - | - | Non- specific | - | - | - |
C30K16 | Peromyscus maniculatus | Kidney | - | - | 34.3 | - | - | Non- specific | - | - | - |
C50K16 | Microtus pennsylvanicus | Kidney | - | - | - | - | - | - | Non- specific | - | - |
C54K16 | Microtus pennsylvanicus | Kidney | - | - | - | - | - | Non- specific | Non- specific | - | - |
C70K16 | Microtus pennsylvanicus | Kidney | - | - | - | 31.3 | - | - | - | + | - |
C94K16 | Microtus pennsylvanicus | Kidney | - | - | - | 28.3 | - | Non- specific | - | + | - |
C99K16 | Microtus pennsylvanicus | Kidney | - | - | - | - | - | Non- specific | - | - | - |
C113L16 | Acanthis flammea | Liver | - | - | - | - | - | - | - | - | - |
C126K16 | Microtus pennsylvanicus | Kidney | - | - | - | - | 39.1 | Non- specific | - | - | - |
C130K16 | Microtus pennsylvanicus | Kidney | - | - | - | - | - | Non- specific | - | - | - |
C6K17 | Zapus hudsonius | Kidney | - | - | - | 23.9 | - | - | - | + | + |
C6L17 | Zapus hudsonius | Liver | - | - | - | - | - | - | - | - | - |
R1K16 | Erethizon dorsatum | Liver | + | - | - | 30.9 | - | No BLAST result 3 | - | - | - |
R1L16 | Zapus hudsonius | Liver | + | - | - | 27.3 | - | - | - | + | - |
R6L16 | Corvus brachyrhynchos | Liver | + | - | - | 39.2 | - | - | - | No BLAST result 3 | - |
C5L16 | Microtus pennsylvanicus | Liver | + | - | - | - | - | No BLAST result 3 | - | - | - |
C6K16 | Zapus hudsonius | Kidney | + | - | - | - | - | No BLAST result 3 | - | - | - |
C8K16 | Zapus hudsonius | Kidney | + | - | - | - | - | - | - | - | - |
C50k17 | Blarina brevicauda | Kidney | + | - | - | - | 30.8 | - | - | No BLAST result 3 | No BLAST result 3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lewis, J.; Lloyd, V.K.; Robichaud, G.A. Development, Optimization, and Validation of a Quantitative PCR Assay for Borrelia burgdorferi Detection in Tick, Wildlife, and Human Samples. Pathogens 2024, 13, 1034. https://doi.org/10.3390/pathogens13121034
Lewis J, Lloyd VK, Robichaud GA. Development, Optimization, and Validation of a Quantitative PCR Assay for Borrelia burgdorferi Detection in Tick, Wildlife, and Human Samples. Pathogens. 2024; 13(12):1034. https://doi.org/10.3390/pathogens13121034
Chicago/Turabian StyleLewis, Julie, Vett K. Lloyd, and Gilles A. Robichaud. 2024. "Development, Optimization, and Validation of a Quantitative PCR Assay for Borrelia burgdorferi Detection in Tick, Wildlife, and Human Samples" Pathogens 13, no. 12: 1034. https://doi.org/10.3390/pathogens13121034
APA StyleLewis, J., Lloyd, V. K., & Robichaud, G. A. (2024). Development, Optimization, and Validation of a Quantitative PCR Assay for Borrelia burgdorferi Detection in Tick, Wildlife, and Human Samples. Pathogens, 13(12), 1034. https://doi.org/10.3390/pathogens13121034