The Detection of Chlamydia pneumoniae, Helicobacter pylori and Cytomegalovirus in Non-Atherosclerotic Arteries of Patients with Coronary Artery Disease
Abstract
1. Introduction
2. Materials and Methods
2.1. DNA Isolation
2.2. Real-Time Polymerase Chain Reaction (qPCR)
2.3. Statistical Analysis
3. Results
4. Discussion
Limitations
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- GBD 2017 Causes of Death Collaborators. Global, regional, and national age-sex-specific mortality for 282 causes of death in 195 countries and territories, 1980–2017: A systematic analysis for the Global Burden of Disease Study 2017. Lancet 2018, 392, 1736–1788. [Google Scholar] [CrossRef] [PubMed]
- Brown, J.C.; Gerhardt, T.E.; Kwon, E. Risk Factors for Coronary Artery Disease. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2023. [Google Scholar] [PubMed]
- Kucharska-Newton, A.; Griswold, M.; Yao, Z.H.; Foraker, R.; Rose, K.; Rosamond, W.; Wagenknecht, L.; Koton, S.; Pompeii, L.; Windham, B.G. Cardiovascular disease and patterns of change in functional status over 15 years: Findings from the atherosclerosis risk in communities (ARIC) study. J. Am. Heart Assoc. 2017, 6, e004144. [Google Scholar] [CrossRef] [PubMed]
- Calabro, P.; Willerson, J.T.; Yeh, E.T. Inflammatory cytokines stimulated C-reactive protein production by human coronary artery smooth muscle cells. Circulation 2003, 108, 1930–1932. [Google Scholar] [CrossRef]
- Alfarisi, H.A.H.; Mohamed, Z.B.H.; Ibrahim, M.B. Basic Pathogenic Mechanisms of Atherosclerosis. Egypt. J. Basic. Appl. Sci. 2020, 7, 116–125. [Google Scholar] [CrossRef]
- Zou, Y.; Huang, Y.; Liu, S.; Yang, J.; Zheng, W.; Deng, Y.; Zhang, M.; Yan, Z.; Xie, H. Periodontopathic Microbiota and Atherosclerosis: Roles of TLR-Mediated Inflammation Response. Oxidative Med. Cell. Longev. 2022, 2022, 9611362. [Google Scholar] [CrossRef]
- Xu, Z.; Li, J.; Wang, H.; Xu, G. Helicobacter Pylori Infection and Atherosclerosis: Is There a Causal Relationship? Eur. J. Clin. Microbiol. Infect. Dis. 2017, 36, 2293–2301. [Google Scholar] [CrossRef]
- Ciarambino, T.; Crispino, P.; Minervini, G.; Giordano, M. Role of Helicobacter pylori Infection in Pathogenesis, Evolution, and Complication of Atherosclerotic Plaque. Biomedicines 2024, 12, 400. [Google Scholar] [CrossRef]
- Dadashi, M.; Hajikhani, B.; Ghazi, M.; Yazdani, S.; Goudarzi, M.; Nasiri, M.J.; Shokouhi, S.; Owlia, P.; Yaslianifard, S. The global prevalence of Chlamydia pneumoniae, Helicobacter pylori, Cytomegalovirus and Herpes simplex virus in patients with coronary artery disease: A systematic review and meta-analysis. Microb. Pathog. 2021, 152, 104572. [Google Scholar] [CrossRef]
- Berquist, V.; Hoy, J.F.; Trevillyan, J.M. Contribution of Common Infections to Cardiovascular Risk in HIV-Positive Individuals. AIDS Rev. 2017, 19, 72–80. [Google Scholar]
- Wu, Y.P.; Sun, D.D.; Wang, Y.; Liu, W.; Yang, J. Herpes Simplex Virus Type 1 and Type 2 Infection Increases Atherosclerosis Risk: Evidence Based on a Meta-Analysis. BioMed Res. Int. 2016, 2016, 2630865. [Google Scholar] [CrossRef]
- Dhakal, B.P.; Sweitzer, N.K.; Indik, J.H.; Acharya, D.; William, P. SARS-CoV-2 Infection and Cardiovascular Disease: COVID-19 Heart. Heart Lung Circ. 2020, 29, 973–987. [Google Scholar] [CrossRef] [PubMed]
- Hooi, J.K.; Lai, W.Y.; Ng, W.K.; Suen, M.M.; Underwood, F.E.; Tanyingoh, D.; Malfertheiner, P.; Graham, D.Y.; Wong, V.W.; Wu, J.C.; et al. Global Prevalence of Helicobacter pylori Infection: Systematic Review and Meta-Analysis. Gastroenterology 2017, 153, 420–429. [Google Scholar] [CrossRef] [PubMed]
- Franceschi, F.; Gasbarrini, A.; Polyzos, S.A.; Kountouras, J. Extragastric Diseases and Helicobacter pylori. Helicobacter 2015, 20 (Suppl. S1), 40–46. [Google Scholar] [CrossRef]
- Kowalski, M. Helicobacter pylori (H. pylori) infection in coronary artery disease: Influence of H. pylori eradication on coronary artery lumen after percutaneous transluminal coronary angioplasty. The detection of H. pylori specific DNA in human coronary atherosclerotic plaque. J. Physiol. Pharmacol. 2001, 52 (Suppl. S1), 3–31. [Google Scholar] [PubMed]
- Wang, J.W.; Tseng, K.L.; Hsu, C.N. Association between Helicobacter pylori eradication and the risk of coronary heart diseases. PLoS ONE 2018, 13, e0190219. [Google Scholar] [CrossRef]
- Szwed, P.; Gąsecka, A.; Zawadka, M.; Eyileten, C.; Postuła, M.; Mazurek, T.; Szarpak, Ł.; Filipiak, K.J. Infections as Novel Risk Factors of Atherosclerotic Cardiovascular Diseases: Pathophysiological Links and Therapeutic Implications. J. Clin. Med. 2021, 10, 2539. [Google Scholar] [CrossRef]
- Britt, W. Manifestations of human cytomegalovirus infection: Proposed mechanisms of acute and chronic disease. Curr. Top. Microbiol. Immunol. 2008, 325, 417–470. [Google Scholar]
- Fowler, K.; Mucha, J.; Neumann, M.; Lewandowski, W.; Kaczanowska, M.; Grys, M.; Schmidt, E.; Natenshon, A.; Talarico, C.; Buck, P.O.; et al. A systematic literature review of the global seroprevalence of cytomegalovirus: Possible implications for treatment, screening, and vaccine development. BMC Public Health 2022, 22, 1659. [Google Scholar] [CrossRef]
- Xenaki, E.; Hassoulas, J.; Apostolakis, S.; Sourvinos, G.; Spandidos, D.A. Detection of cytomegalovirus in atherosclerotic plaques and nonatherosclerotic arteries. Angiology 2009, 60, 504–508. [Google Scholar] [CrossRef]
- Izadi, M.; Fazel, M.; Saadat, S.H.; Nasseri, M.H.; Ghasemi, M.; Dabiri, H.; Aryan, R.S.; Esfahani, A.A.; Ahmadi, A.; Kazemi-Saleh, D.; et al. Cytomegalovirus localization in atherosclerotic plaques is associated with acute coronary syndromes: Report of 105 patients. Methodist. DeBakey Cardiovasc. J. 2012, 8, 42. [Google Scholar] [CrossRef]
- Wang, H.; Peng, G.; Bai, J.; He, B.; Huang, K.; Hu, X.; Liu, D. Cytomegalovirus infection and relative risk of cardiovascular disease (ischemic heart disease, stroke, and cardiovascular death): A meta-analysis of prospective studies up to 2016. J. Am. Heart Assoc. 2017, 6, e005025. [Google Scholar] [CrossRef]
- Lv, Y.L.; Han, F.F.; Gong, L.L.; Liu, H.; Ma, J.; Yu, W.Y.; Wan, Z.R.; Jia, Y.J.; Zhang, W.; Shi, M.; et al. Human Cytomegalovirus Infection and Vascular Disease Risk: A Meta-Analysis. Virus Res. 2017, 227, 124–134. [Google Scholar] [CrossRef] [PubMed]
- Nikitskaya, E.; Lebedeva, A.; Ivanova, O.; Maryukhnich, E.; Shpektor, A.; Grivel, J.C.; Margolis, L.; Vasilieva, E. Cytomegalovirus-Productive Infection Is Associated with Acute Coronary Syndrome. J. Am. Heart Assoc. 2016, 5, e003759. [Google Scholar] [CrossRef]
- Besir Akpinar, M. A Hidden Organism, Chlamydia in the Age of Atherosclerosis; IntechOpen: London, UK, 2023. [Google Scholar] [CrossRef]
- Sessa, R.; Di Pietro, M.; Filardo, S.; Turriziani, O. Infectious burden and atherosclerosis: A clinical issue. World J. Clin. Cases 2014, 2, 240–249. [Google Scholar] [CrossRef]
- Khoshbayan, A.; Taheri, F.; Moghadam, M.T.; Chegini, Z.; Shariati, A. The association of Chlamydia pneumoniae infection with atherosclerosis: Review and update of in vitro and animal studies. Microb. Pathog. 2021, 154, 104803. [Google Scholar] [CrossRef]
- Ridker, P.M. Clinical application of C-reactive protein for cardiovascular disease detection and prevention. Circulation 2003, 107, 363–369. [Google Scholar] [CrossRef]
- Tishkowski, K.; Gupta, V. Erythrocyte Sedimentation Rate. In SatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2023. [Google Scholar] [PubMed]
- Valera Gasparoto, A.L.; da Rocha Martinez, T.L. Fibrinogen as a Cardiovascular Risk Marker. J. Intern. Med. Cardiovasc. Res. 2021, 1, 1–9. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Razeghian-Jahromi, I.; Elyaspour, Z.; Zibaeenezhad, M.J.; Hassanipour, S. Prevalence of Microorganisms in Atherosclerotic Plaques of Coronary Arteries: A Systematic Review and Meta-Analysis. Evid.-Based Complement. Altern. Med. 2022, 2022, 8678967. [Google Scholar] [CrossRef]
- Reszka, E.; Jegier, B.; Wasowicz, W.; Lelonek, M.; Banach, M.; Jaszewski, R. Detection of infectious agents by polymerase chain reaction in human aortic wall. Cardiovasc. Pathol. 2008, 17, 297–302. [Google Scholar] [CrossRef]
- Iriz, E.; Cirak, M.Y.; Engin, E.D.; Zor, M.H.; Erer, D.; Ozdogan, M.E.; Turet, S.; Yener, A. Detection of Helicobacter pylori DNA in aortic and left internal mammary artery biopsies. Tex. Heart Inst. J. 2008, 35, 130–135. [Google Scholar] [PubMed] [PubMed Central]
- Iriz, E.; Cirak, M.Y.; Zor, M.H.; Engin, D.; Oktar, L.; Unal, Y. Differential identification of atypical pneumonia pathogens in aorta and internal mammary artery related to ankle brachial index and walking distance. J. Surg. Res. 2013, 183, 537–541. [Google Scholar] [CrossRef] [PubMed]
- Izadi, M.; Fazel, M.; Sharubandi, S.H.; Saadat, S.H.; Farahani, M.M.; Nasseri, M.H.; Dabiri, H.; SafiAryan, R.; Esfahani, A.A.; Ahmadi, A.; et al. Helicobacter species in the atherosclerotic plaques of patients with coronary artery disease. Cardiovasc. Pathol. 2012, 21, 307–311. [Google Scholar] [CrossRef]
- Kilic, A.; Onguru, O.; Tugcu, H.; Kilic, S.; Guney, C.; Bilge, Y. Detection of cytomegalovirus and Helicobacter pylori DNA in arterial walls with grade III atherosclerosis by PCR. Pol. J. Microbiol. 2006, 55, 333–337. [Google Scholar] [PubMed]
- Heybar, H.; Alavi, S.M.; Farashahi Nejad, M.; Latifi, M. Cytomegalovirus infection and atherosclerosis in candidate of coronary artery bypass graft. Jundishapur J. Microbiol. 2015, 8, e15476. [Google Scholar] [CrossRef]
- Jia, Y.J.; Liu, J.; Han, F.F.; Wan, Z.R.; Gong, L.L.; Liu, H.; Zhang, W.; Wardell, T.; Lv, Y.L.; Liu, L.H. Cytomegalovirus infection and atherosclerosis risk: A meta-analysis. J. Med. Virol. 2017, 89, 2196–2206. [Google Scholar] [CrossRef]
- Taylor-Robinson, D.; Thomas, B.J.; Goldin, R.; Stanbridge, R. Chlamydia pneumoniae in infrequently examined blood vessels. J. Clin. Pathol. 2002, 55, 218–220. [Google Scholar] [CrossRef][Green Version]
- Adiloglu, A.K.; Ocal, A.; Can, R.; Duver, H.; Yavuz, T.; Aridogan, B.C. Detection of Helicobacter pylori and Chlamydia pneumoniae DNA in human coronary arteries and evaluation of the results with serologic evidence of inflammation. Saudi Med. J. 2005, 26, 1068–1074. [Google Scholar] [PubMed]
- Pucar, A.; Milasin, J.; Lekovic, V.; Vukadinovic, M.; Ristic, M.; Putnik, S.; Kenney, E.B. Correlation between atherosclerosis and periodontal putative pathogenic bacterial infections in coronary and internal mammary arteries. J. Periodontol. 2007, 78, 677–682. [Google Scholar] [CrossRef]
- Lee, M.; Baek, H.; Park, J.S.; Kim, S.; Kyung, C.; Baik, S.J.; Lee, B.K.; Kim, J.-H.; Ahn, C.W.; Kim, K.R.; et al. Current Helicobacter pylori infection is significantly associated with subclinical coronary atherosclerosis in healthy subjects: A cross-sectional study. PLoS ONE 2018, 13, e0193646. [Google Scholar] [CrossRef]
- Xia, X.; Zhang, L.; Xu, C.; Hong, H.; Liu, Z. Helicobacter pylori Infection and Endothelial Dysfunction. In Helicobacter pylori—From First Isolation to 2021; IntechOpen: London, UK, 2021. [Google Scholar] [CrossRef]
- Karbasi-Afshar, R.; Khedmat, H.; Izadi, M. Helicobacter Pylori Infection and Atherosclerosis: A Systematic Review. Acta Med. Iran. 2015, 53, 78–88. [Google Scholar] [PubMed]
- Xu, C.; Yan, M.; Sun, Y.; Joo, J.; Wan, X.; Yu, C.; Wang, Q.; Shen, C.; Chen, P.; Li, Y.; et al. Prevalence of Helicobacter pylori infection and its relation with body mass index in a Chinese population. Helicobacter 2014, 19, 437–442. [Google Scholar] [CrossRef] [PubMed]
- Mohammadzadeh, E.; Jalali-Jalalabadi, H.; Abdolahinia, E.D.; Narimisa, N. The effect of Chlamydia pneumoniae infection on serum lipid profile: A systematic review and meta-analysis. Gene Rep. 2022, 27, 101585. [Google Scholar] [CrossRef]
- Filardo, S.; Di Pietro, M.; Farcomeni, A.; Schiavoni, G.; Sessa, R. Chlamydia pneumoniae-Mediated Inflammation in Atherosclerosis: A Meta-Analysis. Mediators Inflamm. 2015, 2015, 378658. [Google Scholar] [CrossRef]
- Yusuf, S.W.; Mishra, R.M. Effect of Helicobacter pylori infection on fibrinogen level in elderly patients with ischaemic heart disease. Acta Cardiol. 2002, 57, 317–322. [Google Scholar] [CrossRef]
- Kountouras, J.; Polyzos, S.A.; Katsinelos, P.; Zeglinas, C.; Artemaki, F.; Tzivras, D.; Vardaka, E.; Gavalas, E.; Romiopoulos, I.; Simeonidou, C.; et al. Cardio-cerebrovascular disease and Helicobacter pylori-related metabolic syndrome: We consider eradication therapy as a potential cardio-cerebrovascular prevention strategy. Int. J. Cardiol. 2017, 229, 17–18. [Google Scholar] [CrossRef] [PubMed]
- Pan, W.; Zhang, H.; Wang, L.; Zhu, T.; Chen, B.; Fan, J. Association between Helicobacter pylori infection and kidney damage in patients with peptic ulcer. Ren. Fail. 2019, 41, 1028–1034. [Google Scholar] [CrossRef]
- Wijarnpreecha, K.; Thongprayoon, C.; Nissaisorakarn, P.; Jaruvongvanich, V.; Nakkala, K.; Rajapakse, R.; Cheungpasitporn, W. Association of Helicobacter pylori with chronic kidney diseases: A meta-analysis. Dig. Dis. Sci. 2017, 62, 2045–2052. [Google Scholar] [CrossRef]
- Shin, S.P.; Bang, C.S.; Lee, J.J.; Baik, G.H. Helicobacter pylori Infection in Patients with Chronic Kidney Disease: A Systematic Review and Meta-Analysis. Gut Liver 2019, 13, 628–641. [Google Scholar] [CrossRef]
- Lu, L.J.; Hao, N.B.; Liu, J.J.; Li, X.; Wang, R.L. Correlation between Helicobacter pylori infection and metabolic abnormality in general population: A cross-sectional study. Gastroenterol. Res. Pract. 2018, 2018, 7410801. [Google Scholar] [CrossRef]
- Oruç, M.; Köroğlu, E. Helicobacter pylori infection and kidney damage: Is there an association? Cerrahpaşa Med. J. 2022, 46, 50–55. [Google Scholar]
- Wang, X.; Jia, Z.; Zhang, Y.; Kou, C.; Jiang, J. Association of Helicobacter pylori infection with estimated glomerular filtration rate in a Chinese population. Infect. Genet. Evol. 2021, 96, 105102. [Google Scholar] [CrossRef] [PubMed]
- Landry, A.; Docherty, P.; Ouellette, S.; Cartier, L.J. Causes and outcomes of markedly elevated C-reactive protein levels. Can. Fam. Physician 2017, 63, e316–e323. [Google Scholar] [PubMed] [PubMed Central]
- Osler, W. Modern Medicine It’s Theory and Practice Volume IV Diseases of the Circulatory System; Lea & Febiger: Philadelphia, PA, USA, 1915. [Google Scholar]
- Lusta, K.A.; Poznyak, A.V.; Sukhorukov, V.N.; Eremin, I.I.; Nadelyaeva, I.I.; Orekhov, A.N. Hypotheses on Atherogenesis Triggering: Does the Infectious Nature of Atherosclerosis Development Have a Substruction? Cells 2023, 12, 707. [Google Scholar] [CrossRef]

| Microorganism/Gene | Primers (5′-3′)/Probe |
|---|---|
| Chlamydia pneumoniae | Forward—GTTGTTCATGAAGGCCTACT Reverse—TGCATAACCTACGGTGTGTT |
| Helicobacter pylori | Forward—CGCTGAAATCTCTCTTTATG) Reverse—CATGCTTTGATTGCCGATAGC |
| Cytomegalovirus | Forward—GAAGGTGCAGGTGCCCTG Reverse—GTCTCGACGAACGACGTACG |
| Glyceraldehyde 3-phosphate dehydrogenase | Forward—GGGCTCTCCAGAACATCATCC Reverse—GTCCACCACTGACACGTTGG Probe—FAM-CCTCTACTGGCGCTGCCAAGGCT-TAMRA |
| Variables | n = 56 (%) |
|---|---|
| Sex, n (%) male female | 48 (85.7%) 8 (14.3%) |
| Age, years, mean ± SD | 64.7 ± 8.8 |
| BMI, kg/m2, mean ± SD | 26.7 ± 3.6 |
| BMI category, n (%) normal overweight obesity | 19 (33.9%) 25 (44.6%) 12 (21.4%) |
| Diagnosis on admission, n (%) Stabile AP NSAP IM | 14 (25.0%) 25 (44.6%) 17 (30.4%) |
| Smoking, n (%) smoker non-smoker | 22 (39.3%) 34 (60.7%) |
| Stenosis, n (%) LM LAD CX RCA | 27 (48.2%) 53 (94.6%) 46 (82.1%) 44 (78.6%) |
| Rhythm disorder, n (%) Atrial fibrillation Ventricular tachycardia/V. Fibrillation Ventricular extrasystole | 11 (19.6%) 2 (3.6%) 3 (5.4%) |
| Laboratory Parameters | Value | Reference Values and Units |
|---|---|---|
| CRP, median (range) | 40.80 (0.50–179.40) | 0–5 mg/dL |
| Fibrinogen, mean ± SD | 4.29 ± 1.06 | 2–4 g/L |
| ESR, median (range) | 23.00 (2.00–95.00) | 2–12 mm/h |
| Total cholesterol, mean ± SD | 4.53 ± 1.34 | <5.2 mmol/L |
| HDL-C, mean ± SD | 1.10 ± 0.34 | >1.3 mmol/L |
| LDL-C, median (range) | 2.31 (0.86–8.50) | <3.3 mmol/L |
| Triglycerides, median (range) | 1.62 (0.42–4.90) | <1.7 mmol/L |
| Urea, mean ± SD | 7.51 ± 2.48 | 2.8–8.3 mmol/L |
| Creatinine, mean ± SD | 101.12 ± 32.97 | 62–103 umol/L |
| eGFR, mean ± SD | 55.61 ± 9.29 | >60 mL/min |
| Uric acid, mean ± SD | 385.61 ± 130.45 | 142–416 umol/L |
| Leukocytes, mean ± SD | 9.50 ± 2.67 | 3.9–10 × 109/L |
| Erythrocytes, mean ± SD | 4.18 ± 0.80 | 3.86 × 1012/L–5.08 × 1012/L (female) 4.34 × 1012/L–5.72 × 1012/L (male) |
| Hemoglobin, mean ± SD | 126.41 ± 22.71 | 110–150 g/L (female) 120–160 g/L (male) |
| Hematocrit, mean ± SD | 0.37 ± 0.07 | 0.36–0.47 l/L (female) 0.41–0.53 l/L (male) |
| Platelets, mean ± SD | 202.77 ± 54.47 | 140–450 × 109/L |
| Dependent Variable | HP Presence | Cpn Presence | CMV Presence |
|---|---|---|---|
| CRP | B = 24.344 p = 0.159 | B = 24.584 p = 0.349 | B = 7.656 p = 0.761 |
| Fibrinogen | B = 0.989 p = 0.016 * | B = −1.509 p = 0.016 * | B = 1.136 p = 0.057 |
| ESR | B = 7.734 p = 0.352 | B = −37.796 p = 0.004 * | B = 42.571 p = 0.001 * |
| Total cholesterol | B = −0.020 p = 0.972 | B = 0.314 p = 0.708 | B = −0.691 p = 0.394 |
| HDL-C | B = 0.252 p = 0.066 | B = −0.252 p = 0.225 | B = 0.070 p = 0.726 |
| LDL-C | B = −0.217 p = 0.712 | B = 0.364 p = 0.685 | B = −0.815 p = 0.347 |
| Triglycerides | B = −0.380 p = 0.346 | B = 0.374 p = 0.543 | B = −0.071 p = 0.904 |
| Urea | B = 1.693 p = 0.064 | B = 3.037 p = 0.031 * | B = −3.816 p = 0.005 * |
| Creatinine | B = 25.492 p = 0.055 | B = −5.641 p = 0.777 | B = −13.395 p = 0.485 |
| eGFR | B = −8.887 p = 0.016 * | B = 2.031 p = 0.710 | B = 5.088 p = 0.335 |
| Dependent Variable | HP Presence | Cpn Presence | CMV Presence |
|---|---|---|---|
| CRP | B = 23.173 p = 0.189 | B = 26.667 p = 0.321 | B = 12.980 p = 0.610 |
| Fibrinogen | B = 1.070 p = 0.010 * | B = −1.288 p = 0.039 * | B = 1.180 p = 0.046 * |
| ESR | B = 7.272 p = 0.396 | B = −37.045 p = 0.006 * | B = 44.636 p = 0.001 * |
| Total cholesterol | B = −0.226 p = 0.681 | B = 0.099 p = 0.906 | B = −0.456 p = 0.568 |
| HDL-C | B = 0.238 p = 0.075 | B = −0.227 p = 0.261 | B = 0.119 p = 0.533 |
| LDL-C | B = −0.362 p = 0.542 | B = 0.270 p = 0.766 | B = −0.580 p = 0.502 |
| Triglycerides | B = −0.476 p = 0.242 | B = 0.296 p = 0.632 | B = 0.087 p = 0.882 |
| Urea | B = 1.796 p = 0.048 * | B = 2.914 p = 0.037 * | B = −4.223 p = 0.002 * |
| Creatinine | B = 26.484 p = 0.050 * | B = −7.377 p = 0.716 | B = −17.143 p = 0.375 |
| eGFR | B = −9.447 p = 0.014 * | B = 1.122 p = 0.844 | B = 5.438 p = 0.318 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Šačić, D.; Tomić, U.; Milašin, J.; Putnik, S.; Jovanović, M.; Radojević Škodrić, S.; Glumac, S. The Detection of Chlamydia pneumoniae, Helicobacter pylori and Cytomegalovirus in Non-Atherosclerotic Arteries of Patients with Coronary Artery Disease. Pathogens 2024, 13, 927. https://doi.org/10.3390/pathogens13110927
Šačić D, Tomić U, Milašin J, Putnik S, Jovanović M, Radojević Škodrić S, Glumac S. The Detection of Chlamydia pneumoniae, Helicobacter pylori and Cytomegalovirus in Non-Atherosclerotic Arteries of Patients with Coronary Artery Disease. Pathogens. 2024; 13(11):927. https://doi.org/10.3390/pathogens13110927
Chicago/Turabian StyleŠačić, Dalila, Uroš Tomić, Jelena Milašin, Svetozar Putnik, Milena Jovanović, Sanja Radojević Škodrić, and Sofija Glumac. 2024. "The Detection of Chlamydia pneumoniae, Helicobacter pylori and Cytomegalovirus in Non-Atherosclerotic Arteries of Patients with Coronary Artery Disease" Pathogens 13, no. 11: 927. https://doi.org/10.3390/pathogens13110927
APA StyleŠačić, D., Tomić, U., Milašin, J., Putnik, S., Jovanović, M., Radojević Škodrić, S., & Glumac, S. (2024). The Detection of Chlamydia pneumoniae, Helicobacter pylori and Cytomegalovirus in Non-Atherosclerotic Arteries of Patients with Coronary Artery Disease. Pathogens, 13(11), 927. https://doi.org/10.3390/pathogens13110927

