The Outer Membrane Vesicles of Salmonella enterica Serovar Typhimurium Activate Chicken Immune Cells through Lipopolysaccharides and Membrane Proteins
Abstract
1. Introduction
2. Results
2.1. The Characterization of Salmonella OMVs
2.2. OMVs Stimulated Formation of Dendrites in Chicken Bone Marrow-Derived Monocytes (BMDMs) and HD11 Cells
2.3. OMVs Modulate Cytokine Production in HD11 Cells
2.4. OMVs Are Internalized by HD11 Cells
2.5. Salmonella OMVs Improve Phagocytic Capacities of HD11 Cells
2.6. Involvement of LPS and Proteins from OMVs in the Activation and Phagocytic Capability of the HD11 Cells and Chicken Splenic Mononuclear Cells
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Chicken Macrophage Cell Line
4.2. Isolation and Characterization of Salmonella OMVs
4.3. Cell Cultures
4.3.1. Generation of Chicken Bone Marrow-Derived Monocyte Cells (BMDMs)
4.3.2. Culture of HD11 Cultures
4.3.3. Preparation of Spleen Mononuclear Cells
4.4. Uptake of Salmonella OMVs by HD11 Cells
4.5. Phagocytic Activities of HD11 Cells
4.6. Treatments of OMVs with Polymyxin B and Proteinase K
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Interagency Food Safety Analytics Collaboration(IFSAC). Foodborne Illness Source Attribution Estimates for 2019 for Salmonella, Escherichia coli O157, Listeria monocytogenes, and Campylobacter Using Multi-Year Outbreak Surveillance Data; Centers for Disease Control and Prevention (CDC): Atlanta, GA, USA; U.S. Food and Drug Administration (FDA): Silver Spring, MD, USA; U.S. Department of Agriculture’s Food Safety and Inspection Service (USDA-FSIS): Washington, DC, USA, 2021.
- Desin, T.S.; Köster, W.; Potter, A.A. Salmonella vaccines in poultry: Past, present and future. Expert Rev. Vaccines 2013, 12, 87–96. [Google Scholar] [CrossRef] [PubMed]
- Azcarate-Peril, M.A.; Butz, N.; Cadenas, M.B.; Koci, M.; Ballou, A.; Mendoza, M.; Ali, R.; Hassan, H. An Attenuated Salmonella enterica Serovar Typhimurium Strain and Galacto-Oligosaccharides Accelerate Clearance of Salmonella Infections in Poultry through Modifications to the Gut Microbiome. Appl. Environ. Microbiol. 2018, 84, e02526-17. [Google Scholar] [CrossRef] [PubMed]
- van der Pol, L.; Stork, M.; van der Ley, P. Outer membrane vesicles as platform vaccine technology. Biotechnol. J. 2015, 10, 1689–1706. [Google Scholar] [CrossRef]
- Balhuizen, M.D.; Veldhuizen, E.J.A.; Haagsman, H.P. Outer Membrane Vesicle Induction and Isolation for Vaccine Development. Front. Microbiol. 2021, 12, 629090. [Google Scholar] [CrossRef] [PubMed]
- Alaniz, R.C.; Deatherage, B.L.; Lara, J.C.; Cookson, B.T. Membrane vesicles are immunogenic facsimiles of Salmonella typhimurium that potently activate dendritic cells, prime B and T cell responses, and stimulate protective immunity in vivo. J. Immunol. 2007, 179, 7692–7701. [Google Scholar] [CrossRef] [PubMed]
- Roy, K.; Hamilton, D.J.; Munson, G.P.; Fleckenstein, J.M. Outer membrane vesicles induce immune responses to virulence proteins and protect against colonization by enterotoxigenic Escherichia coli. Clin. Vaccine Immunol. 2011, 18, 1803–1808. [Google Scholar] [CrossRef] [PubMed]
- United States Food and Drug Administration. Research Vaccines Licensed for Use in the United States. 2016. Available online: https://www.fda.gov/BiologicsBloodVaccines/Vaccines/ApprovedProducts/ucm431374.htm (accessed on 3 January 2022).
- Liu, Q.; Liu, Q.; Yi, J.; Liang, K.; Hu, B.; Zhang, X.; Curtiss, R.; Kong, Q. Outer membrane vesicles from flagellin-deficient Salmonella enterica serovar Typhimurium induce cross-reactive immunity and provide cross-protection against heterologous Salmonella challenge. Sci. Rep. 2016, 6, 34776. [Google Scholar] [CrossRef]
- Iqbal, M.; Philbin, V.J.; Smith, A.L. Expression patterns of chicken Toll-like receptor mRNA in tissues, immune cell subsets and cell lines. Vet. Immunol. Immunopathol. 2005, 104, 117–127. [Google Scholar] [CrossRef] [PubMed]
- Kaufman, J.; Milne, S.; Göbel, T.W.; Walker, B.A.; Jacob, J.P.; Auffray, C.; Zoorob, R.; Beck, S. The chicken B locus is a minimal essential major histocompatibility complex. Nature 1999, 401, 923–925. [Google Scholar] [CrossRef]
- Lauvau, G.; Chorro, L.; Spaulding, E.; Soudja, S.M. Inflammatory monocyte effector mechanisms. Cell Immunol. 2014, 291, 32–40. [Google Scholar] [CrossRef]
- Jakubzick, C.V.; Randolph, G.J.; Henson, P.M. Monocyte differentiation and antigen-presenting functions. Nat. Rev. Immunol. 2017, 17, 349–362. [Google Scholar] [CrossRef] [PubMed]
- Singh, D.; Singh, M.; Chander, V.; Sharma, G.K.; Mahawar, M.; Teeli, A.S.; Goswami, T.K. Differential responses of chicken monocyte-derived dendritic cells infected with Salmonella Gallinarum and Salmonella Typhimurium. Sci. Rep. 2021, 11, 17214. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Morales, C.; Nandi, S.; Zhao, D.; Sauter, K.A.; Vervelde, L.; McBride, D.; Sang, H.M.; Clinton, M.; Hume, D.A. Cell-autonomous sex differences in gene expression in chicken bone marrow-derived macrophages. J. Immunol. 2015, 194, 2338–2344. [Google Scholar] [CrossRef] [PubMed]
- Gogoi, M.; Shreenivas, M.M.; Chakravortty, D. Hoodwinking the Big-Eater to Prosper: The Salmonella-Macrophage Paradigm. J. Innate Immun. 2019, 11, 289–299. [Google Scholar] [CrossRef] [PubMed]
- Eisele, N.A.; Ruby, T.; Jacobson, A.; Manzanillo, P.S.; Cox, J.S.; Lam, L.; Mukundan, L.; Chawla, A.; Monack, D.M. Salmonella require the fatty acid regulator PPARδ for the establishment of a metabolic environment essential for long-term persistence. Cell Host. Microbe 2013, 14, 171–182. [Google Scholar] [CrossRef] [PubMed]
- Aderem, A.; Underhill, D.M. Mechanisms of phagocytosis in macrophages. Annu. Rev. Immunol. 1999, 17, 593–623. [Google Scholar] [CrossRef] [PubMed]
- Jones, C.; Lee, C.K.; Ahn, C.; Shin, J.; Knezevic, I. Working Group on quality, safety and efficacy of typhoid Vi capsular polysaccharide conjugate, vaccines, Jeju, Republic of Korea, 5–7 September 2012. Vaccine 2013, 31, 4466–4469. [Google Scholar] [CrossRef] [PubMed]
- Hill, A.B.; Kilgore, C.; McGlynn, M.; Jones, C.H. Improving global vaccine accessibility. Curr. Opin. Biotechnol. 2016, 42, 67–73. [Google Scholar] [CrossRef]
- Knezevic, I. Stability evaluation of vaccines: WHO approach. Biologicals 2009, 37, 357–359. [Google Scholar] [CrossRef]
- Micoli, F.; MacLennan, C.A. Outer membrane vesicle vaccines. Semin. Immunol. 2020, 50, 101433. [Google Scholar] [CrossRef]
- Arigita, C.; Jiskoot, W.; Westdijk, J.; van Ingen, C.; Hennink, W.E.; Crommelin, D.J.A.; Kersten, G.F.A. Stability of mono- and trivalent meningococcal outer membrane vesicle vaccines. Vaccine 2004, 22, 629–642. [Google Scholar] [CrossRef]
- Bachmann, M.F.; Jennings, G.T. Vaccine delivery: A matter of size, geometry, kinetics and molecular patterns. Nat. Rev. Immunol. 2010, 10, 787–796. [Google Scholar] [CrossRef]
- Kim, O.Y.; Hong, B.S.; Park, K.-S.; Yoon, Y.J.; Choi, S.J.; Lee, W.H.; Roh, T.-Y.; Lötvall, J.; Kim, Y.-K.; Gho, Y.S. Immunization with Escherichia coli outer membrane vesicles protects bacteria-induced lethality via Th1 and Th17 cell responses. J. Immunol. 2013, 190, 4092–4102. [Google Scholar] [CrossRef] [PubMed]
- Peng, L.; Matthijs, M.G.R.; Haagsman, H.P.; Veldhuizen, E.J.A. Avian pathogenic Escherichia coli-induced activation of chicken macrophage HD11 cells. Dev. Comp. Immunol. 2018, 87, 75–83. [Google Scholar] [CrossRef]
- Elsheimer-Matulova, M.; Varmuzova, K.; Kyrova, K.; Havlickova, H.; Sisak, F.; Rahman, M.; Rychlik, I. phoP, SPI1, SPI2 and aroA mutants of Salmonella Enteritidis induce a different immune response in chickens. Vet. Res. 2015, 46, 96. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Mei, C.; Sun, A.H.; Blackall, P.J.; Xian, H.; Li, S.F.; Gong, Y.M.; Wang, H.J. Component Identification and Functional Analysis of Outer Membrane Vesicles Released by Avibacterium paragallinarum. Front. Microbiol. 2020, 11, 518060. [Google Scholar] [CrossRef] [PubMed]
- Doyle, S.E.; O’Connell, R.M.; Miranda, G.A.; Vaidya, S.A.; Chow, E.K.; Liu, P.T.; Suzuki, S.; Suzuki, N.; Modlin, R.L.; Yeh, W.C.; et al. Toll-like receptors induce a phagocytic gene program through p38. J. Exp. Med. 2004, 199, 81–90. [Google Scholar] [CrossRef]
- Hu, R.; Lin, H.; Li, J.; Zhao, Y.; Wang, M.; Sun, X.; Min, Y.; Gao, Y.; Yang, M. Probiotic Escherichia coli Nissle 1917-derived outer membrane vesicles enhance immunomodulation and antimicrobial activity in RAW264.7 macrophages. BMC Microbiol. 2020, 20, 268. [Google Scholar] [CrossRef]
- Oliveira, D.L.; Freire-de-Lima, C.G.; Nosanchuk, J.D.; Casadevall, A.; Rodrigues, M.L.; Nimrichter, L. Extracellular vesicles from Cryptococcus neoformans modulate macrophage functions. Infect. Immun. 2010, 78, 1601–1609. [Google Scholar] [CrossRef]
- Schwechheimer, C.; Kuehn, M.J. Outer-membrane vesicles from Gram-negative bacteria: Biogenesis and functions. Nat. Rev. Microbiol. 2015, 13, 605–619. [Google Scholar] [CrossRef]
- Schager, A.E.; Dominguez-Medina, C.C.; Necchi, F.; Micoli, F.; Goh, Y.S.; Goodall, M.; Flores-Langarica, A.; Bobat, S.; Cook, C.N.L.; Arcuri, M.; et al. IgG Responses to Porins and Lipopolysaccharide within an Outer Membrane-Based Vaccine against Nontyphoidal Develop at Discordant Rates. mBio 2018, 9, e02379-17. [Google Scholar] [CrossRef] [PubMed]
- Chu, J.; Li, X.; Qu, G.; Wang, Y.; Li, Q.; Guo, Y.; Hou, L.; Liu, J.; Eko, F.O.; He, C. Chlamydia psittaci PmpD-N Exacerbated Chicken Macrophage Function by Triggering Th2 Polarization and the TLR2/MyD88/NF-kappaB Signaling Pathway. Int. J. Mol. Sci. 2020, 21, 2003. [Google Scholar] [CrossRef] [PubMed]
- Vanaja, S.K.; Russo, A.J.; Behl, B.; Banerjee, I.; Yankova, M.; Deshmukh, S.D.; Rathinam, V.A.K. Bacterial Outer Membrane Vesicles Mediate Cytosolic Localization of LPS and Caspase-11 Activation. Cell 2016, 165, 1106–1119. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Hwang, I.; Lee, E.; Shin, S.J.; Lee, E.-J.; Rhee, J.H.; Yu, J.-W. Bacterial Outer Membrane Vesicle-Mediated Cytosolic Delivery of Flagellin Triggers Host NLRC4 Canonical Inflammasome Signaling. Front. Immunol. 2020, 11, 581165. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Ren, J.; Xian, H.; Yin, C.; Yuan, Y.; Li, Y.; Ji, R.; Chu, C.; Qiao, Z.; Jiao, X. rOmpF and OMVs as efficient subunit vaccines against Salmonella enterica serovar Enteritidis infections in poultry farms. Vaccine 2020, 38, 7094–7099. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.; Tong, C.; Ma, S.; Zhou, L.; Zhao, L.; Zhao, X. Involvement of MicroRNAs in Probiotics-Induced Reduction of the Cecal Inflammation by Salmonella Typhimurium. Front. Immunol. 2017, 8, 704. [Google Scholar] [CrossRef]
- Feng, J.; Wang, L.; Zhou, L.; Yang, X.; Zhao, X. Using In Vitro Immunomodulatory Properties of Lactic Acid Bacteria for Selection of Probiotics against Salmonella Infection in Broiler Chicks. PLoS ONE 2016, 11, e0147630. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Zhai, D.; Wu, Z.; Zhao, Y.; Qiao, D.; Zhao, X. Impairment of the Cell Wall Ligase, LytR-CpsA-Psr Protein (LcpC), in Methicillin Resistant Staphylococcus aureus Reduces Its Resistance to Antibiotics and Infection in a Mouse Model of Sepsis. Front. Microbiol. 2020, 11, 557. [Google Scholar] [CrossRef]
- Prados-Rosales, R.; Brown, L.; Casadevall, A.; Montalvo-Quirós, S.; Luque-Garcia, J.L. Isolation and identification of membrane vesicle-associated proteins in Gram-positive bacteria and mycobacteria. MethodsX 2014, 1, 124–129. [Google Scholar] [CrossRef]
- Willms, E.; Johansson, H.J.; Mager, I.; Lee, Y.; Blomberg, K.E.; Sadik, M.; Alaarg, A.; Smith, C.I.; Lehtio, J.; El Andaloussi, S.; et al. Cells release subpopulations of exosomes with distinct molecular and biological properties. Sci. Rep. 2016, 6, 22519. [Google Scholar] [CrossRef]
- Wu, Z.; Rothwell, L.; Young, J.R.; Kaufman, J.; Butter, C.; Kaiser, P. Generation and characterization of chicken bone marrow-derived dendritic cells. Immunology 2010, 129, 133–145. [Google Scholar] [CrossRef] [PubMed]
- Lin, J.; Xia, J.; Zhang, K.; Yang, Q. Genome-wide profiling of chicken dendritic cell response to infectious bursal disease. BMC Genom. 2016, 17, 878. [Google Scholar] [CrossRef] [PubMed]
- Pourabedin, M.; Chen, Q.; Yang, M.; Zhao, X. Mannan- and xylooligosaccharides modulate caecal microbiota and expression of inflammatory-related cytokines and reduce caecal Salmonella Enteritidis colonisation in young chickens. FEMS Microbiol. Ecol. 2017, 93, fiw226. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.I.; Kim, S.; Kim, E.; Hwang, S.Y.; Yoon, H. Secretion of Salmonella Pathogenicity Island 1-Encoded Type III Secretion System Effectors by Outer Membrane Vesicles in Salmonella enterica Serovar Typhimurium. Front. Microbiol. 2018, 9, e2810. [Google Scholar] [CrossRef] [PubMed]
- Ellis, T.N.; Leiman, S.A.; Kuehn, M.J. Naturally produced outer membrane vesicles from Pseudomonas aeruginosa elicit a potent innate immune response via combined sensing of both lipopolysaccharide and protein components. Infect. Immun. 2010, 78, 3822–3831. [Google Scholar] [CrossRef] [PubMed]
- Hui, W.W.; Hercik, K.; Belsare, S.; Alugubelly, N.; Clapp, B.; Rinaldi, C.; Edelmann, M.J. Salmonella enterica Serovar Typhimurium Alters the Extracellular Proteome of Macrophages and Leads to the Production of Proinflammatory Exosomes. Infect. Immun. 2018, 86, e00386-17. [Google Scholar] [CrossRef] [PubMed]
- Schromm, A.B.; Paulowski, L.; Kaconis, Y.; Kopp, F.; Koistinen, M.; Donoghue, A.; Keese, S.; Nehls, C.; Wernecke, J.; Garidel, P.; et al. Cathelicidin and PMB neutralize endotoxins by multifactorial mechanisms including LPS interaction and targeting of host cell membranes. Proc. Natl. Acad. Sci. USA 2021, 118, e2101721118. [Google Scholar] [CrossRef]








| Bacteria | Proteins (μg/1012 Particles) | LPS (μg/1012 Particles) | LPS Corresponding to Unit Protein |
|---|---|---|---|
| CVCC542 | 1342.15 ± 232.10 | 1038.19 ± 110.45 | 0.78 ± 0.06 |
| SALA | 1365.62 ± 224.33 | 958.49 ± 221.53 | 0.71 ± 0.11 |
| SALB | 1726.46 ± 587.41 | 1211.96 ± 200.42 | 0.73 ± 0.14 |
| p-value | 0.445 | 0.318 | 0.715 |
| Item | PBS | OMVs |
|---|---|---|
| FITC-Salmonella (MFI) | 13.37 b | 20.63 a |
| ±0.46 | ±0.59 | |
| FITC-dextran (MFI) | 179.33 b | 275 a |
| ±10.02 | ±17.58 | |
| Colony-forming unit (104 CFU/mL) | 50 b | 98.67 a |
| ±17 | ±15.14 |
| Gene | Sequence (5′−3′) | Product Size (bp) | GenBank Accession No. |
|---|---|---|---|
| LITAF [45] | F: TACCCTGTCCCACAACCTG | 152 | XM_015294125.2 |
| R: TGAACTGGGCGGTCATAGA | |||
| IL-6 [45] | F: ATCCCTCCTCGCCAATCT | 142 | NM_204628.1 |
| R: GGCACTGAAACTCCTGGTCT | |||
| iNOS (this study) | F: ATTGTGGAAGGACCGAGCTG | 141 | NM_204961.1 |
| R: CCTCGCACACGGTACTCATT | |||
| GAPDH [45] | F: TGGAGAAACCAGCCAAGTAT | 145 | NM_204305.1 |
| R: GCATCAAAGGTGGAGGAAT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cui, H.; Sun, Y.; Lin, H.; Zhao, Y.; Zhao, X. The Outer Membrane Vesicles of Salmonella enterica Serovar Typhimurium Activate Chicken Immune Cells through Lipopolysaccharides and Membrane Proteins. Pathogens 2022, 11, 339. https://doi.org/10.3390/pathogens11030339
Cui H, Sun Y, Lin H, Zhao Y, Zhao X. The Outer Membrane Vesicles of Salmonella enterica Serovar Typhimurium Activate Chicken Immune Cells through Lipopolysaccharides and Membrane Proteins. Pathogens. 2022; 11(3):339. https://doi.org/10.3390/pathogens11030339
Chicago/Turabian StyleCui, Hongxiao, Yajun Sun, Hua Lin, Yan Zhao, and Xin Zhao. 2022. "The Outer Membrane Vesicles of Salmonella enterica Serovar Typhimurium Activate Chicken Immune Cells through Lipopolysaccharides and Membrane Proteins" Pathogens 11, no. 3: 339. https://doi.org/10.3390/pathogens11030339
APA StyleCui, H., Sun, Y., Lin, H., Zhao, Y., & Zhao, X. (2022). The Outer Membrane Vesicles of Salmonella enterica Serovar Typhimurium Activate Chicken Immune Cells through Lipopolysaccharides and Membrane Proteins. Pathogens, 11(3), 339. https://doi.org/10.3390/pathogens11030339

