Molecular Detection and Phylogenetic Analysis of Tick-Borne Pathogens in Ticks Collected from Horses in the Republic of Korea
Abstract
:1. Introduction
2. Results
2.1. Prevalence of Ticks Infesting Horses in ROK
2.2. Detection of Tick-Borne Pathogens
2.3. Sequencing and Phylogenetic Analysis
3. Discussion
4. Materials and Methods
4.1. Tick Collection and Identification
4.2. Extraction of Nucleic Acids
4.3. Polymerase Chain Reaction (PCR) and Real-Time PCR
4.4. Phylogenetic Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Horse Industry Status Report (HISR), Ministry of Agriculture, Food and Rural Affairs. 2019. Available online: www.horsepia.com/industry/stat/horseAllStat.do (accessed on 10 February 2021).
- Kim, J.-Y. The Present Condition and Prospect of Korean Horse Industry. Int. J. Multimed. Ubiquitous Eng. 2015, 10, 119–124. [Google Scholar] [CrossRef]
- Laus, F.; Veronesi, F.; Passamonti, F.; Paggi, E.; Cerquetella, M.; Hyatt, D.; Tesei, B.; Fioretti, D.P. Prevalence of Tick Borne Pathogens in Horses from Italy. J. Vet. Med. Sci. 2013, 75, 715–720. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ueti, M.W.; Palmer, G.H.; Scoles, G.A.; Kappmeyer, L.; Knowles, D.P. Persistently Infected Horses Are Reservoirs for Intrastadial Tick-Borne Transmission of the Apicomplexan Parasite Babesia equi. Infect. Immun. 2008, 76, 3525–3529. [Google Scholar] [CrossRef] [Green Version]
- Chen, Z.; Liu, Q.; Liu, J.-Q.; Xu, B.-L.; Lv, S.; Xia, S.; Zhou, X.-N. Tick-borne pathogens and associated co-infections in ticks collected from domestic animals in central China. Parasites Vectors 2014, 7, 237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, Y.-J.; Park, J.; Lee, Y.-S.; Chae, J.-S.; Yu, D.-H.; Park, B.-K.; Kim, H.-C.; Choi, K.-S. Molecular identification of selected tick-borne pathogens in wild deer and raccoon dogs from the Republic of Korea. Vet. Parasitol. Reg. Stud. Rep. 2017, 7, 25–31. [Google Scholar] [CrossRef] [PubMed]
- Orkun, Ö.; Emir, H. Identification of tick-borne pathogens in ticks collected from wild animals in Turkey. Parasitol. Res. 2020, 119, 3083–3091. [Google Scholar] [CrossRef]
- Labruna, M.B.; Kasai, N.; Ferreira, F.; Faccini, J.L.; Gennari, S. Seasonal dynamics of ticks (Acari: Ixodidae) on horses in the state of São Paulo, Brazil. Vet. Parasitol. 2002, 105, 65–77. [Google Scholar] [CrossRef]
- Duell, J.R.; Carmichael, R.; Herrin, B.H.; Holbrook, T.C.; Talley, J.; Little, S.E. Prevalence and species of ticks on horses in central Oklahoma. J. Med. EÈntomol. 2013, 50, 1330–1333. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khoury, C.; Manilla, G.; Maroli, M. Le zecche parassite del cavallo in Italia. Osservazioni sulla distribuzione e sul ruolo patogeno [Parasitic horse ticks in Italy. Observations on their distribution and pathogenic role]. Parassitologia 1994, 36, 273–279. [Google Scholar]
- Camacho, A.T.; Guitian, J.; Pallas, E.; Gestal, J.J.; Olmeda, A.S.; Habela, M.A.; Iii, S.R.T.; Spielman, A. Theileria (Babesia) equi and Babesia caballi Infections in Horses in Galicia, Spain. Trop. Anim. Health Prod. 2005, 37, 293–302. [Google Scholar] [CrossRef]
- Chan, K.Y.; Wang, C.H.; Wu, Y.L. Serological Survey of Equine Piroplasmosis, Equine Granulocytic Anaplasmosis, and Equine Lyme Disease in Taiwan. Taiwan Vet. J. 2010, 36, 261–267. [Google Scholar]
- Engvall, E.O.; Pettersson, B.; Persson, M.; Artursson, K.; Johansson, K.E. A 16S rRNA-based PCR assay for detection and identification of granulocytic Ehrlichia species in dogs, horses, and cattle. J. Clin. Microbiol. 1996, 34, 2170–2174. [Google Scholar] [CrossRef] [Green Version]
- Teglas, M.; Matern, E.; Lein, S.; Foley, P.; Mahan, S.M.; Foley, J. Ticks and tick-borne disease in Guatemalan cattle and horses. Vet. Parasitol. 2005, 131, 119–127. [Google Scholar] [CrossRef] [PubMed]
- Aguero-Rosenfeld, M.E. Diagnosis of Human Granulocytic Ehrlichiosis: State of the Art. Vector-Borne Zoonotic Dis. 2002, 2, 233–239. [Google Scholar] [CrossRef]
- Strle, F. Human granulocytic ehrlichiosis in Europe. Int. J. Med. Microbiol. 2004, 293S, 27–35. [Google Scholar] [CrossRef]
- Seo, M.; Kwon, O.; Kwak, D. Diversity and genotypic analysis of tick-borne pathogens carried by ticks infesting horses in Korea. Med. Vet. EÈntomol. 2021, 35, 213–218. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.Y.; Jeong, Y.E.; Yun, S.-M.; Lee, I.Y.; Han, M.G.; Ju, Y.R. Molecular evidence for tick-borne encephalitis virus in ticks in South Korea. Med. Vet. EÈntomol. 2009, 23, 15–20. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.-O.; Na, D.-K.; Kim, C.-M.; Li, Y.-H.; Cho, Y.-H.; Park, J.-H.; Lee, J.-H.; Eo, S.-K.; A Klein, T.; Chae, J.-S. Identification and prevalence of Ehrlichia chaffeensis infection in Haemaphysalis longicornis ticks from Korea by PCR, sequencing and phylogenetic analysis based on 16S rRNA gene. J. Vet. Sci. 2005, 6, 151–155. [Google Scholar] [CrossRef] [PubMed]
- Seo, M.-G.; Kwon, O.-D.; Kwak, D. Molecular Identification of Borrelia afzelii from Ticks Parasitizing Domestic and Wild Animals in South Korea. Microorganisms 2020, 8, 649. [Google Scholar] [CrossRef] [PubMed]
- Im, J.H.; Baek, J.; Durey, A.; Kwon, H.Y.; Chung, M.-H.; Lee, J.-S. Current Status of Tick-Borne Diseases in South Korea. Vector-Borne Zoonotic Dis. 2019, 19, 225–233. [Google Scholar] [CrossRef]
- Lado, P.; Smith, M.L.; Carstens, B.C.; Klompen, H. Population genetic structure and demographic history of the lone star tick, Amblyomma americanum (Ixodida: Ixodidae): New evidence supporting old records. Mol. Ecol. 2020, 29, 2810–2823. [Google Scholar] [CrossRef]
- Macdonald, A.J. Abiotic and habitat drivers of tick vector abundance, diversity, phenology and human encounter risk in southern California. PLoS ONE 2018, 13, e0201665. [Google Scholar] [CrossRef] [Green Version]
- Fryxell, R.T.T.; Moore, J.E.; Collins, M.D.; Kwon, Y.; Jean-Philippe, S.R.; Schaeffer, S.M.; Odoi, A.; Kennedy, M.; Houston, A.E. Habitat and Vegetation Variables Are Not Enough When Predicting Tick Populations in the Southeastern United States. PLoS ONE 2015, 10, e0144092. [Google Scholar] [CrossRef]
- Uspensky, I. Tick pests and vectors (Acari: Ixodoidea) in European towns: Introduction, persistence and management. Ticks Tick-Borne Dis. 2014, 5, 41–47. [Google Scholar] [CrossRef]
- Valcárcel, F.; González, J.; Gonzalez, M.; Sánchez, M.; Tercero, J.M.; Elhachimi, L.; Carbonell, J.D.; Olmeda, A.S. Comparative Ecology of Hyalomma lusitanicum and Hyalomma marginatum Koch, 1844 (Acarina: Ixodidae). Insects 2020, 11, 303. [Google Scholar] [CrossRef] [PubMed]
- Kang, S.W.; Doan, H.T.T.; Choe, S.E.; Noh, J.H.; Yoo, M.S.; Reddy, K.E.; Kim, Y.H.; Kweon, C.H.; Jung, S.C.; Chang, K.Y. Molecular investigation of tick-borne pathogens in ticks from grazing cattle in Korea. Parasitol. Int. 2013, 62, 276–282. [Google Scholar] [CrossRef] [PubMed]
- Seo, H.-J.; Kim, K.-H.; Lee, S.K.; Min, S.; Lim, J.-Y.; Yang, S.-J.; Yoo, M.-S.; Jung, S.; Yoon, S.-S.; Cho, Y.S. Molecular and serological surveillance of equine piroplasmosis in the Republic of Korea between 2016 and 2017. Korean J. Vet. Res. 2021, 61, 4. [Google Scholar] [CrossRef]
- Sanders, D.M.; Parker, J.E.; Walker, W.W.; Buchholz, M.W.; Blount, K.; Kiel, J.L. Field collection and genetic classification of tick-borne Rickettsiae and Rickettsiae-like pathogens from South Texas: Coxiella burnetii isolated from field-collected Amblyomma cajennense. Ann. N. Y. Acad. Sci. 2008, 1149, 208–211. [Google Scholar] [CrossRef]
- Noden, B.H.; Martin, J.; Carrillo, Y.; Talley, J.L.; Ochoa-Corona, F. Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia. PLoS ONE 2018, 13, e0192331. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boulanger, N.; Boyer, P.; Talagrand-Reboul, E.; Hansmann, Y. Ticks and tick-borne diseases. Médecine Maladies Infectieuses 2019, 49, 87–97. [Google Scholar] [CrossRef]
- Saleem, S.; Ijaz, M.; Farooqi, S.H.; Ghaffar, A.; Ali, A.; Iqbal, K.; Mehmood, K.; Zhang, H. Equine Granulocytic Anaplasmosis 28 years later. Microb. Pathog. 2018, 119, 1–8. [Google Scholar] [CrossRef]
- Kim, C.M.; Kim, M.S.; Park, M.S.; Park, J.H.; Chae, J.S. Identification of Ehrlichia chaffeensis, Anaplasma phagocytophilum, and A. bovis in Haemaphysalis longicornis and Ixodes persulcatus ticks from Korea. Vector-Borne Zoonotic Dis. 2003, 3, 17–26. [Google Scholar] [CrossRef] [PubMed]
- Biggs, H.M.; Behravesh, C.B.; Bradley, K.K.; Dahlgren, F.; Drexler, N.A.; Dumler, J.S.; Folk, S.M.; Kato, C.Y.; Lash, R.R.; Levin, M.L.; et al. Diagnosis and Management of Tickborne Rickettsial Diseases: Rocky Mountain Spotted Fever and Other Spotted Fever Group Rickettsioses, Ehrlichioses, and Anaplasmosis—United States. MMWR Recomm. Rep. 2016, 65, 1–44. [Google Scholar] [CrossRef] [Green Version]
- Lee, S.-H.; Yun, S.-H.; Choi, E.; Park, Y.-S.; Lee, S.-E.; Cho, G.-J.; Kwon, O.-D.; Kwak, D. Serological Detection of Borrelia burgdorferi among Horses in Korea. Korean J. Parasitol. 2016, 54, 97–101. [Google Scholar] [CrossRef] [PubMed]
- Chomel, B. Lyme disease. Rev. Sci. Tech. 2015, 34, 569–576. [Google Scholar] [CrossRef] [PubMed]
- Seo, M.-G.; Ouh, I.-O.; Choi, E.; Kwon, O.-D.; Kwak, D. Molecular Detection and Phylogenetic Analysis of Anaplasma phagocytophilum in Horses in Korea. Korean J. Parasitol. 2018, 56, 559–565. [Google Scholar] [CrossRef]
- Battilani, M.; De Arcangeli, S.; Balboni, A.; Dondi, F. Genetic diversity and molecular epidemiology of Anaplasma. Infect. Genet. Evol. 2017, 49, 195–211. [Google Scholar] [CrossRef] [PubMed]
- Margos, G.; Notter, I.; Fingerle, V. Species Identification and Phylogenetic Analysis of Borrelia burgdorferi Sensu Lato Using Molecular Biological Methods. Adv. Struct. Saf. Stud. 2017, 1690, 13–33. [Google Scholar] [CrossRef]
- Urwin, R.; Maiden, M.C. Multi-locus sequence typing: A tool for global epidemiology. Trends Microbiol. 2003, 11, 479–487. [Google Scholar] [CrossRef]
- Hoogstraal, H.; Roberts, F.H.; Kohls, G.M.; Tipton, V.J. Review of Haemaphysalis (Kaiserinana) longicornis Neumann (resurrected) of Australia, New Zealand, New Caledonia, Fiji, Japan, Korea, and Norteastern China and USSR, and its parthenogenetic and bisexual populations (Ixodoidea, Ixodidae). J. Parasitol. 1968, 54, 1197–1213. [Google Scholar] [CrossRef] [Green Version]
- Hoogstraal, H.; Wassef, H.Y. The Haemaphysalis Ticks (Ixodoidea: Ixodidae) of Birds. 3. H. (Ornithophysalis) Subgen. N.: Definition, Species, Hosts, and Distribution in the Oriental, Palearctic, Malagasy, and Ethiopian Faunal Regions. J. Parasitol. 1973, 59, 1099. [Google Scholar] [CrossRef]
- Yamaguti, N.; Tipton, V.J.; Keegan, H.L.; Toshioka, S. Ticks of Japan, Korea, and the Ryukyu islands. Brigh. Young Univ. Sci. Bull. Biol. Ser. 1971, 15, 1–226. [Google Scholar]
- Kramer, V.L.; Gutierrez, A.G.; Hui, L.T.; E Irwin, W.; Randolph, M.P.; Vugia, D.J. Detection of the agents of human ehrlichioses in ixodid ticks from California. Am. J. Trop. Med. Hyg. 1999, 60, 62–65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ott, D.; Ulrich, K.; Ginsbach, P.; Öhme, R.; Bock-Hensley, O.; Falk, U.; Teinert, M.; Lenhard, T. Tick-borne encephalitis virus (TBEV) prevalence in field-collected ticks (Ixodes ricinus) and phylogenetic, structural and virulence analysis in a TBE high-risk endemic area in southwestern Germany. Parasites Vectors 2020, 13, 1–15. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alhassan, A.; Pumidonming, W.; Okamura, M.; Hirata, H.; Battsetseg, B.; Fujisaki, K.; Yokoyama, N.; Igarashi, I. Development of a single-round and multiplex PCR method for the simultaneous detection of Babesia caballi and Babesia equi in horse blood. Vet. Parasitol. 2005, 129, 43–49. [Google Scholar] [CrossRef] [PubMed]
- Sparagano, O.; Allsopp, M.; Mank, R.; Rijpkema, S.; Figueroa, J.; Jongejan, F. Molecular detection of pathogen DNA in ticks (Acari: Ixodidae): A review. Exp. Appl. Acarol. 1999, 23, 929–960. [Google Scholar] [CrossRef]
- Hancock, S.I.; Breitschwerdt, E.B.; Pitulle, C. Differentiation of Ehrlichia platys and E. equi Infections in Dogs by Using 16S Ribosomal DNA-Based PCR. J. Clin. Microbiol. 2001, 39, 4577–4578. [Google Scholar] [CrossRef] [Green Version]
- Anderson, B.E.; Sumner, J.W.; Dawson, J.E.; Tzianabos, T.; Greene, C.R.; Olson, J.G.; Fishbein, D.B.; Olsen-Rasmussen, M.; Holloway, B.P.; George, E.H. Detection of the etiologic agent of human ehrlichiosis by polymerase chain reaction. J. Clin. Microbiol. 1992, 30, 775–780. [Google Scholar] [CrossRef] [Green Version]
- Hersh, M.H.; Ostfeld, R.S.; McHenry, D.J.; Tibbetts, M.; Brunner, J.L.; Killilea, M.E.; Logiudice, K.; Schmidt, K.A.; Keesing, F. Co-Infection of Blacklegged Ticks with Babesia microti and Borrelia burgdorferi is Higher than Expected and Acquired from Small Mammal Hosts. PLoS ONE 2014, 9, e99348. [Google Scholar] [CrossRef]
- Zhai, B.; Niu, Q.; Yang, J.; Liu, Z.; Liu, J.; Yin, H.; Zeng, Q. Identification and molecular survey of Borrelia burgdorferi sensu lato in Sika deer (Cervus nippon) from Jilin Province, north-eastern China. Acta Trop. 2017, 166, 54–57. [Google Scholar] [CrossRef] [PubMed]
Metropolitan City and Province | Collecting Source | 2016 | 2017 | Total | |||||
---|---|---|---|---|---|---|---|---|---|
H. longicornis * | I. nipponensis * | H. longicornis * | |||||||
Larva | Nymph | Adult | Adult | Larva | Nymph | Adult | |||
Busan | Horse | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Vegetation | 2(1) | 2(1) | 0 | 0 | 0 | 148(17) | 8(8) | 160(27) | |
Subtotal | 2(1) | 2(1) | 0 | 0 | 0 | 148(17) | 8(8) | 160(27) | |
Gwangju | Horse | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Vegetation | 1(1) | 1(1) | 0 | 0 | 0 | 65(7) | 5(5) | 72(14) | |
Subtotal | 1(1) | 1(1) | 0 | 0 | 0 | 65(7) | 5(5) | 72(14) | |
Ulsan | Horse | 0 | 0 | 4(1) | 0 | 0 | 0 | 0 | 4(1) |
Vegetation | 81(2) | 101(7) | 14(4) | 0 | 0 | 0 | 0 | 196(13) | |
Subtotal | 81(2) | 101(7) | 18(5) | 0 | 0 | 0 | 0 | 200(14) | |
Gangwon | Horse | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Vegetation | 293(7) | 5(2) | 0 | 0 | 0 | 0 | 0 | 298(9) | |
Subtotal | 293(7) | 5(2) | 0 | 0 | 0 | 0 | 0 | 298(9) | |
Gyeonggi | Horse | 0 | 9(3) | 0 | 0 | 0 | 0 | 0 | 9(3) |
Vegetation | 0 | 134(9) | 0 | 4(3) | 81(3) | 375(45) | 11(11) | 605(71) | |
Subtotal | 0 | 143(12) | 0 | 4(3) | 81(3) | 375(45) | 11(11) | 614(74) | |
Gyeongsangbuk | Horse | 0 | 0 | 33(11) | 0 | 0 | 0 | 0 | 33(11) |
Vegetation | 60(2) | 128(5) | 32(7) | 0 | 0 | 0 | 0 | 220(14) | |
Subtotal | 60(2) | 128(5) | 65(18) | 0 | 0 | 0 | 0 | 253(25) | |
Gyeongsangnam | Horse | 0 | 0 | 3(2) | 0 | 0 | 0 | 0 | 3(2) |
Vegetation | 0 | 0 | 0 | 0 | 0 | 269(27) | 8(8) | 277(35) | |
Subtotal | 0 | 0 | 3(2) | 0 | 0 | 269(27) | 8(8) | 280(37) | |
Jeollabuk | Horse | 1(1) | 126(42) | 12(5) | 2(1) | 0 | 0 | 0 | 141(49) |
Vegetation | 0 | 108(8) | 2(2) | 0 | 0 | 3(2) | 2(2) | 115(14) | |
Subtotal | 1(1) | 234(50) | 14(7) | 2(1) | 0 | 3(2) | 2(2) | 256(63) | |
Jeollanam | Horse | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Vegetation | 2(1) | 6(2) | 0 | 0 | 0 | 361(38) | 11(11) | 380(52) | |
Subtotal | 2(1) | 6(2) | 0 | 0 | 0 | 361(38) | 11(11) | 380(52) | |
Jeju Island | Horse | 0 | 454(156) | 645(219) | 0 | 0 | 6(3) | 390(282) | 1495(660) |
Vegetation | 1746(37) | 2108(78) | 156(43) | 0 | 960(99) | 168(168) | 5138(425) | ||
Subtotal | 1746(37) | 2562(234) | 801(262) | 0 | 0 | 966(102) | 558(450) | 6633(1085) | |
Total | Horse | 1(1) | 589(201) | 698(237) | 2(1) | 0 | 6(3) | 390(282) | 1686(725) |
Vegetation | 2185(51) | 2657(121) | 213(62) | 4(3) | 81(3) | 2181(235) | 213(213) | 7534(688) | |
Subtotal | 2186(52) | 3246(322) | 911(299) | 6(4) | 81(3) | 2187(238) | 603(495) | 9220(1413) |
Spots | Colletion Source | 2016 | 2017 | Total | |||||
---|---|---|---|---|---|---|---|---|---|
H. longicornis ** | I. nipponensis ** | H. longicornis ** | |||||||
Larva | Nymph | Adult | Adult | Larva | Nymph | Adult | |||
RHA * | Horse | 1(1) | 139(47) | 74(30) | 2(1) | 0 | 0 | 211(111) | 427(190) |
Vegetation | 2(1) | 324(18) | 11(6) | 2(1) | 0 | 678(68) | 88(88) | 1105(182) | |
Subtotal | 3(2) | 463(65) | 85(36) | 4(2) | 0 | 678(68) | 299(199) | 1532(372) | |
PHF | Horse | 0 | 263(90) | 220(78) | 0 | 0 | 0 | 0 | 483(168) |
Vegetation | 63(3) | 1435(54) | 97(28) | 1(1) | 0 | 101(12) | 4(4) | 1701(102) | |
Subtotal | 63(3) | 1698(144) | 317(106) | 1(1) | 0 | 101(12) | 4(4) | 2184(270) | |
LHR | Horse | 0 | 187(64) | 404(129) | 0 | 0 | 6(3) | 179(171) | 776(367) |
Vegetation | 2120(47) | 898(49) | 105(26) | 1(1) | 81(3) | 1402(155) | 121(121) | 4728(402) | |
Subtotal | 2120(47) | 1085(113) | 509(155) | 1(1) | 81(3) | 1408(158) | 300(292) | 5504(769) | |
Total | Horse | 1(1) | 589(201) | 698(237) | 2(1) | 0 | 6(3) | 390(282) | 1686(725) |
Vegetation | 2185(51) | 2657(121) | 213(62) | 4(3) | 81(3) | 2181(235) | 213(213) | 7534(688) | |
Subtotal | 2186(52) | 3246(322) | 911(299) | 6(4) | 81(3) | 2187(238) | 603(495) | 9220(1413) |
Year | Species | Stage | Tick No. (Pool) | No. of PCR Positive Tick Pools | ||||
---|---|---|---|---|---|---|---|---|
B. caballi | T. equi | A. phagocytophilum | E. chaffeensis | B. burgdorferi s.l. | ||||
2016 | H. longicornis | Larva | 2186 (52) | 0 | 0 | 0 | 0 | 0 |
Nymph | 3246 (322) | 0 | 0 | 0 | 0 | 0 | ||
Adult | 911 (299) | 0 | 0 | 0 | 0 | 0 | ||
Subtotal | 6343 (673) | 0 | 0 | 0 | 0 | 0 | ||
I. nipponensis | Adult | 6 (4) | 0 | 0 | 0 | 0 | 0 | |
2017 | H. longicornis | Larva | 81 (3) | 0 | 0 | 0 | 0 | 0 |
Nymph | 2187 (238) | 0 | 0 | 0 | 0 | 3 | ||
Adult | 603 (495) | 0 | 0 | 5 | 0 | 1 | ||
Subtotal | 2871 (736) | 0 | 0 | 5 | 0 | 4 | ||
Total | 9220 (1413) | 0 | 0 | 5 | 0 | 4 |
Pathogens | Primers | Sequences (5′-3′) | PCR Condition | Target Gene (bp) | Reference |
---|---|---|---|---|---|
B. caballi/ T. equi | Bec-UF1 | GTTGATCCTGCCAGTAGTCA | 95 °C (5 min); 37 cycles of 95 °C (30 s), 56 °C (30 s), and 72 °C (1 min) | 18S rRNA (Bc:867/ Te:913) | [47] |
Bec-UR | CGGTATCTGATCGTCTTCGA | ||||
Babesia spp. | B5UK1 | GTCAGCAAGCGAACCGACAA | 95 °C (5 min); 37 cycles of 95 °C (30 s), 55 °C (30 s), and 72 °C (40 s) | SpS7 (670) | [48] |
B3UK1 | CCAAGACGAGCTGAAGGATC | ||||
Anaplasma phagocytophilum | PITA-fwd | GTCGAACGGATTATTCTTTA | 95 °C (5 min); 37 cycles of 95 °C (30 s), 58 °C (30 s), and 72 °C (40 s) | 16S rRNA (511) | [49] |
PITA-rev | TTCACCTTTAACTTACCGAA | ||||
Ehrlichia chaffeensis | HE1 | CAATTGCTTATAACCTTTTGGTTATAAAT | 95 °C (5 min); 37 cycles of 95 °C (30 s), 50 °C (30 s), and 72 °C (30 s) | 16S rRNA (390) | [50] |
HE3 | TATAGGTACCGTCATTATCTTCCCTAT | ||||
Borrelia spp. | Bb23Sp-FAM | 56-FAM/AGATGTGGT/ZEN/AGACCCGAAGCCGAGTG/31ABkFQ | 50 °C (2 min); 95 °C (5 min); 40 cycles of 95 °C (15 s) and 60 °C (30 s) | 23S rRNA (75) | [51] |
Bb23Sf | CGAGTCTTAAAAGGGCGATTTAGT | ||||
Bb23Sr | GCTTCAGCCTGGCCATAAATA | ||||
Bb16s-F | GAGGCGAAGGCGAACTTCTG | 95 °C (5min); 37 cycles of 95 °C (30 s), 60 °C (30 s), and 72 °C (1 min) | 16S rRNA (622) | [52] | |
Bb16s-R | CTAGCGATTCCAACTTCATGAAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Seo, H.-J.; Truong, A.-T.; Kim, K.-H.; Lim, J.-Y.; Min, S.; Kim, H.-C.; Yoo, M.-S.; Yoon, S.-S.; Klein, T.A.; Cho, Y.S. Molecular Detection and Phylogenetic Analysis of Tick-Borne Pathogens in Ticks Collected from Horses in the Republic of Korea. Pathogens 2021, 10, 1069. https://doi.org/10.3390/pathogens10091069
Seo H-J, Truong A-T, Kim K-H, Lim J-Y, Min S, Kim H-C, Yoo M-S, Yoon S-S, Klein TA, Cho YS. Molecular Detection and Phylogenetic Analysis of Tick-Borne Pathogens in Ticks Collected from Horses in the Republic of Korea. Pathogens. 2021; 10(9):1069. https://doi.org/10.3390/pathogens10091069
Chicago/Turabian StyleSeo, Hyun-Ji, A-Tai Truong, Keun-Ho Kim, Ji-Yeon Lim, Subin Min, Heung-Chul Kim, Mi-Sun Yoo, Soon-Seek Yoon, Terry A. Klein, and Yun Sang Cho. 2021. "Molecular Detection and Phylogenetic Analysis of Tick-Borne Pathogens in Ticks Collected from Horses in the Republic of Korea" Pathogens 10, no. 9: 1069. https://doi.org/10.3390/pathogens10091069