Next Article in Journal
Reproductive Behavior of the Polyembryonic Parasitoid Copidosomopsis nacoleiae (Eady) at Different Ages
Next Article in Special Issue
Effects of Temperature and Humidity on the Fitness of Aphid Parasitoid, Binodoxys communis
Previous Article in Journal
New Wasps of Maimetshidae (Hymenoptera: Ceraphronoidea) from the Mid-Cretaceous Myanmar Amber
Previous Article in Special Issue
The Belowground–Aboveground Interactions of Zucchini: The Effects of Trichoderma afroharzianum Strain T22 on the Population and Behavior of the Aphid Aphis gossypii Glover and Its Endoparasitoid Aphidius colemani Viereck
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Pseudomonas Infection Affects the Growth and Development of Aphis gossypii by Disrupting Energy Metabolism and Reproductive Processes

1
Zhengzhou Research Base, State Key Laboratory of Cotton Bio-Breeding and Integrated Utilization, Institute of Cotton Research, Chinese Academy of Agricultural Sciences, Anyang 455000, China
2
Zhengzhou Research Base, State Key Laboratory of Cotton Bio-Breeding and Integrated Utilization, School of Agricultural Sciences, Zhengzhou University, Zhengzhou 450001, China
3
State Key Laboratory of Cotton Bio-Breeding and Integrated Utilization, Henan University, Kaifeng 475000, China
*
Authors to whom correspondence should be addressed.
Insects 2025, 16(3), 238; https://doi.org/10.3390/insects16030238
Submission received: 27 December 2024 / Revised: 19 February 2025 / Accepted: 20 February 2025 / Published: 24 February 2025
(This article belongs to the Special Issue Protecting Field Crops from Economically Damaging Aphid Infestation)

Simple Summary

The genus Pseudomonas encompasses a highly diverse array of bacteria that are ubiquitously present across diverse environments and hosts, with their effects ranging from beneficial to harmful. Aphis gossypii Glover shares a long-standing evolutionary connection with Pseudomonas, frequently establishing a symbiotic bond. Pseudomonas is intricately involved in numerous life processes of A. gossypii and significantly influences its physiological parameters. Despite the well-documented nature of this phenomenon, the underlying mechanisms remain obscure. In this study, to explore the relationship between Pseudomonas and A. gossypii in greater depth, we collected A. gossypii that were infected and non-infected with Pseudomonas from the wild. Subsequently, we analyzed the impact of Pseudomonas on A. gossypii by using life table parameters in combination with RNA-sequencing techniques. The results indicated that upon infection with Pseudomonas, the growth, development, and reproductive capabilities of A. gossypii were significantly and adversely affected.

Abstract

For instance, Pseudomonas is involved in numerous life processes of A. gossypii and exerts a significant influence on its physiological indicators. The results demonstrate that Pseudomonas infection disturbs the normal growth and development of A. gossypii, resulting in a substantial reduction in the number of offspring. Compared with the uninfected control group, the innate rate of increase and the endogenous growth rate are markedly lower. Moreover, RNA-sequencing revealed that genes related to energy synthesis and nutrient metabolism were significantly upregulated in A. gossypii infected with Pseudomonas. Simultaneously, the infection led to a significant downregulation of genes related to alkaline phosphatase in the folate-synthesis pathway and histone proteinase B synthesis in the metabolism pathway of A. gossypii. These experimental findings indicate that Pseudomonas infection disrupts the growth and development of A. gossypii, specifically manifested as a significant upregulation of genes related to energy synthesis and nutrient metabolism and a downregulation of genes related to reproduction. Overall, these results offer support for the study of the interactions between aphids and symbiotic bacteria.

1. Introduction

Aphis gossypii Glover, also known as the cotton aphid, is a globally distributed, polymorphic pest that feeds on over 300 species of host plants, particularly those in the Cucurbitaceae, Solanaceae, and Brassicaceae families [1]. The insect primarily damages crop yields through indirect feeding and the transference of viral diseases [2,3]. In recent decades, A. gossypii control has largely relied upon chemical insecticides, but efficacy is continuously threatened by the insect’s large populations, rapid reproduction, and high adaptability. Insecticide resistance in aphid populations negatively impacts the quality and safety of cotton production, resulting in serious chemical insecticide losses [4,5]. Consequently, many researchers and growers are turning to biological controls as a more environmentally friendly and reliable method of regulating A. gossypii [6,7].
Insects of herbivorous nature, specifically those possessing piercing-sucking mouthparts, subsist by consuming plant sap. Nevertheless, the nutrient content in the sap may not consistently fulfill their specific growth and developmental demands. Earlier scientific investigations have shown that endophytic bacteria have the potential to address this nutritional disparity [8]. Buchnera, the primary symbiotic bacteria in aphids, can furnish their hosts with a vast array of vital nutrients. For instance, in Myzus Persicae (green peach aphid), Buchnera Mp fixes atmospheric nitrogen and synthesizes essential amino acids such as leucine, isoleucine, and methionine [9,10]. These symbiotic bacteria fulfill indispensable functions in the survival, growth, reproduction of insects as well as their adaptation to host plants, natural predators, and high-temperature environments [11]. Oliver, K.M. et al. demonstrated that facultative symbiotic bacterial infection in Acyrthosiphon pisum (pea aphid) can significantly impede the growth and advancement of its natural adversary, Aphidius service Haliday [12]. Moreover, Attia, S. et al. observed that infection from the secondary symbiotic bacterium Serratia could diminish the pupation rate of A. pisum [13]. A. pisum containing Serratia also exhibits a higher reproduction rate and better suitability under high temperatures and heat stress conditions [14,15]. Another study demonstrated that Drosophila infected with Wolbachia experienced a significantly higher survival rate [16], along with a low probability of passing the infection on to their offspring [17]. Additionally, aphids infected with the parthenogenic symbiotic bacterium Rickettsiella have an increased content of blue-green polycyclic aromatic quinone, changing their body color from red to green [18]. Although secondary symbiotic bacteria are not essential for insect growth and reproduction, a growing body of research has demonstrated their role in bolstering insect defenses [19].
Nevertheless, the effects of symbiotic bacteria on insects are not invariably advantageous. For instance, Pseudomonas, a prevalent symbiotic bacterium, exerts notably negative effects on its hosts [20]. A 2016 study by DuPont Pioneer USA reported that the IPD072Aa protein produced by Pseudomonas chlororaphis exhibits insecticidal abilities against the western maize rootworm. Transgenic maize engineered with this protein is protected from the worm and contains important agronomic traits and nutrient composition [21]. Furthermore, the Fit protein produced by Pseudomonas fluorescens is virulent against Manduca sexta (tobacco hornworm) and Galleria mellonella (greater wax moth) [22]. Some strains of P. protegens and P. chlororaphis can infect and kill insect larvae after oral ingestion, potentially enabling rhizobia to resist grazing predators, thereby protecting the host and providing a competitive edge [23]. The bacterial genus can impact a wide variety of insect life activities. For example, Pseudomonas sp. form tiny, widespread, and stable communities in the gut of Ceratitis capitata including arthro-pathogenic bacteria. Injecting large amounts of Pseudomonas shortens the life span of Ceratitis capitata, while Enterobacteriaceae injections suppress Pseudomonas and extend the host’s life span [21,24]. Despite the growing body of research on symbiotic bacteria, the interactions between Pseudomonas and A. gossypii remain largely unexplored.
Recent research has facilitated the exploration of numerous biological functions of Pseudomonas, with a particular emphasis on its applications in biological control and plant growth promotion within the agricultural domain. In this study, we examined the growth and development indicators of A. gossypii infected with Pseudomonas, and then compared these with the pre-established life table parameters.
To gain a deeper understanding of the regulatory mechanisms of this bacterium on the life processes of A. gossypii, we employed RNA-Seq analysis to compare the gene expression dynamics between the infected and uninfected populations.
Overall, our findings shed light on the mechanisms underlying the use of Pseudomonas as a biological control agent against A. gossypii

2. Materials and Methods

2.1. Insects

Aphis gopssypii populations were originally collected from a cotton field at the Institute of Cotton Research, Chinese Academy of Agricultural Sciences (CAAS, 36°5′34.8″ N, 114°31′47.19″ E). Due to the fact that aphid symbiotes mainly propagate vertically from the mother to offspring during reproduction, they have a certain transmission failure rate [25]. Therefore, A. gossypii within five generations were used for data collection. Pseudomonas infection was determined according to the methods of [26]. Pseudomonas specific primers were designed based on the 16 s rRNA gene. qPCR was used to quantify copies of the Pseudomonas 16 s rRNA gene, with genomic DNA from a single aphid serving as the template. Detected gene copies were used to estimate the abundance of Pseudomonas in 1 μL of DNA solution. Aphid copy numbers exceeding the lowest point of the standard curve (~100 copies) were considered Pseudomonas-infected, while those below this threshold were considered uninfected.

2.2. Analysis of Biological Parameters

Treatments containing either 15 Pseudomonas-infected (there was no infection of other facultative symbiotic bacteria, or there were merely extremely low levels of these bacteria present) or non-infected (the organisms were either not infected with any facultative symbiotic bacteria or had very low levels of such bacteria). A. gossypii were reared in Petri dishes, and fed with the leaves of the cotton variety “Zhong 49”, with the non-infected A. gossypii serving as controls. These were maintained at 25 ± 1 °C, 65 ± 5% relative humidity (RH), and a 14:10 h light:dark photoperiod. The body length and width were recorded daily until adulthood. Individual body weight measurements began on the fourth day after emergence, and the experimental data were analyzed to detect differences among groups using a t-test, with GraphPad Prime 10.0 software serving as the analytical tool.
Treatments contained either 45 Pseudomonas-infected. The life table parameters of each offspring of A. gossypii were recorded individually. After recording, all of the offspring were removed, and the mother continued to give birth until the mother died. The life table data were first recorded in a TXT file. Subsequently, this file was uploaded to the relevant software, where the data were analyzed by means of the TWOSEX-MSChart program [27,28]. To obtain the means and standard errors, the bootstrap program was utilized, with 100,000 random resamples being carried out. To determine whether there were differences in the life table parameters between the treatment groups, paired bootstrap tests were employed [29].

2.3. RNA Extraction and RNA-Seq Analysis

Total RNA of adult A. gossypii was extracted with TRIzol (Thermo Fisher, Waltham, MA, 15596018CN) following the manufacturer’s instructions. The RNA quantity and quality were measured with a NanoDrop2000C spectrophotometer (Thermo Scientific, USA), and integrity was assessed by agarose gel electrophoresis.
cDNA libraries were constructed by sequencing extracted RNA at Shanghai Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China) using the Illumina HiSeq X ten(NovaSeq X 1.3) sequencing platform. Clean reads were obtained by removing adaptors and low-quality reads. All raw data were uploaded in FASTQ format and stored in the NCBI SRA database under the accession number PRJNA832535. Gene expression levels were calculated as TPM values and differentially expressed genes (DEGs) were identified using the DESeq2 1.42.0 [30]. The isolated genes underwent assessment using DESeq2 1.42.0 software, employing a stringent threshold of p < 0.05 with |log2(fold change)| > 2 criteria for characterizing DEGs. Relationships between samples were assessed through principal component analysis. Functional enrichment analyses including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) were performed using Goatools and KOBAS [31] to analyze the DEG functions. GO and KEGG terms were considered significantly enriched at a corrected p-value < 0.05.

2.4. RT-qPCR Analysis

DEGs identified from the RNA-Seq data were analyzed by RT-qPCR. A template consisting of 1 μg of RNA was utilized for reverse transcription using the PrimeScript™ RT Reagent Kit with gDNA Eraser (TAKARA Bio, Beijing, China, RR047Q) according to the manufacturer’s instructions. The RT-qPCR mixture comprised 5 μL Trans-Start Top Green qPCR SuperMix (Dye I) (2×, TransGen, Beijing, China, AQ131-01), 0.2 μL of each primer (10 μM), 1 μL of cDNA (20× dilution), and RNase-free water up to 10 μL. Real-time PCR reactions were performed on a Step OnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using the two-step method: initiation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. Three biological and three technical replicates were performed for each RT-qPCR reaction. Relative expression levels of the target genes were calculated using the 2−ΔΔCt method [32]. Elongation factor1 alpha (EF1α) and beta-actin (β-ACT) genes were used as the endogenous reference gene for normalizing the target gene expression levels [33]. All primers used in this study are listed in Table 1.

3. Results

3.1. Aphid Body Length and Width

The body lengths of A. gossypii both infected and uninfected with Pseudomonas (Pse and no-Pse) exhibited an increasing trend, plateauing on the third day of the adult (Figure 1A). The Pse group was marginally shorter than the control, but this difference was not statistically significant. Neither population showed significant increases in length following the adult 3 d timepoint, however, the no-Pse was markedly longer than Pse. The body width of A. gossypii in both populations demonstrated an ascending trend prior to the fifth day of adulthood. From adult 5 to 15 days, the growth of the body width of A. gossypii in both populations tended to plateau, and there was no significant disparity in body width between Pse and no-Pse (Figure 1B).

3.2. Aphid Weight

Body mass measurements of single A. gossypii were recorded daily, starting at the fourth instar. The body weights from the first to third instars were too low to measure with the balance. After the 11th day, weights were recorded every other day (Figure 1C).
From 4L (fourth instar) to 5 d, the weight of the aphids in both treatment groups consistently increased, reaching peak values at 5 d (no-Pse = 24.13 ± 5.12, Pse = 19.47 ± 3.23) (Figure 1C). With the exception of 4L, the Pse group weighted significantly less than the no-Pse control at all stages.

3.3. Aphid Offspring Size

Both A. gossypii treatment populations began reproducing on the first day of adulthood, with birth numbers progressively increasing between 1 and 4 d and peaking from 4–7 d. During this time, the daily mean birth number surpassed four. After the 7th day, the birth number steadily diminished, with no additional offspring produced after 20 days (Figure 1D). The total number of Pse offspring (36.75 ± 9.79) was significantly lower than the no-Pse treatment (44.7 ± 10.91), with a difference of 7.95 (t = 2.710, df = 49, p = 0.0092) (Figure 1E).

3.4. Aphid Life Table Parameters

We assessed the life tables of the A. gossypii populations infected and uninfected with Pseudomonas (Table 2). The Pse group had a finite increase rate of 1.52 and an innate increase rate of 0.42, both showing no significant difference compared with the no-Pse group, respectively. However, the longevity of adult and lifespan, fecundity, net reproductive rate R0, and mean generation time T(d) were significantly lower than that of the no-Pse. This indicates that Pseudomonas infection negatively impacts A. gossypii reproduction and lifespan.

3.5. Transcriptomic Analysis

A total of 259,170,048 raw sequences were generated by Illumina Hiseq technology, resulting in 254,733,654 pristine sequences following stringent quality control and filtering. Q20 and Q30 quality scores exceeded 98.48% and 95.25%, respectively. The reference genome alignment rate was above 54.03% (Table 3). The GC rate ranged from 34.5% to 43.14%. These results underscore the superior quality of the sequencing data, reinforcing the reliability of subsequent gene expression analyses. The expressed genes were annotated with the GO, KEGG, COG, NR, Swiss Prot, and Pfam databases, resulting in classifications of 6249, 7119, 11,523, 12,621, 9192, and 10,504 genes, respectively (Figure 2A).

3.6. DEG Functional Enrichment Analysis

The principal component analysis (PCA) graphs of the transcriptomic sequencing data illustrated considerable differences between Pse and no-pse A. gossypii populations, with compact clustering within each treatment group (Figure 2B). A volcano plot was used to depict the contrast in gene expression levels between treatments, identifying 255 DEGs across all samples (p < 0.05). Compared with the control, the Pse group exhibited 181 upregulated and 74 downregulated DEGs (Figure 2C). These results indicate that significant transcriptional differences in A. gossypii are induced by Pseudomonas infection.
A GO enrichment analysis was conducted on significant DEGs to classify their functions, resulting in three major domains: biological process (BP), cellular component (CC), and molecular function (MF). The MF classification primarily includes monooxygenase activity, iron ion binding, and serine-type peptidase activity. BP encompasses processes related to carbohydrate metabolism, oxidation–reduction, and cellular amino acid biosynthesis. CC primarily consists of membrane components (Figure 3A).
We examined the metabolic pathways involved in the DEGs using the KEGG database. A total of 173 DEGs showed significant changes between the two cotton aphid populations, mainly concentrated in 12 metabolic pathways (p < 0.05). The most important pathways were related to carbohydrate digestion and absorption, galactose metabolism, valine, leucine and isoleucine biosynthesis, and lysosome processes (Figure 3B).

3.7. Validation of RNA-Seq Results

To validate the quality and accuracy of the transcriptome data, eight differentially expressed genes (DEGs) were randomly selected for reverse transcription-quantitative polymerase chain reaction (RT-qPCR). The outcomes of this analysis demonstrated the upregulation of genes encoding endocuticle structural glycoprotein SgAbd-2, UDP-glucuronosyltransferase, 60S ribosomal protein L11, 40S ribosomal protein S17, hemolymph juvenile hormone-binding protein (JHBP), and cytochrome P450 4c1. In contrast, the fatty acid synthase and vitellogenin genes were downregulated. These observations were consistent with the results from RNA-sequencing (RNA-Seq), as illustrated in Figure 4.
In the transcriptome analysis, fragments per kilobase of exon model per million mapped read (FPKM) values were utilized to quantify the gene expression levels. The results of the quantitative validation were in line with the trends in the gene expression levels observed in the transcriptome, thus indicating the reliability of the transcriptome results.

4. Discussion

The diverse and widespread presence of microorganisms has led to the development of complex relationships with insects throughout evolution. The metabolism and physiological activities of insects are influenced by microorganisms in many ways, both directly and indirectly [34,35]. For instance, monophagous aphids that feed on plant sap often rely on symbiotic bacteria to digest plant polysaccharides and provide sources of nutrients such as carbon, essential amino acids, and vitamins [36]. This mutualistic relationship is typically observed in nutrient-poor environments [37]. Previous studies have also suggested that certain symbiotic bacteria may adversely affect the growth and advancement of their hosts. Garcia, L.C. et al. [38] determined that heterohadididae and Steinernematidae nematodes dispense Photorhabdus and Xenorhabdus bacteria to annihilate the host insect, the fall armyworm (Spodoptera frugiperda). Moreover, Thanwisai A et al. [39] reported that these nematode families infected with Photorhabdus can lethally impact Aedes aegypti (yellow fever mosquito) and Culex quinquefasciatus (southern house mosquito). The beneficial bacteria Pseudomonas is commonly found in human intestines; however, increasing research has shown its potential to harm insect hosts [20,40]. Vodovar N et al. reported that Pseudomonas infection causes damage to the intestinal cells of Drosophila larvae [41]. Our understanding of aphid–microbe relationships has advanced significantly, with particular emphasis on the roles of Pseudomonas in biological control. Previous studies have also found that Pseudomonas has adverse effects on insect hosts. Pseudomonas, which colonizes plants, can invade insects when orally ingested, leading to the death of susceptible pest insects [42]. The bacterium Pseudomonas achieved a kill rate of over 90% of Culex pipiens and Aedes albopictus larvae within 72 h after exposition to a bacterial concentration of 100 million CFU/mL [43]. However, their roles in the life processes of cotton aphids remain unclear. This study analyzed the impact of Pseudomonas infection on A. gossypii using life table parameters and transcriptome sequencing, advancing our understanding of their symbiosis.
Numerous reports have elucidated how symbiotic bacteria affect various insect traits related to reproduction, growth, and development [44]. Our results indicate that Pseudomonas infection in A. gossypii significantly suppresses the host’s reproductive capacity and offspring size. Additionally, the rates of endogenous and circumferential growth were significantly reduced in the Pseudomonas-infected aphids. Pseudomonas also disrupted the normal growth and development of A. gossypii, causing a decrease in aphid length, width, and body weight.
Symbiotic bacteria are known to greatly affect insect reproduction, influencing their hosts in various ways that may be beneficial or harmful [45]. For example, Rickettsia bacteria play a regulatory role in Bemisia tabaci (silverleaf white fly) reproduction. High proportions of infected females exhibit increased offspring sizes and higher overall survival rates [46]. Additionally, Wolbachia bacteria remarkably manipulate insect reproduction, greatly increasing the female-to-male ratios in populations of Culex pipiens (common mosquito) [47]. In Prostephanus truncatus (larger grain borer), Wolbachia leads to reduced offspring sizes and cytoplasmic incompatibility [48]. Finally, aphids infected with Serratia tend to exhibit reduced viability and fertility [49].
Likewise, symbiotic bacterial infections can either positively or negatively affect the growth and development of insect hosts. Treating Eurygaster integriceps (Sunn pest) with the antibiotic norfloxacin has been shown to significantly impair the growth and development of offspring, indicating the important roles of symbiotic bacteria [50]. Conversely, A. pisum infected with Hamiltonella and A. gossypiis infected with Serratia experience weight loss, suggesting an adverse relationship [51,52]. These examples highlight the variable influences of symbiotic bacteria on the reproductive, growth, and developmental processes of insects. We hypothesize that the changes observed in our treatment groups could be attributable to the pathogenic nature of the microorganism [20]. Pathogenic bacteria typically enter insects through ingestion or injection into the epidermis, where they release toxins or other pathogenic factors [53]. The intricate interactions and the metabolites produced by Pseudomonas provide a promising pathway for biological control strategies.
In this study, we conducted an RNA-Seq analysis to compare the physiological and biochemical differences between Pseudomonas-infected and non-infected A. gossypii. Genes enriched in the KEGG pathway were concentrated in UGT, LCT, hexokinase, alkaline phosphatase, and cathepsin B. The upregulation of UGT was mainly through pentose and glucuronate interconversions as well as porphyrin and chlorophyll metabolism. UDP-glucuronosyl transferase enhances the activity of the insects’ intrinsic detoxification enzymes, diminishing their susceptibility to insecticides [54,55]. The upregulation of the lactase rhizosphere hydrolase (LCT) in the KEGG pathway is believed to modify the plasticity of the insect’s epidermis and assist host adaptability. While elevated levels of LCT enhance the growth rate and overall performance of Oedaleus asiaticus (common grasshopper), they also lead to a reduction in insect body size [56]. Our enrichment analysis revealed that an alkaline phosphatase gene was downregulated in the folate synthesis pathway under Pse treatment. Alkaline phosphatase is a ubiquitous enzyme with distinct roles across various tissues and organs. This enzyme is implicated in insect nutrient uptake, midgut lumen alkalinization, development, neurological and renal function, and cuticle sclerosis [57]. In aphids, alkaline phosphatase influences detoxification and host defense/manipulation. Further research is required to clarify the roles of alkaline phosphatase in the saliva of hemipteran insects [58]. In our study, cathepsin B was downregulated in the NOD-like receptor signaling pathway. Cathepsin B is an intracellular protease predominantly located in lysosomes, whose presence is indispensable for the vital activities of the organism. During embryonic development, the enzyme degrades yolk proteins to provide essential amino acids [59]. Nutrient catabolism is a crucial biochemical process during the early stages of insect embryonic development, with the inhibition of protease activity during this period leading to early egg termination. Our results suggest that the initial size and weight decrease observed in A. gossypii infected Pse may be attributed to the downregulation of UGT and LCT. Conversely, the downregulation of alkaline phosphatase and cathepsin B may explain the significant reduction in offspring size, endogenous growth rate, and perinatal growth rate after Pseudomonas infection.

5. Conclusions

This study presented a comprehensive analysis of the effects of Pseudomonas on A. gossypii. Our results demonstrate that Pseudomonas infection disrupts the growth and development of A. gossypii, significantly reducing the offspring size, innate rate of increase, and finite rate of increase. Additionally, the bacteria affects the expression of genes such as UGT and LCT, which are primarily involved in pentose and glucuronate interconversions, porphyrin and chlorophyll metabolism, galactose metabolism, and carbohydrate digestion and absorption pathways. This work provides a theoretical basis for microbial pest control strategies and furthers our understanding of insect–microbe interactions.

Author Contributions

Q.Y., R.N., X.G., J.L. and J.C. designed the experiments; R.N., X.Z. and L.W. carried out the proposals; Q.Y., R.N. and X.G. performed the data analysis; and Q.Y. and R.N. drafted the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Biological Breeding-Major Projects (2023ZD04062), the Agricultural Science and Technology Innovation Program (ASTIP) (CAAS-ZDRW202412), the Young Elite Scientists Sponsorship Program by CAST (2022QNRC001), the Youth Innovation Program of Chinese Academy of the Agricultural Sciences (Y2023QC23), the Agricultural Science and Technology Innovation Program of the Chinese Academy of Agricultural Sciences and China Agriculture Research System (CARS-15-21).

Data Availability Statement

All data contained within the article.

Conflicts of Interest

The original contributions presented in this study are included in the article.

References

  1. Zhang, Y.C.; Lei, H.X.; Miao, N.H.; Liu, X.D. Comparative Transcriptional Analysis of the Host-Specialized Aphids Aphis gossypii (Hemiptera: Aphididae). J. Econ. Entomol. 2017, 110, 702–710. [Google Scholar] [CrossRef]
  2. Ebert, T.A.; Cartwright, B.O. Biology and ecology of Aphis gossypii Glover (Homoptera: Aphididae). Southwest Entomol. 1997, 22, 116–153. [Google Scholar]
  3. Blackman, R.L.; Eastop, V.F. Aphids on the World’s Crops. An Information and Identification Guide. Aust. J. Entomol. 2000, 39, 354–355. [Google Scholar]
  4. Chen, X.; Tie, M.; Chen, A.; Ma, K.; Li, F.; Liang, P.; Liu, Y.; Song, D.; Gao, X. Pyrethroid resistance associated with M918L mutation and detoxifying metabolism in Aphis gossypii from Bt cotton growing regions of China. Pest. Manag. Sci. 2017, 73, 2353–2359. [Google Scholar] [CrossRef] [PubMed]
  5. Herron, G.A.; Powis, K.; Rophail, J. Insecticide resistance in Aphis gossypii Glover (Hemiptera: Aphididae), a serious threat to Australian cotton. Aust. J. Entomol. 2001, 40, 85–91. [Google Scholar] [CrossRef]
  6. Yang, Y.; Zhang, Y.; Zhang, J.; Wang, A.; Liu, B.; Zhao, M.; Wyckhuys, K.A.G.; Lu, Y. Plant volatiles mediate Aphis gossypii settling but not predator foraging in intercropped cotton. Pest. Manag. Sci. 2023, 79, 4481–4489. [Google Scholar] [CrossRef]
  7. Hopkinson, J.E.; Zalucki, M.P.; Murray, D.A.H. Host selection and parasitism behavior of Lysiphlebus testaceipes: Role of plant, aphid species and instar. Biol. Control. 2013, 64, 283–290. [Google Scholar] [CrossRef]
  8. Douglas, A.E. Nutritional interactions in insect-microbial symbioses: Aphids and their symbiotic bacteria Buchnera. Annu. Rev. Entomol. 1998, 43, 17–37. [Google Scholar] [CrossRef] [PubMed]
  9. Jiang, Z.; Jones, D.H.; Khuri, S.; Tsinoremas, N.F.; Wyss, T.; Jander, G.; Wilson, A.C. Comparative analysis of genome sequences from four strains of the Buchnera aphidicola Mp endosymbion of the green peach aphid, Myzus persicae. BMC Genom. 2013, 14, 917. [Google Scholar] [CrossRef]
  10. Machado-Assefh, C.R.; Alvarez, A.E. Probing behavior of aposymbiotic green peach aphid (Myzus persicae) on susceptible Solanum tuberosum and resistant Solanum stoloniferum plants. Insect Sci. 2018, 25, 127–136. [Google Scholar] [CrossRef]
  11. Heyworth, E.R.; Ferrari, J. A facultative endosymbiont in aphids can provide diverse ecological benefits. J. Evol. Biol. 2015, 28, 1753–1760. [Google Scholar] [CrossRef] [PubMed]
  12. Oliver, K.M.; Russell, J.A.; Moran, N.A.; Hunter, M.S. Facultative bacterial symbionts in aphids confer resistance to parasitic wasps. Proc. Natl. Acad. Sci. USA 2003, 100, 1803–1807. [Google Scholar] [CrossRef] [PubMed]
  13. Attia, S.; Foray, V.; Louâpre, P.; Lognay, G.; Heuskin, S.; Hance, T. Influence of the secondary endosymbiont Serratia Symbiotica on the resistance to the parasitism in the aphid Acyrthosiphon pisum. J. Entomol. Zool. Stud. 2016, 4, 123–126. [Google Scholar]
  14. Chen, D.Q.; Montllor, C.B.; Purcell, A.H. Fitness effects of two facultative endosymbiotic bacteria on the pea aphid, Acyrthosiphon pisum, and the blue alfalfa aphid, A. kondoi. Entomol. Exp. Appl. 2010, 95, 315–323. [Google Scholar] [CrossRef]
  15. Russell, J.A.; Moran, N.A. Costs and benefits of symbiont infection in aphids: Variation among symbionts and across temperatures. Proc. Biol. Sci. 2006, 273, 603–610. [Google Scholar] [CrossRef]
  16. Hedges, L.M.; Brownlie, J.C.; O’Neill, S.L.; Johnson, K.N. Wolbachia And Virus Protection in Insects. Science. 2008, 322, 702. [Google Scholar] [CrossRef] [PubMed]
  17. Glaser, R.L.; Meola, M.A. The native Wolbachia endosymbionts of Drosophila melanogaster and Culex quinquefasciatus increase host resistance to West Nile virus infection. PLoS ONE 2010, 5, e11977. [Google Scholar] [CrossRef] [PubMed]
  18. Tsuchida, T.; Koga, R.; Horikawa, M.; Tsunoda, T.; Maoka, T.; Matsumoto, S.; Simon, J.C.; Fukatsu, T. Symbiotic bacterium modifies aphid body color. Science 2010, 330, 1102–1104. [Google Scholar] [CrossRef]
  19. Oliver, K.M.; Degnan, P.H.; Burke, G.R.; Moran, N.A. Facultative symbionts in aphids and the horizontal transfer of ecologically important traits. Annu. Rev. Entomol. 2010, 55, 247–266. [Google Scholar] [CrossRef]
  20. Teoh, M.C.; Furusawa, G.; Veera Singham, G. Multifaceted interactions between the pseudomonads and insects: Mechanisms and prospects. Arch. Microbiol. 2021, 203, 1891–1915. [Google Scholar] [CrossRef] [PubMed]
  21. Schellenberger, U.; Oral, J.; Rosen, B.A.; Wei, J.Z.; Zhu, G.; Xie, W.; McDonald, M.J.; Cerf, D.C.; Diehn, S.H.; Crane, V.C.; et al. A selective insecticidal protein from Pseudomonas for controlling corn rootworms. Science 2016, 354, 634–637. [Google Scholar] [CrossRef] [PubMed]
  22. Péchy-Tarr, M.; Bruck, D.J.; Maurhofer, M.; Fischer, E.; Vogne, C.; Henkels, M.D.; Donahue, K.M.; Grunder, J.; Loper, J.E.; Keel, C. Molecular analysis of a novel gene cluster encoding an insect toxin in plant-associated strains of Pseudomonas fluorescens. Environ. Microbiol. 2008, 10, 2368–2386. [Google Scholar] [CrossRef] [PubMed]
  23. Nandi, M.; Selin, C.; Brassinga, A.K.; Belmonte, M.F.; Fernando, W.G.; Loewen, P.C.; de Kievit, T.R. Pyrrolnitrin and Hydrogen Cyanide Production by Pseudomonas chlororaphis Strain PA23 Exhibits Nematicidal and Repellent Activity against Caenorhabditis elegans. PLoS ONE 2015, 10, e0123184. [Google Scholar] [CrossRef] [PubMed]
  24. Zhang, Q.; Cai, P.; Wang, B.; Liu, X.; Lin, J.; Hua, R.; Zhang, H.; Yi, C.; Song, X.; Ji, Q.; et al. Manipulation of Gut Symbionts for Improving the Sterile Insect Technique: Quality Parameters of Bactrocera dorsalis (Diptera: Tephritidae) Genetic Sexing Strain Males After Feeding on Bacteria-Enriched Diets. J. Econ. Entomol. 2021, 114, 560–570. [Google Scholar] [CrossRef]
  25. Rock, D.I.; Smith, A.H.; Joffe, J.; Albertus, A.; Wong, N.; O’Connor, M.; Oliver, K.M.; Russell, J.A. Context-dependent vertical transmission shapes strong endosymbiont community structure in the pea aphid, Acyrthosiphon pisum. Mol. Ecol. 2018, 27, 2039–2056. [Google Scholar] [CrossRef] [PubMed]
  26. Zhang, S.; Su, H.; Jiang, W.; Hu, D.; Ali, I.; Jin, T.; Yang, Y.; Ma, X. Symbiotic microbial studies in diverse populations of Aphis gossypii, existing on altered host plants in different localities during different times. Ecol. Evol. 2021, 11, 13948–13960. [Google Scholar] [CrossRef] [PubMed]
  27. Chi, H.; Liu, H. Two New Methods for Study of Insect Population Ecology; IEEE: Piscataway, NJ, USA, 1984. [Google Scholar]
  28. Shang, J.; Yao, Y.S.; Chen, L.L.; Zhu, X.Z.; Niu, L.; Gao, X.K.; Luo, J.Y.; Ji, J.C.; Cui, J.J. Sublethal Exposure to Deltamethrin Stimulates Reproduction and Alters Symbiotic Bacteria in Aphis gossypii. J. Agric. Food Chem. 2021, 69, 15097–15107. [Google Scholar] [CrossRef] [PubMed]
  29. Efron, B.; Tibshirani, R.J. An introductin to the bootstrap. J. Great Lakes Res. 1993, 20, 1–6. [Google Scholar]
  30. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
  31. Xie, C.; Mao, X.; Huang, J.; Ding, Y.; Wu, J.; Dong, S.; Kong, L.; Gao, G.; Li, C.Y.; Wei, L. KOBAS 2.0: A web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res. 2011, 39, W316–W322. [Google Scholar] [CrossRef] [PubMed]
  32. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  33. Ma, K.; Li, F.; Tang, Q.; Liang, P.; Liu, Y.; Zhang, B.; Gao, X. CYP4CJ1-mediated gossypol and tannic acid tolerance in Aphis gossypii Glover. Chemosphere 2019, 219, 961–970. [Google Scholar] [CrossRef] [PubMed]
  34. Crotti, E.; Balloi, A.; Hamdi, C.; Sansonno, L.; Marzorati, M.; Gonella, E.; Favia, G.; Cherif, A.; Bandi, C.; Alma, A.; et al. Microbial symbionts: A resource for the management of insect-related problems. Microb. Biotechnol. 2012, 5, 307–317. [Google Scholar] [CrossRef] [PubMed]
  35. Jiang, Z.R.; Masuya, H.; Kajimura, H. Novel Symbiotic Association Between Euwallacea Ambrosia Beetle and Fusarium Fungus on Fig Trees in Japan. Front. Microbiol. 2021, 12, 2590. [Google Scholar] [CrossRef]
  36. Ankrah, N.Y.D.; Douglas, A.E. Nutrient factories: Metabolic function of beneficial microorganisms associated with insects. Environ. Microbiol. 2018, 20, 2002–2011. [Google Scholar] [CrossRef] [PubMed]
  37. Rio, R.V.; Lefevre, C.; Heddi, A.; Aksoy, S. Comparative genomics of insect-symbiotic bacteria: Influence of host environment on microbial genome composition. Appl. Environ. Microbiol. 2003, 69, 6825–6832. [Google Scholar] [CrossRef]
  38. Garcia, L.C.; Raetano, C.G.; Leite, L.G. Application technology for the entomopathogenic nematodes Heterorhabditis indica and Steinernema sp. (Rhabditida: Heterorhabditidae and Steinernematidae) to control Spodoptera frugiperda (Smith) (Lepidoptera: Noctuidae) in corn. Neotrop. Entomol. 2008, 37, 305–311. [Google Scholar] [CrossRef] [PubMed]
  39. Thanwisai, A.; Muangpat, P.; Meesil, W.; Janthu, P.; Dumidae, A.; Subkrasae, C.; Ardpairin, J.; Tandhavanant, S.; Yoshino, T.P.; Vitta, A. Entomopathogenic Nematodes and Their Symbiotic Bacteria from the National Parks of Thailand and Larvicidal Property of Symbiotic Bacteria against Aedes aegypti and Culex quinquefasciatus. Biology 2022, 11, 1658. [Google Scholar] [CrossRef]
  40. He, Y.; Qin, Q.; DiLegge, M.J.; Vivanco, J.M. Isolation of Klebsiella pneumoniae and Pseudomonas aeruginosa from entomopathogenic nematode-insect host relationship to examine bacterial pathogenicity on Trichoplusia ni. Microb. Pathog. 2019, 135, 103606. [Google Scholar] [CrossRef] [PubMed]
  41. Vodovar, N.; Vinals, M.; Liehl, P.; Basset, A.; Degrouard, J.; Spellman, P.; Boccard, F.; Lemaitre, B. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proc. Natl. Acad. Sci. USA 2005, 102, 11414–11419. [Google Scholar] [CrossRef] [PubMed]
  42. Vesga, P.; Flury, P.; Vacheron, J.; Keel, C.; Croll, D.; Maurhofer, M. Transcriptome plasticity underlying plant root colonization and insect invasion by Pseudomonas protegens. ISME J. 2020, 14, 2766–2782. [Google Scholar] [CrossRef] [PubMed]
  43. Hamze, R.; Foxi, C.; Ledda, S.; Satta, G.; Ruiu, L. Pseudomonas protegens Affects Mosquito Survival and Development. Curr. Microbiol. 2023, 80, 172. [Google Scholar] [CrossRef] [PubMed]
  44. Trienens, M.; Beukeboom, L.W. Symbionts in insect biology and pest controlAn introduction. Entomol. Exp. Appl. 2019, 167, 153–155. [Google Scholar] [CrossRef]
  45. Nogge, G. Significance of symbionts for the maintenance of an optimal nutritional state of successful reproduction in hematophagous arthropods. Parasitology 1981, 82, 101–104. [Google Scholar]
  46. Himler, A.G.; Adachi-Hagimori, T.; Bergen, J.E.; Kozuch, A.; Kelly, S.E.; Tabashnik, B.E.; Chiel, E.; Duckworth, V.E.; Dennehy, T.J.; Zchori-Fein, E. Rapid spread of a bacterial symbiont in an invasive whitefly is driven by fitness benefits and female bias. Science 2011, 332, 254–256. [Google Scholar] [CrossRef] [PubMed]
  47. Landmann, F. The Wolbachia Endosymbionts. Microbiol. Spectr. 2019, 7. [Google Scholar] [CrossRef] [PubMed]
  48. Xia, X.; Peng, C.W.; Cui, J.R.; Jin, P.Y.; Yang, K.; Hong, X.Y. Wolbachia affects reproduction in the spider mite Tetranychus truncatus (Acari: Tetranychidae) by regulating chorion protein S38-like and Rop. Insect Mol. Biol. 2021, 30, 18–29. [Google Scholar] [CrossRef]
  49. Pons, I.; Renoz, F.; Hance, T. Fitness costs of the cultivable symbiont Serratia symbiotica and its phenotypic consequences to aphids in presence of environmental stressors. Evol. Ecol. 2019, 33, 825–838. [Google Scholar] [CrossRef]
  50. Kafil, M.; Bandani, A.R.; Kaltenpoth, M.; Goldansaz, S.H.; Alavi, S.M. Role of symbiotic bacteria in the growth and development of the Sunn pest, Eurygaster integriceps. J. Insect Sci. 2013, 13, 99. [Google Scholar] [CrossRef]
  51. Liu, X.D.; Lei, H.X.; Chen, F.F. Infection pattern and negative effects of a facultative endosymbiont on its insect host are environment-dependent. Sci. Rep. 2019, 9, 4013. [Google Scholar] [CrossRef]
  52. Weldon, S.R.; Strand, M.R.; Oliver, K.M. Phage loss and the breakdown of defensive symbiosis in aphids. Proc. R. Soc. B Biol. Sci. 2013, 280, 20122103. [Google Scholar] [CrossRef]
  53. Glare, T.R.; Jurat-Fuentes, J.L.; O’Callaghan, M. Basic and Applied Research. In Microbial Control of Insect & Mite Pests; Academic Press: Cambridge, MA, USA, 2017. [Google Scholar]
  54. Riaz, M.A.; Chandor-Proust, A.; Dauphin-Villemant, C.; Poupardin, R.; Jones, C.M.; Strode, C.; Régent-Kloeckner, M.; David, J.P.; Reynaud, S. Molecular mechanisms associated with increased tolerance to the neonicotinoid insecticide imidacloprid in the dengue vector Aedes aegypti. Aquat. Toxicol. 2013, 126, 326–337. [Google Scholar] [CrossRef]
  55. Zhao, L.; Alto, B.W.; Duguma, D. Transcriptional Profile for Detoxification Enzymes AeaGGT1 and AaeGGT2 from Aedes aegypti (Diptera: Culicidae) in Response to Larvicides. J. Med. Entomol. 2017, 54, 878–887. [Google Scholar] [CrossRef]
  56. Qin, X.; Hao, K.; Ma, J.; Huang, X.; Tu, X.; Ali, M.P.; Pittendrigh, B.R.; Cao, G.; Wang, G.; Nong, X.; et al. Molecular Ecological Basis of Grasshopper (Oedaleus asiaticus) Phenotypic Plasticity under Environmental Selection. Front. Physiol. 2017, 8, 770. [Google Scholar] [CrossRef]
  57. Harper, R.A.; Armstrong, F.B. Alkaline phosphatase of Drosophila melanogaster. I. Partial purification and characterization. Biochem. Genet. 1972, 6, 75–82. [Google Scholar] [CrossRef] [PubMed]
  58. Cooper, W.R.; Dillwith, J.W.; Puterka, G.J. Salivary proteins of Russian wheat aphid (Hemiptera: Aphididae). Environ. Entomol. 2010, 39, 223–231. [Google Scholar] [CrossRef]
  59. Götz, B.; Felleisen, R.; Shaw, E.; Klinkert, M.Q. Expression of an active cathepsin B-like protein Sm31 from Schistosoma mansoni in insect cells. Trop. Med. Parasitol. 1992, 43, 282–284. [Google Scholar]
Figure 1. Influence of Pseudomonas on A. gossypii physical characteristics. Insect body (A) length, (B) width, (C) weight, (D) trend chart of daily litter size of A. gossypii, and (E) offspring size. Data represent the mean and standard error. SAS V8 software was used to analyze the body length and width through a one−way ANOVA. *: p-value ≤ 0.05, **: p-value ≤ 0.01, ***: p-value ≤ 0.001, and ns indicates no significant difference.
Figure 1. Influence of Pseudomonas on A. gossypii physical characteristics. Insect body (A) length, (B) width, (C) weight, (D) trend chart of daily litter size of A. gossypii, and (E) offspring size. Data represent the mean and standard error. SAS V8 software was used to analyze the body length and width through a one−way ANOVA. *: p-value ≤ 0.05, **: p-value ≤ 0.01, ***: p-value ≤ 0.001, and ns indicates no significant difference.
Insects 16 00238 g001
Figure 2. (A) Expression gene annotation map of Pseudomonas. (B) Principal component analysis of the transcriptome samples. (C) Volcano plot of DEGs between the infected and uninfected aphid populations.
Figure 2. (A) Expression gene annotation map of Pseudomonas. (B) Principal component analysis of the transcriptome samples. (C) Volcano plot of DEGs between the infected and uninfected aphid populations.
Insects 16 00238 g002
Figure 3. GO and KEGG pathway enrichment analysis of DEGs. (A) Bar chart of GO annotation for enriched pathways of differentially expressed genes between the Pse and the no-Pse. (B) Bubble chart of KEGG pathway annotations for the enriched differentially expressed genes between the Pse and the no-Pse.
Figure 3. GO and KEGG pathway enrichment analysis of DEGs. (A) Bar chart of GO annotation for enriched pathways of differentially expressed genes between the Pse and the no-Pse. (B) Bubble chart of KEGG pathway annotations for the enriched differentially expressed genes between the Pse and the no-Pse.
Insects 16 00238 g003
Figure 4. qRT-PCR validation of 8 selected DEGs. For each bar chart, the left-hand side shows the detection result of RT-qPCR, while the right-hand side presents the FPKM value from the transcriptome results. These values serve to reflect the gene expression levels. Columns and bars represent the means and standard errors, respectively. Stars indicate statistical significance (*: p-value ≤ 0.05, **: p-value ≤ 0.01).
Figure 4. qRT-PCR validation of 8 selected DEGs. For each bar chart, the left-hand side shows the detection result of RT-qPCR, while the right-hand side presents the FPKM value from the transcriptome results. These values serve to reflect the gene expression levels. Columns and bars represent the means and standard errors, respectively. Stars indicate statistical significance (*: p-value ≤ 0.05, **: p-value ≤ 0.01).
Insects 16 00238 g004
Table 1. Encoding genes and corresponding sequences of the qRT-PCR primers.
Table 1. Encoding genes and corresponding sequences of the qRT-PCR primers.
Prime NameGene NamePrimer Sequences (5′–3′)
EF1a-FActinGAAGCCTGGTATGGTTGTCGT
EF1a-R GGGTGGGTTGTTCTTTGTG
LCT-FLactase rhizosphere hydrolaseGCTGATGTGTATAAGGGCATGGGAG
LCT-R AATCCGCAGCAATATCTCCGTTGAA
UGT-FUDP-glucuronosyl transferaseTCCCTTCGCCAATGGTCTCCAA
UGT-R TGTTCTAGGCACCGCGTGATGA
Vg-FVitellogeninGCACGAGCCATAATTGTTGAG
Vg-R ACCCGGTTTCATGGTTGGT
SgAbd-2-FEndocuticle structural glycoprotein SgAbd-2ACGTCGTACGTCACGAATACA
SgAbd-2-R GGAGACCGCGAGGAAAGAAA
JH-FHormone binding protein (JHBP)AGCTGCACTTATTATCTATAGTTGT
JH-R ATTGTCCGTTCCGTCAATCG
FAS-FFatty acid synthaseTCGCGATCATTGTTATGGTCCT
FAS-R TCAAACCACATTTGTCTGAACAGT
60S-F60S ribosomal protein L13aCTGGTAACTTCGGTTTCGGT
60S-R AAATAAGATAAGCTAACCTTGACG
40S-F40S ribosomal protein S17CTGCCAGAGTCATCATCGAG
40S-R TCATATTTAGTATTTACCCAGCGA
CYP4c1-FCytochrome P450 4c1TAAAACAACTTCAGGGGTGG
CYP4c1-R ACAATGATGGTAAGTTTTTGAGTT
Primer name refers to the name assigned to the designed primer; Gene name represents the name of both the reference gene and the gene employed for quantitative validation; On the far-right side of the table are the upstream and downstream primers of the corresponding gene.
Table 2. The effect of Pseudomonas on the life table parameters of A. gossypii.
Table 2. The effect of Pseudomonas on the life table parameters of A. gossypii.
Parametersno-Pse (n = 45)Pse (n = 45)Significant Levelp-Value
Adult longevity (d)20.72 ± 0.5115.54 ± 0.80****<0.00001
Total longevity (d)24.72 ± 0.0.5119.54 ± 0.0.80****<0.00001
Fecundity (nymphs)45.50 ± 2.3736.71 ± 2.02**0.00449
Oviposition days (d)11.72 ± 0.6610.79 ± 0.52ns0.26517
R0 (offspring)45.49 ± 2.3736.71 ± 2.02**0.00449
r (d−1)0.40 ± 0.010.42 ± 0.01ns0.20238
λ (d−1)1.49 ± 0.0240.50 ± 2.08ns0.19647
T (d)9.53 ± 0.028.60 ± 0.17***0.0004
Values in the table represent the mean ± SE. The data at the significant level represent the level of significant difference between Group A and Group B, where the meaning is: ns: p-value > 0.05, **: p-value ≤ 0.01, ***: p-value ≤ 0.001, ****: p-value ≤ 0.0001. Adult longevity (d) is the lifespan of A. gossypii after emergence; total longevity (d) is the entire life cycle of A. gossypii; fecundity is the offspring number per female; oviposition days (d), the interval between the first and last oviposition of A. gossypii.; R0, net reproductive rate (offspring per individual); r, intrinsic rate of increase (d−1); λ, finite rate of increase (d−1); T, mean generation time (days).
Table 3. Quality control data table of A. gossypii transcriptome.
Table 3. Quality control data table of A. gossypii transcriptome.
SampleRaw ReadsClean ReadsError Rate (%)Q20 (%)Q30 (%)GC Content (%)Mapped
no-Pse 144,619,32643,910,7280.023598.6895.6936.7577.45%
no-Pse 243,081,22442,564,9440.023498.7195.7236.9154.03%
no-Pse 342,073,73641,477,1860.022998.8896.2743.1470.42%
Pse 142,825,85841,983,9160.023498.7195.7836.5190.61%
Pse 241,839,38240,938,1820.023498.6895.7536.2187.82%
Pse 344,730,52243,858,6980.023998.4895.2534.581.29%
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yu, Q.; Niu, R.; Gao, X.; Luo, J.; Cui, J.; Wang, L.; Zhu, X. Pseudomonas Infection Affects the Growth and Development of Aphis gossypii by Disrupting Energy Metabolism and Reproductive Processes. Insects 2025, 16, 238. https://doi.org/10.3390/insects16030238

AMA Style

Yu Q, Niu R, Gao X, Luo J, Cui J, Wang L, Zhu X. Pseudomonas Infection Affects the Growth and Development of Aphis gossypii by Disrupting Energy Metabolism and Reproductive Processes. Insects. 2025; 16(3):238. https://doi.org/10.3390/insects16030238

Chicago/Turabian Style

Yu, Qiqing, Ruichang Niu, Xueke Gao, Junyu Luo, Jinjie Cui, Li Wang, and Xiangzhen Zhu. 2025. "Pseudomonas Infection Affects the Growth and Development of Aphis gossypii by Disrupting Energy Metabolism and Reproductive Processes" Insects 16, no. 3: 238. https://doi.org/10.3390/insects16030238

APA Style

Yu, Q., Niu, R., Gao, X., Luo, J., Cui, J., Wang, L., & Zhu, X. (2025). Pseudomonas Infection Affects the Growth and Development of Aphis gossypii by Disrupting Energy Metabolism and Reproductive Processes. Insects, 16(3), 238. https://doi.org/10.3390/insects16030238

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop