Next Article in Journal
Lobesia botrana Infestation in Petit Verdot and Sangiovese: A Comparative Study
Previous Article in Journal
Ecologo-Geographic Distribution Patterns of the Italian Locust Calliptamus italicus (Linnaeus) (Orthoptera: Acrididae) in the Easternmost Part of Its Range
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 16
Issue 2
10.3390/insects16020212
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification and Expression Profiling of Odorant-Binding Protein Genes in the Bean Flower Thrips Megalurothrips usitatus (Bagnall) (Thysanoptera: Thripidae)

by
Gen Xia
1,†,
Lang Yang
2,†,
Boliao Li
3,†,
Qinli Wang
1,
Lifei Huang
2,
Xiaoli Tian
4 and
Guohui Zhang
1,*
1
College of Agriculture, Yangtze University, Jingzhou 434025, China
2
Guangxi Key Laboratory of Biology for Crop Diseases and Insect Pests, Key Laboratory of Green Prevention and Control on Fruits and Vegetables in South China Ministry of Agriculture and Rural Affairs, Plant Protection Research Institute, Guangxi Academy of Agricultural Science, Nanning 530007, China
3
Shaanxi Province Key Laboratory of Jujube, College of Life Science, Yan’an University, Yan’an 716000, China
4
College of Life Science, Yangtze University, Jingzhou 434025, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Insects 2025, 16(2), 212; https://doi.org/10.3390/insects16020212
Submission received: 12 January 2025 / Revised: 10 February 2025 / Accepted: 13 February 2025 / Published: 14 February 2025
(This article belongs to the Section Insect Molecular Biology and Genomics)
Browse Figures
Versions Notes

Simple Summary

The bean flower thrips Megalurothrips usitatus is an important Leguminosae pest in Asia and has caused enormous economic losses to leguminous crops in Southern China. The current management of this pest is still the application of chemical insecticides and lacks green and efficient control methods. Insect odorant-binding proteins (OBPs) play a central role in discriminating and transporting odorant molecules to odorant receptors, and, thus, OBPs are considered to be key molecular targets for screening environmentally friendly odorant attractants for pest control. Here, we systematically identified 14 OBP genes from the genome of M. usitatus and analyzed their basic structural characteristics and spatiotemporal expression profiles for the first time. The findings of this study will help researchers to further investigate the functions of these OBPs and to develop environmentally friendly control methods against M. usitatus.

Abstract

Megalurothrips usitatus is an economically important vegetable pest. Because of the growing demand for reducing pesticide use on vegetables, new environmentally friendly strategies for controlling M. usitatus are urgently needed. Insect odorant-binding proteins are prospective targets for screening environmentally friendly odorant attractants for pest control. However, very little is known about OBP genes in M. usitatus. Here, we identified 14 OBPs in the M. usitatus genome using HMMER and BLAST. The chromosomal location showed that these OBPs were widely distributed across eight chromosomes. The analysis of the gene and protein structure characteristics of OBPs in M. usitatus revealed substantial diversity within the OBP gene family. The spatiotemporal expression profiles showed that ten out of 14 MusiOBPs displayed male biased expression, which were highly expressed in antennae, suggesting that they may play a crucial role in the recognition of host plant volatiles and thrips aggregation pheromones. Notably, only MusiOBP8 was significantly higher expressed in female adults, indicating a potential involvement in reproduction. Moreover, MusiOBP7 and MusiOBP13 were highly expressed in the pupae, indicating their possible role in immune responses. These results provide an important foundation for further exploration of the functions of the OBPs in M. usitatus.

1. Introduction

The bean flower thrips, Megalurothrips usitatus (Bagnall) (Thysanoptera: Thripidae), is a destructive pest attacking leguminous crops in Asia [1,2,3,4]. The insect can damage the whole growth period of legumes by feeding on flowers, leaves, and pods and laying eggs in plant tissue, resulting in leaf deformity, necrosis and premature abortion of buds and flowers, and pod scab [3,5]. It can cause significant losses of yield, quality, and commodity value in crop production. To manage this pest, applying chemical insecticides is still the main method [6,7,8]. However, excessive pesticide usage against M. usitatus has led to the development of resistance and the production of pesticide residues that cause environmental contamination and risk consumer health [9,10,11]. Therefore, developing green and efficient management strategies against M. usitatus is important.
Insects have evolved a sensitive olfactory system to locate mates, host plants, and oviposition sites and escape from threats [12,13,14]. It has been demonstrated that the accurate operation of the system relies on a series of olfactory proteins, including odorant-binding proteins (OBPs), chemosensory proteins (CSPs), odorant receptors (ORs), gustatory receptors (GRs), ionotropic receptors (IRs), sensory neuron membrane proteins (SNMPs), odorant degrading enzymes (ODEs), and Niemann–Pick protein C2 (NPC2) [15,16]. Notably, OBPs are involved in the first biochemical reaction in the olfactory transduction cascade and play a central role in discriminating, binding, and transporting odorant molecules to ORs [17,18,19]. OBPs are small, globular, and hydrosoluble proteins [20,21]. The characteristic of OBPs is the highly conserved cysteines (Cys) that are paired to form interlocked disulfide bonds [22]. Based on the number of Cys residues in sequences, OBPs can be divided into four major subfamilies: Classic OBPs (with six conserved Cys residues), Minus-C OBPs (with four or five Cys residues), Plus-C OBPs (at least eight Cys residues and a conserved proline residue after the sixth Cys residue), and Atypical OBPs (with nine or ten Cys residues and an extended C-terminal region) [19,23,24]. Most studies have shown that OBPs could participate in the perception of external odorant cues. For example, mutants of OBP76a (lush) show abnormal behavioral responses to cis-vaccenyl acetate (cVA), the male sex pheromone in Drosophila melanogaster [25]. Similarly, knockdown of ApisOBP3 and ApisOBP7 altered the adult repellent behavioral responses towards the alarm pheromone (E)-β-farnesene (EBF) in aphids Acyrthosiphon pisum [26]. In Rhynchophorus ferrugineus, RferOBP8 and RferOBP11 are involved in the discrimination of palm volatiles and aggregation pheromones [27]. Therefore, OBPs have the potential to be used as molecular targets to screen efficient pest behavioral control agents. In addition to odorant perception functions, some OBPs have other physiological functions, including in taste, mating behavior, humidity detection, immunity response, and insecticide resistance [28,29,30,31,32].
Since the first OBP was reported in the male antennae of Antheraea polyphemus in 1981 [22], insect OBPs have been gradually identified by transcriptome or genomic analyses. For instance, 51 OBPs were identified in the genome of Drosophila melanogaster [23], 7 OBPs in the antennal transcriptome of Frankliniella occidentalis [33], 6 OBPs in the antennal transcriptome of F. intonsa [33], and 33 OBPs in the genome of Spodoptera frugiperda [34]. However, the current understanding of the OBPs in M. usitatus is insufficient. To date, only one OBP gene has been identified in M. usitatus from the transcriptome [35]. Recently, the chromosome-level genome of M. usitatus has been released [36], and we can deeply explore OBPs in the M. usitatus genome. In this study, we first identified OBP genes in the genome of M. usitatus. Then, we analyzed their basic characteristics, including chromosomal location, phylogenetic analysis, gene structure, motif, and domain analysis. Finally, real-time quantitative polymerase chain reaction (RT-qPCR) was used to analyze the expression patterns of these OBP genes in different developmental stages and tissues of both sexes. The results will help us to investigate the functions of OBPs and to develop environmentally friendly control methods against M. usitatus.

2. Materials and Methods

2.1. Identification of OBP Genes in M. usitatus

The whole-genome sequence assembly Mus_1.0 (GenBank assembly number: GCA_026979955.1), GFF annotation file, total CDS sequence, and total protein sequence file of M. usitatus were acquired from the NCBI website (https://www.ncbi.nlm.nih.gov/datasets/genome/GCA_026979955.1/, accessed on 18 January 2024). Putative odorant-binding protein (OBP) genes in M. usitatus were identified using HMMER and BLAST based on genome data. The HMM file for OBP (PF01395: PBP/GOBP family) was downloaded from the Pfam database (v. 35.0). HMMER searching was conducted using the HMMER software (version 3.3) [37] to retrieve potential protein sequences of M. usitatus OBPs. Subsequently, the potential OBPs were manually checked by BLASTP searches against the NCBI Nr database [38]. The final identification results were combined with the results of these two approaches. Putative N-terminal signal peptides of all OBPs were predicted by the SignalP5.0 online program (https://services.healthtech.dtu.dk/services/SignalP-5.0/, accessed on 18 January 2024) [39]. The protein sequences of OBPs without signal peptides were aligned using the muscle method with Jalview software (version 2.11.4.0) [40].

2.2. Chromosomal Location, Phylogenetic Analysis, and Structural Characteristics Analyses of MusiOBPs

Chromosomal location information of OBP genes was extracted from the M. usitatus GFF annotation file and mapped onto the chromosomes using TBtools (version 2.154) [41]. The phylogenetic tree of full-length protein sequences of OBPs from M. usitatus was constructed using the neighbor-joining (NJ) method. Trees with 1000 bootstrap replicates were built and improved using MEGA 11.0 software (version 11.0.13) [42]. The maximum likelihood phylogenetic tree of OBPs was constructed with the full-length protein sequences of OBPs from M. usitatus (Thysanoptera), Odontothrips loti (Thysanoptera), Thrips palmi (Thysanoptera), F. occidentalis (Thysanoptera), F. intonsa (Thysanoptera), Locusta migratoria (Orthoptera), A. pisum (Hemiptera), D. melanogaster (Diptera), Tribolium castaneum (Coleoptera), Apis mellifera (Hymenoptera), and S. exigua (Lepidoptera) (Supplementary Data Sheet S1) using the IQ-TREE web server (http://iqtree.cibiv.univie.ac.at/, accessed on 28 January 2025) with 1000 bootstrap replicates and visualized in iTOL (https://itol.embl.de/, accessed on 28 January 2025). The exon–intron structure of MusiOBP genes was constructed by TBtools (version 2.154) [41]. The motif patterns of MusiOBPs were discovered using the MEME online server (https://meme-suite.org/meme/tools/meme, accessed on 31 October 2024) with the number of motifs as 10 [43], and the conservative domains of MusiOBPs were analyzed by the Conserved Domain Database (NCBI-CDD) (https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi, accessed on 31 October 2024) [44]. Finally, the above results of structural characteristics were visualized and merged via TBtools (version 2.154) [41].

2.3. Insect Rearing and Sample Collection

The insects used in this study were from a laboratory colony of M. usitatus provided by the Institute of Plant Protection and Microbiology, Zhejiang Academy of Agricultural Sciences, Hangzhou, China. The population was reared on fresh Lablab purpureus in an artificial incubator at 26 ± 1 °C, 70 ± 5% relative humidity, with a photoperiod of 14 L: 10 D. For developmental stage expression profiling, the first instar nymphs (60), second instar nymphs (60), prepupae (60), pseudo-pupae (50), 1–3-days-old female adults (60), and 1–3-days-old male adults (100) were collected separately. For tissue expression profiling, around 150 male and 100 female M. usitatus adults of 1–3 days old were dissected on ice to remove the antennae using 1 mL medical syringes under a light microscope. Then, adults without antennae (A−) were obtained and collected. Adults (A+) of male (150) and female (100) of 1–3 days old were collected separately after eclosion. All samples were collected with three biological replicates and stored at −80 °C until use.

2.4. RNA Extraction and cDNA Synthesis

Total RNA was extracted from the above samples using M5 Total RNA Extraction Reagent (Mei5bio, Wuhan, China) according to the manufacturer’s instructions. The quality and quantity of the RNA samples were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). In addition, the integrity of the RNA was detected with 1% agarose electrophoresis. Subsequently, 1 μg of total RNA from different developmental stages’ samples and 0.5 μg of total RNA from different tissues’ samples were reverse transcribed to cDNA using the PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, China) following the manufacturer’s protocol, after which the cDNA was stored at −20 °C until use.

2.5. Real-Time Quantitative PCR Analysis of MusiOBPs

Real-time quantitative PCR (RT-qPCR) was used to analyze the expression levels of OBP genes in different developmental stages and tissues of both sexes. Gene-specific primers were designed with the Primer3 web service (https://primer3.ut.ee/, accessed on 20 March 2024) and are shown in Table 1. The lengths of the PCR products ranged from 100 to 211 bp. The cDNA templates from different developmental stages and tissues were diluted 5-fold with sterile water, and 1 μL of the diluted cDNA was used as template for subsequent RT-qPCR analysis. RT-qPCR was performed with TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) (TaKaRa, Dalian, China) in the ABI QuantStudioTM 6 Flex Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Each RT-qPCR reaction was conducted in a total volume of 20 μL mixture containing 10 μL of TB Green Premix Ex Taq II (Tli RNaseH Plus) (2×), 0.8 μL of each primer (10 μM), 0.4 μL of ROX Reference Dye II (50×), 1 μL of diluted cDNA, and 7 μL of sterile water. The amplification procedure was as follows: 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s, 51/54 °C for 15 s, and 72 °C for 20 s. After 40 cycles, 95 °C, 15 s, and melting curves were conducted at increments of 0.5 °C from 60 to 95 °C for 0.05 s each to detect the presence of a single gene-specific peak and the absence of primer dimer peaks for each gene. All developmental stages and tissues were performed with three biological and three technical replications. The relative expression levels of OBP genes of M. usitatus were analyzed using the 2−ΔΔCT method [45] and normalized with the reference genes RPL and ACT of M. usitatus [46]. The data are represented as the mean ± standard error (mean ± SE). Statistical comparison of gene expression in different developmental stages was performed using a one-way analysis of variance followed by Tukey’s honestly significant difference test. Statistical significance of different letters was considered at p < 0.05. The Student’s t-test was used to analyse the expression of these OBP genes in different tissues and sexes (* p < 0.05; ** p < 0.01; *** p < 0.001; ns, not significant). The statistical analysis was conducted and visualized on IBM SPSS software (version 26.0) and GraphPad Prism software (version 10.1.2) (Inc., La Jolla, CA, USA).

3. Results

3.1. Genome-Wide Identification of OBP Genes in M. usitatus

In the present study, 14 OBP genes were identified in M. usitatus based on the Mus_1.0 genome data using the Hidden-Markov-Model (HMM) search and BLASTP (Table 2). Based on the chromosomal location, the sequences were named MusiOBP1-14. These OBP genes had complete open reading frames (ORFs), potentially encoding proteins consisting of 103 (MusiOBP12) to 211 (MusiOBP9) amino acids, with the majority falling around the 140 amino acid mark (Table 2). Most of these OBPs had a signal peptide ranged from 17 to 29 amino acids, except for MusiOBP2, 3, 12 (Table 2). In addition, most of the MusiOBPs had homology with the OBPs of F. fusca and O. loti (Table 2). Based on the number of conserved cysteines, the OBPs of M. usitatus were divided into two subfamilies, namely, Classic OBPs and Minus-C OBPs. Nine OBPs of M. usitatus belonged to the Classic OBP subfamily (MusiOBP2-5, MusiOBP9, and MusiOBP11-14), which had six conserved cysteine residues and corresponding spaces (Figure 1A). Among them, MusiOBP3 and MusiOBP12 lacked the conserved C1, although classified as a Classic OBP given the conservation of the other five conserved cysteines and corresponding spaces (Figure 1A). The remaining five OBPs of M. usitatus belonged to the Minus-C OBP subfamily (MusiOBP1, MusiOBP6-8, and MusiOBP10), which had four conserved cysteine residues, lacking C2 and C5 (Figure 1B).

3.2. Chromosomal Location of OBP Genes in M. usitatus

The chromosomal location analysis of all 14 OBPs showed that they were widely distributed across eight out of the total sixteen chromosomes, with OBPs located on Chr1-5, Chr7, Chr10, and Chr11 (Figure 2). Notably, Chr4 harbored six OBPs, and three OBPs (MusiOBP6-8) clustered tightly on Chr4 (Figure 2). Additionally, Chr3 harbored two OBPs, while Chr1, Chr2, Chr5, Chr7, Chr10, and Chr11 each harbored a single OBP (Figure 2).

3.3. Gene and Protein Structure of OBPs in M. usitatus

The analysis of the motif pattern and conservative domains of OBP proteins and exon-intron of OBP genes in M. usitatus revealed substantial diversity within the OBP gene family (Figure 3). The phylogenetic tree of OBPs in M. usitatus divided the full-length protein sequences into three subgroups. Motif pattern analysis revealed that all OBP sequences presented motif 1, and the OBP sequences from subgroup 1 presented motif 1 and motif 2, except for MusiOBP2 (Figure 3). Notably, MusiOBP9 from subgroup2 had the most motifs (five motifs), while MusiOBP6 from subgroup3 presented only motif 1 (Figure 3). The conservative domain analysis using NCBI-CDD confirmed that all OBPs contained PBP_GOBP and PhBP domains (Figure 3). In addition, the exon–intron analysis showed that the number of exons ranged from one to seven, with most OBPs containing six to seven exons (Figure 3). Notably, MusiOBP2 contained only a long exon. Additionally, eight OBPs exhibited 5′ and 3′ UTRs, three genes (MusiOBP3, MusiOBP7, and MusiOBP8) contained only 5′ UTR, while three others (MusiOBP2, MusiOBP5, and MusiOBP12) presented no UTR (Figure 3).

3.4. Phylogenetic Analysis of OBPs

To show the homologous relationships of all OBPs in M. usitatus with other insect OBPs, a phylogenetic tree was established using the full-length protein sequences of 196 OBPs of 11 species from seven orders (Figure 4). In terms of species affinities, nine out of fourteen MusiOBPs were more closely related to Thysanoptera, especially to O. loti, which was consistent with the results of BLASTP (Table 2). Among them, MusiOBP2 was a homolog of FoccOBP6; MusiOBP3 was a homolog of OlotOBP4; MusiOBP5 was a homolog of OlotOBP1; MusiOBP8 was a homolog of OlotOBP7; MusiOBP11 and MusiOBP12 were closely related to TpalOBP56h-like; MusiOBP13 was a homolog of TpalOBP56d-like; and MusiOBP14 was a homolog of OlotOBP6 (Figure 4). Interestingly, three MusiOBPs had homology with the OBPs of S. exigua. MusiOBP4 was closely related to SexiOBP4; MusiOBP9 was closely related to SexiOBP1 and SexiOBP2; and MusiOBP10 was closely related to SexOBP10 and SexiOBP17 (Figure 4).

3.5. Expression Patterns of OBPs in Different Developmental Stages of M. usitatus

The results of the relative expression level of OBPs showed that ten out of fourteen OBPs (MusiOBP1-6, MusiOBP9, MusiOBP11, MusiOBP12, and MusiOBP14) were significantly higher expressed in male adults, while MusiOBP8 was significantly higher expressed in female adults (Figure 5). Interestingly, MusiOBP10 was highly expressed in both female and male adults, followed by the second instar nymphs (N2), but there were no significant differences between the three of them (Figure 5). In addition, MusiOBP7 was highly expressed at the prepupae stage (P1), while MusiOBP13 was highly expressed at the pseudo-pupae stage (P2) (Figure 5).

3.6. Tissue- and Sex-Specific Expression Patterns of OBPs in M. usitatus

The expression of 14 OBPs in adults (A+) and adults without antennae (A−) of both sexes in M. usitatus were monitored by RT-qPCR (Figure 6). The results showed that 11 out of 14 OBPs had significantly different expression levels between the same sex adults with and without antennae (p < 0.05), except for MusiOBP7, MusiOBP8, and MusiOBP13 (Figure 6). Among them, seven OBPs (MusiOBP3, MusiOBP5, MusiOBP6, MusiOBP10-12, and MusiOBP14) were expressed significantly higher in adults (A+) of both sexes, and three OBPs (MusiOBP2, MusiOBP4, and MusiOBP9) were expressed significantly higher in female adults (A+), while MusiOBP1 was expressed significantly higher in male adults (A+) (Figure 6). In addition, the results also showed that 12 out of 14 OBPs had significantly different expression levels in different sexes of adults with/without antennae (p < 0.05), except for MusiOBP10 and MusiOBP13 (Figure 6). Among them, five OBPs (MusiOBP2, MusiOBP4, MusiOBP8, MusiOBP9, and MusiOBP11) showed significant differences in adults (A+) and adults without antennae (A−) between females and males, and six OBPs (MusiOBP1, MusiOBP3, MusiOBP5, MusiOBP6, MusiOBP12, and MusiOBP14) showed significant differences in adults (A+) between females and males, while MusiOBP7 showed significant differences in adults without antennae (A−) between females and males (Figure 6). Notably, only MusiOBP8 had a significantly higher expression level in females than males across the adults with/without antennae (Figure 6). After excluding the adults without antennae (A−), we compared the expression levels of 14 OBPs in the antennae between females and males. The results showed that nine out of fourteen OBPs were expressed significantly higher in male antennae than female antennae (p < 0.05), except for MusiOBP4, MusiOBP7, MusiOBP8, MusiOBP10, and MusiOBP13 (Figure S1).

4. Discussion

M. usitatus is one of the most serious pests of cowpea in China, especially the southern regions [47]. Due to the excessive use of chemical pesticides against M. usitatus, coupled with growing concerns about insecticide resistance and food safety, it is essential to develop efficient and sustainable management strategies to control this pest. Insects largely rely on their chemosensory system to survive and reproduce, with OBPs playing a vital role in these chemosensory processes [27,48]. Therefore, a better understanding of the chemosensory system, especially OBPs in M. usitatus, could contribute to exploring environmentally friendly control approaches. Despite the important role and potential value of OBP genes, studies on this gene family of M. usitatus are rarely reported. In this study, to expand our knowledge of the thrips chemosensory system, we systematically identified OBP genes in M. usitatus using genome data. Furthermore, we characterized the expression patterns of these OBPs in different developmental stages and tissues of both sexes.
The identification of olfactory genes is a pre-requisite for illustrating the molecular basis of chemosensation [49]. OBP genes have been identified in numerous insect species using transcriptome and genome analyses [23,24,50,51]. The number of OBP genes varies considerably across species, ranging from 7 in Megachile rotundata to 109 in Cluex quinquefasciatus [52]. In the present study, we identified 14 OBP genes in M. usitatus genome, higher than that observed in other thrip species, such as F. occidentalis (twelve OBPs) [53], T. palmi (eight OBPs) [53], F. intonsa (six OBPs) [33] and O. loti (six OBPs) [53], which may be associated with its higher environmental adaptability, especially on cowpea Vigna unguiculata L. [54]. In addition, the sequence of MusiOBP5 in our findings is similar to MusiOBP1 identified by Li et al. [35], but the 3′ end differs. This discrepancy is likely due to errors occurring during the amplification or splicing process, as MusiOBP1 was obtained by using RACE PCR.
Chromosomal location, gene structure, and conserved domain analysis are crucial for exploring the evolutionary relationships and functional characteristics of OBPs [55,56]. Our results showed that most of MusiOBPs were distributed on different chromosomes, with six OBPs clustered on Chr4, followed by two OBPs on Chr3. This distribution suggests potential gene duplications in the genome [57], which may indicate a relatively recent expansion of the OBP genes of M. usitatus [58]. Notably, three of them were clustered tightly on Chr4, which may have analogous functions [34]. For example, in Solenopsis invicta, ten of twenty-four OBPs located in the social chromosome may involve in regulating behavioral differences between single- and multiple-queen colonies [59]. In addition, our results showed that the OBP genes in M. usitatus had divergent patterns of exon–intron organization, which may broaden a potential for alternative splicing [34] and contribute to functional diversification [58]. Moreover, the motif analysis further highlighted the variable motif patterns, suggesting that these OBPs may have specialized and divergent functions. Nevertheless, all MusiOBPs contained PBP_GOBP and PhBP domains, which are characteristic features of insect OBP [60].
Phylogenetic analysis among 11 species from seven orders showed that the OBPs from M. usitatus were more closely related to OBPs from O. loti, S. exigua, T. palmi, and F. occidentalis, which share some host plants with M. usitatus [33,53,61], indicating that these phylogenetically correlated OBPs may have similar functions. Notably, MusiOBP2 and MusiOBP14 were closely related to FoccOBP6 and OlotOBP6, respectively. In F. occidentalis, FoccOBP6 may involve in delivering two aggregation pheromones [33], while OlotOBP6 in O. loti plays a role in host plant location [53]. Thus, MusiOBP2 and MusiOBP14 may have similar roles.
The expression patterns provide important cues for exploring their functions. In this study, the expression patterns in different developmental stages showed that 12 out of 14 OBPs (except for MusiOBP7 and MusiOBP13) were highly expressed in adults (Figure 5) and 11 in antennae out of 12 OBPs (Figure 6, MusiOBP1-6, MusiOBP9-12, and MusiOBP14), especially in male adults (Figure 6, MusiOBP1, MusiOBP3, MusiOBP5, MusiOBP6, MusiOBP10-12, and MusiOBP14), implying that these genes may play a crucial role during the adult stage. Similar expression patterns have been reported in other thrips. For instance, five out of seven OBPs in F. occidentalis and five out of six OBPs in F. intonsa were highly expressed both in the adult stage and in antennae, suggesting their involvement in host plant volatile recognition and thrips aggregation pheromones detection [33]. Moreover, in O. loti, OBP1, OBP4, and OBP6 were highly expressed both in male adults and in antennae, with OBP6 specifically implicated in host location [53]. Thus, these 12 OBPs of M. usitatus may be associated with a role in olfaction, such as host plant location, mating, and reproduction. Interestingly, only MusiOBP8 was significantly higher expressed in female adults, which even may not express in antennae, suggesting that this OBP may play an important role in female-specific behaviors, such as reproduction.
MusiOBP10 was highly expressed not only in adults but also in the second instar nymphs (N2). Previous studies have documented OBP expression in both adults and nymphs, with findings indicating that these OBPs may mediate the response to alarm pheromones [62]. In M. usitatus, male adults can produce an aggregation pheromone that attracts conspecific female and male adult individuals [63], while Dendrothrips minowai larvae release two aggregation pheromones to attract larvae and adults [64]. Hence, MusiOBP10 may participate in the detection of aggregation pheromones.
MusiOBP7 and MusiOBP13 were highly expressed in the prepupae and pseudo-pupae stage, respectively. Recently, a study found that PverOBP18 was highly expressed in the pupae, which enhanced the pathogen resistance of Plagiodera versicolora larvae [65]. Therefore, MusiOBP7 and MusiOBP13 may play a vital role in immune responses.
The results of tissue expression patterns showed that 11 out of 14 OBPs (except for MusiOBP7, MusiOBP8, and MusiOBP13) had significantly different expression levels between the same-sex adults with and without antennae (p < 0.05), suggesting that these genes were likely to express in antennae of adults. Antennae are primary olfactory organs for insects, and numerous studies indicate that the highly expressed genes in antennae play a pivotal role in olfaction [66,67,68,69,70]. Thus, these 11 OBPs of M. usitatus may have potential involvement in olfactory perception, while the remaining three OBPs (MusiOBP7, MusiOBP8, and MusiOBP13) appear to serve other physiological functions, as no significant expression differences were observed across the adults with/without antennae. Furthermore, the expression of 12 OBPs (except for MusiOBP10 and MusiOBP13) in different sexes of adults with/without antennae exhibited significant differences, implying functional differentiation between females and males. To sum up, these OBPs are worth studying for their functions in the future.

5. Conclusions

In summary, we systematically identified 14 OBP genes from the whole genome of M. usitatus and named the MusiOBPs based on the chromosomal location for the first time. Then, we analyzed their basic characteristics including phylogenetic analysis, gene structure, motif pattern and conservative domain, and spatiotemporal expression profiles. These findings will provide a solid foundation for future research to identify the roles of MusiOBPs, which will also contribute to understanding the olfactory mechanism of M. usitatus and develop environmentally friendly control approaches against M. usitatus in the future.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/insects16020212/s1, Supplementary Data Sheet S1: The OBP amino acid sequences used for the phylogenetic tree; Figure S1. The relative expression level of OBP genes in the antennae of M. usitatus.

Author Contributions

Conceptualization, G.Z., G.X. and B.L.; methodology, G.Z., G.X., L.Y., B.L., Q.W. and L.H.; formal analysis, G.Z., G.X., L.Y., B.L., L.H. and X.T.; writing—original draft preparation, G.Z., G.X., L.Y. and B.L.; writing—review and editing, G.Z., G.X., B.L., Q.W., L.H. and X.T. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Project of Guangxi Key Laboratory of Biology for Crop Diseases and Insect Pests (No. 22-035-31-23KF06), the National Natural Science Foundation of China (No. 31972274), the Outstanding Youth Science and Technology Innovation Team Project of Colleges and Universities in Hubei Province (No. T2022009), and the Natural Science Foundation Research Project of Shaanxi province of China (No. 2021JQ-621).

Data Availability Statement

The entire M. usitatus genome data were downloaded from the National Center for Biotechnology information (NCBI) GenBank website (accession number: GCA_026979955.1).

Acknowledgments

We are grateful to Xiaowei Li (Institute of Plant Protection and Microbiology, Zhejiang Academy of Agricultural Sciences, Hangzhou, China) for providing the insects M. usitatus used in this study.

Conflicts of Interest

The authors declare no competing financial interests.

References

  1. Oparaeke, A.M. The sensitivity of flower bud thrips, Megalurothrips sjostedti Trybom (Thysanoptera: Thripidae), on cowpea to three concentrations and spraying schedules of Piper guineense Schum. & Thonn. extracts. Plant Protect. Sci. 2006, 42, 106–111. [Google Scholar]
  2. Duraimurugan, P.; Tyagi, K. Pest spectra, succession and its yield losses in mungbean and urdbean under changing climatic scenario. Legume Res. 2014, 37, 212–222. [Google Scholar] [CrossRef]
  3. Tang, L.D.; Yan, K.L.; Fu, B.L.; Wu, J.H.; Liu, K.; Lu, Y.Y. The life table parameters of Megalurothrips usitatus (Thysanoptera: Thripidae) on four leguminous crops. Fla. Entomol. 2015, 98, 620–625. [Google Scholar] [CrossRef]
  4. Yasmin, S.; Ali, M.; Rahman, M.M.; Akter, M.S.; Latif, M.A. Biological traits of bean flower thrips, Megalurothrips usitatus (Thysanoptera: Thripidae) reared on mung bean. Herit. Sci. 2021, 5, 29–33. [Google Scholar] [CrossRef]
  5. Pan, X.; Yang, L.; Jin, H.; Lu, R.; Li, F.; Cao, F.; Wu, S. Research advances in occurrence and control of Megalurothrips usitatus in Hainan. J. Trop. Biol. 2021, 12, 508–513. [Google Scholar]
  6. Peter, C.; Govindarajulu, V. Management of blossom thrips, Megalurothrips usitatuson pigeonpea. Trop. Pest Manag. 1990, 36, 312–313. [Google Scholar] [CrossRef]
  7. Hossain, M.A. Efficacy of some insecticides against insect pests of mungbean (Vigna radiata L.). Bangladesh J. Agril. Res. 2015, 40, 657–667. [Google Scholar] [CrossRef]
  8. Maradi, R.M.; Rajashekharappa, K.; Pradhan, K. Evaluation of bio-efficacy of newer molecules of insecticides against thrips, Megalurothrips usitatus in yard long bean, Vigna unguiculata subsp. sesquipedalis. Bioscan 2020, 15, 189–192. [Google Scholar]
  9. Tang, L.D.; Zhao, H.Y.; Fu, B.L.; Han, Y.; Liu, K.; Wu, J.H. Colored sticky traps to selectively survey thrips in cowpea ecosystem. Neotrop. Entomol. 2016, 45, 96–101. [Google Scholar] [CrossRef] [PubMed]
  10. Srinivasan, R.; Paola, S.; Lin, M.-Y.; Chhun Hy, H.; Sareth, K.; Sor, S. Development and validation of an integrated pest management strategy for the control of major insect pests on yard-long bean in Cambodia. Crop Prot. 2019, 116, 82–91. [Google Scholar] [CrossRef]
  11. Tang, L.D.; Guo, L.H.; Ali, A.; Desneux, N.; Zang, L.S.; Musser, F. Synergism of adjuvants mixed with spinetoram for the management of bean flower thrips, Megalurothrips usitatus (Thysanoptera: Thripidae) in Cowpeas. J. Econ. Entomol. 2022, 115, 2013–2019. [Google Scholar] [CrossRef]
  12. Bruce, T.J.A.; Wadhams, L.J.; Woodcock, C.M. Insect host location: A volatile situation. Trends Plant Sci. 2005, 10, 269–274. [Google Scholar] [CrossRef]
  13. Hansson, B.; Stensmyr, M. Evolution of insect olfaction. Neuron 2011, 72, 698–711. [Google Scholar] [CrossRef] [PubMed]
  14. Carrasco, D.; Larsson, M.C.; Anderson, P. Insect host plant selection in complex environments. Curr. Opin. Insect Sci. 2015, 8, 1–7. [Google Scholar] [CrossRef] [PubMed]
  15. Rützler, M.; Zwiebel, L.J. Molecular biology of insect olfaction: Recent progress and conceptual models. J. Comp. Physiol. A 2005, 191, 777–790. [Google Scholar] [CrossRef] [PubMed]
  16. Zhu, J.; Guo, M.; Ban, L.; Song, L.M.; Liu, Y.; Pelosi, P.; Wang, G. Niemann-Pick C2 proteins: A new function for an old family. Front. Physiol. 2018, 9, 52. [Google Scholar] [CrossRef] [PubMed]
  17. Sun, L.; Wang, Q.; Wang, Q.; Dong, K.; Xiao, Y.; Zhang, Y.J. Identification and characterization of odorant binding proteins in the forelegs of Adelphocoris lineolatus (Goeze). Front. Physiol. 2017, 8, 735. [Google Scholar] [CrossRef]
  18. Tang, B.; Tai, S.; Dai, W.; Zhang, C. Expression and functional analysis of two odorant-binding proteins from Bradysia odoriphaga (Diptera: Sciaridae). J. Agric. Food Chem. 2019, 67, 3565–3574. [Google Scholar] [CrossRef] [PubMed]
  19. Brito, N.F.; Moreira, M.F.; Melo, A.C.A. A look inside odorant-binding proteins in insect chemoreception. J. Insect Physiol. 2016, 95, 51–65. [Google Scholar] [CrossRef] [PubMed]
  20. Pelosi, P. Odorant-binding proteins. Crit. Rev. Biochem. Mol. Biol. 1994, 29, 199–228. [Google Scholar] [CrossRef] [PubMed]
  21. Leal, W.S. Odorant reception in insects: Roles of receptors, binding proteins, and degrading enzymes. Annu. Rev. Entomol. 2013, 58, 373–391. [Google Scholar] [CrossRef] [PubMed]
  22. Vogt, R.G.; Riddiford, L.M. Pheromone binding and inactivation by moth antennae. Nature 1981, 293, 161–163. [Google Scholar] [CrossRef]
  23. Hekmat-Scafe, D.S.; Scafe, C.R.; Mckinney, A.J.; Tanouye, M.A. Genome-wide analysis of the odorant-binding protein gene family in Drosophila melanogaster. Genome Res. 2002, 12, 1357–1369. [Google Scholar] [CrossRef] [PubMed]
  24. Manoharan, M.; Ng Fuk Chong, M.; Vaïtinadapoulé, A.; Frumence, E.; Sowdhamini, R.; Offmann, B. Comparative genomics of odorant binding proteins in Anopheles gambiae, Aedes aegypti, and Culex quinquefasciatus. Genome Biol. Evol. 2013, 5, 163–180. [Google Scholar] [CrossRef] [PubMed]
  25. Billeter, J.C.; Levine, J.D. The role of cVA and the odorant binding protein lush in social and sexual behavior in Drosophila melanogaster. Front. Ecol. Evol. 2015, 3, 75. [Google Scholar] [CrossRef]
  26. Zhang, R.; Wang, B.; Grossi, G.; Falabella, P.; Liu, Y.; Yan, S.; Lu, J.; Xi, J.; Wang, G. Molecular basis of alarm pheromone detection in aphids. Curr. Biol. 2017, 27, 55–61. [Google Scholar] [CrossRef] [PubMed]
  27. Huang, Y.; Hu, W.; Hou, Y.M. Host plant recognition by two odorant-binding proteins in Rhynchophorus ferrugineus (Coleoptera: Curculionidae). Pest Manag. Sci. 2023, 79, 4521–4534. [Google Scholar] [CrossRef] [PubMed]
  28. Rihani, K.; Fraichard, S.; Chauvel, I.; Poirier, N.; Delompré, T.; Neiers, F.; Tanimura, T.; Ferveur, J.F.; Briand, L. A conserved odorant binding protein is required for essential amino acid detection in Drosophila. Commun. Biol. 2019, 2, 245. [Google Scholar] [CrossRef]
  29. Swarup, S.; Williams, T.I.; Anholt, R.R.H. Functional dissection of odorant binding protein genes in Drosophila melanogaster. Genes Brain Behav. 2011, 10, 648–657. [Google Scholar] [CrossRef]
  30. Sun, J.S.; Larter, N.K.; Chahda, J.S.; Rioux, D.; Gumaste, A.; Carlson, J.R. Humidity response depends on the small soluble protein Obp59a in Drosophila. Elife 2018, 7, e39249. [Google Scholar] [CrossRef] [PubMed]
  31. Benoit, J.B.; Vigneron, A.; Broderick, N.A.; Wu, Y.; Sun, J.S.; Carlson, J.R.; Aksoy, S.; Weiss, B.L. Symbiont-induced odorant binding proteins mediate insect host hematopoiesis. Elife 2017, 6, e19535. [Google Scholar] [CrossRef] [PubMed]
  32. Xiao, X.; Yin, X.H.; Hu, S.Y.; Miao, H.N.; Wang, Z.; Li, H.; Zhang, Y.J.; Liang, P.; Gu, S.H. Overexpression of two odorant binding proteins confers chlorpyrifos resistance in the green peach aphid Myzus persicae. J. Agric. Food Chem. 2024, 72, 20101–20113. [Google Scholar] [CrossRef]
  33. Li, X.; Cheng, J.; Chen, L.; Huang, J.; Zhang, Z.; Zhang, J.; Ren, X.; Hafeez, M.; Zhou, S.; Dong, W.; et al. Comparison and functional analysis of odorant-binding proteins and chemosensory proteins in two closely related thrips species, Frankliniella occidentalis and Frankliniella intonsa (Thysanoptera: Thripidae) based on antennal transcriptome analysis. Int. J. Mol. Sci. 2022, 23, 13900. [Google Scholar] [CrossRef]
  34. Jia, C.; Mohamed, A.; Cattaneo, A.M.; Huang, X.; Keyhani, N.O.; Gu, M.; Zang, L.; Zhang, W. Odorant-binding proteins and chemosensory proteins in Spodoptera frugiperda: From genome-wide identification and developmental stage-related expression analysis to the perception of host plant odors, sex pheromones, and insecticides. Int. J. Mol. Sci. 2023, 24, 5595. [Google Scholar] [CrossRef] [PubMed]
  35. Li, Z.; Chen, W.; Wang, X.; Sang, W.; Pan, H.; Ali, S.; Tang, L.; Wu, J. Transcriptome analysis of Megalurothrips usitatus (Bagnall) identifies olfactory genes with ligands binding characteristics of MusiOBP1 and MusiCSP1. Front. Physiol. 2022, 13, 978534. [Google Scholar] [CrossRef]
  36. Ma, L.; Liu, Q.; Wei, S.; Liu, S.; Tian, L.; Song, F.; Duan, Y.; Cai, W.; Li, H. Chromosome-level genome assembly of bean flower thrips Megalurothrips usitatus (Thysanoptera: Thripidae). Sci. Data 2023, 10, 252. [Google Scholar] [CrossRef]
  37. Mistry, J.; Finn, R.D.; Eddy, S.R.; Bateman, A.; Punta, M. Challenges in homology search: HMMER3 and convergent evolution of coiled-coil regions. Nucleic Acids Res. 2013, 41, e121. [Google Scholar] [CrossRef] [PubMed]
  38. Ye, J.; Mcginnis, S.; Madden, T.L. BLAST: Improvements for better sequence analysis. Nucleic Acids Res. 2006, 34, W6–W9. [Google Scholar] [CrossRef] [PubMed]
  39. Almagro Armenteros, J.J.; Tsirigos, K.D.; Sønderby, C.K.; Petersen, T.N.; Winther, O.; Brunak, S.; Von Heijne, G.; Nielsen, H. SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat. Biotechnol. 2019, 37, 420–423. [Google Scholar] [CrossRef]
  40. Waterhouse, A.M.; Procter, J.B.; Martin, D.M.A.; Clamp, M.; Barton, G.J. Jalview Version 2—A multiple sequence alignment editor and analysis workbench. Bioinformatics 2009, 25, 1189–1191. [Google Scholar] [CrossRef] [PubMed]
  41. Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “one for all, all for one” bioinformatics platform for biological big-data mining. Mol. Plant. 2023, 16, 1733–1742. [Google Scholar] [CrossRef] [PubMed]
  42. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
  43. Bailey, T.L.; Johnson, J.; Grant, C.E.; Noble, W.S. The MEME Suite. Nucleic Acids Res. 2015, 43, W39–W49. [Google Scholar] [CrossRef] [PubMed]
  44. Wang, J.; Chitsaz, F.; Derbyshire, M.K.; Gonzales, N.R.; Gwadz, M.; Lu, S.; Marchler, G.; Song, J.; Thanki, N.; Yamashita, R.; et al. The conserved domain database in 2023. Nucleic Acids Res. 2023, 51, D384–D388. [Google Scholar] [CrossRef]
  45. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  46. Hou, Q.; Yuan, L.; Jin, H.; Yan, H.; Li, F.; Wu, S. Identification and validation of reference genes for normalization of gene expression analysis using qRT-PCR in Megalurothrips usitatus (Thysanoptera: Thripidae). Front. Physiol. 2023, 14, 1161680. [Google Scholar] [CrossRef] [PubMed]
  47. Huang, W.K.; Kong, X.Y.; Ke, Y.C.; Wang, S.; Li, Q.J.; Fu, Q.W.; Wu, Q.X.; Liu, Y. Research progress on thrips Megalurothrips usitatus (Bagrall). China Veg. 2018, 21–27. [Google Scholar] [CrossRef]
  48. Zhang, X.; Purba, E.R.; Sun, J.; Zhang, Q.H.; Dong, S.L.; Zhang, Y.N.; He, P.; Mang, D.; Zhang, L. Functional differentiation of two general-odorant binding proteins in Hyphantria cunea (Drury) (Lepidoptera: Erebidae). Pest Manag. Sci. 2023, 79, 3312–3325. [Google Scholar] [CrossRef]
  49. Chen, X.F.; Xu, L.; Zhang, Y.X.; Wei, D.; Wang, J.J.; Jiang, H.B. Genome-wide identification and expression profiling of odorant-binding proteins in the oriental fruit fly, Bactrocera dorsalis. Comp. Biochem. Phys. D 2019, 31, 100605. [Google Scholar] [CrossRef] [PubMed]
  50. Gong, D.P.; Zhang, H.J.; Zhao, P.; Xia, Q.Y.; Xiang, Z.H. The Odorant binding protein gene family from the genome of silkworm, Bombyx mori. BMC Genom. 2009, 10, 332. [Google Scholar] [CrossRef] [PubMed]
  51. Dippel, S.; Oberhofer, G.; Kahnt, J.; Gerischer, L.; Opitz, L.; Schachtner, J.; Stanke, M.; Schütz, S.; Wimmer, E.A.; Angeli, S. Tissue-specific transcriptomics, chromosomal localization, and phylogeny of chemosensory and odorant binding proteins from the red flour beetle Tribolium castaneum reveal subgroup specificities for olfaction or more general functions. BMC Genom. 2014, 15, 1141. [Google Scholar] [CrossRef] [PubMed]
  52. Pelosi, P.; Iovinella, I.; Felicioli, A.; Dani, F.R. Soluble proteins of chemical communication: An overview across arthropods. Front. Physiol. 2014, 5, 320. [Google Scholar] [CrossRef] [PubMed]
  53. Liu, Y.; Luo, Y.; Du, L.; Ban, L. Antennal transcriptome analysis of olfactory genes and characterization of odorant binding proteins in Odontothrips loti (Thysanoptera: Thripidae). Int. J. Mol. Sci. 2023, 24, 5284. [Google Scholar] [CrossRef] [PubMed]
  54. Qiu, H.; Fu, B.; Tang, L.; Chen, J.; Liu, K. Occurrence regularity of thrips in cowpea and evaluation of insecticides. Chin. Agric. Sci. Bull. 2017, 33, 138–142. [Google Scholar]
  55. Huang, C.; Ou, X.; Wang, Y.; Zhou, Y.; Zhang, G.; Liu, W.; Wan, F.; Jiang, H.; Zhang, Y. Genome-wide identification, evolution, and female-biased expression analysis of odorant receptors in Tuta absoluta (Lepidoptera: Gelechiidae). Life 2024, 14, 872. [Google Scholar] [CrossRef] [PubMed]
  56. Zhang, S.; Li, M.; Xu, Y.; Zhao, Y.; Niu, Y.; Zong, S.; Tao, J. Genome-wide identification of the odorant receptor gene family and revealing key genes involved in sexual communication in Anoplophora glabripennis. Int. J. Mol. Sci. 2023, 24, 1625. [Google Scholar] [CrossRef] [PubMed]
  57. Zeng, Y.; Yang, Y.T.; Wu, Q.J.; Wang, S.L.; Xie, W.; Zhang, Y.J. Genome-wide analysis of odorant-binding proteins and chemosensory proteins in the sweet potato whitefly, Bemisia tabaci. Insect Sci. 2018, 26, 620–634. [Google Scholar] [CrossRef] [PubMed]
  58. Li, J.B.; Yin, M.Z.; Yao, W.C.; Ma, S.; Dewer, Y.; Liu, X.Z.; Wang, Y.Y.; Wang, C.W.; Li, B.P.; Zhu, X.Y. Genome-wide analysis of odorant-binding proteins and chemosensory proteins in the bean bug Riptortus pedestris. Front. Physiol. 2022, 13, 949607. [Google Scholar] [CrossRef] [PubMed]
  59. Pracana, R.; Levantis, I.; Martínez-Ruiz, C.; Stolle, E.; Priyam, A.; Wurm, Y. Fire ant social chromosomes: Differences in number, sequence and expression of odorant binding proteins. Evol. Lett. 2017, 1, 199–210. [Google Scholar] [CrossRef] [PubMed]
  60. He, H.; Crabbe, M.J.C.; Ren, Z. Genome-wide identification and characterization of the chemosensory relative protein genes in Rhus gall aphid Schlechtendalia chinensis. BMC Genom. 2023, 24, 222. [Google Scholar] [CrossRef]
  61. Frei, A.; Gu, H.; Bueno, J.M.; Cardona, C.; Dorn, S. Antixenosis and antibiosis of common beans to Thrips palmi Karny (Thysanoptera: Thripidae). J. Econ. Entomol. 2003, 96, 1577–1584. [Google Scholar] [CrossRef]
  62. Wang, Z.; Yang, F.; Sun, A.; Song, J.; Shan, S.; Zhang, Y.; Wang, S. Expressional and functional comparisons of five clustered odorant binding proteins in the brown marmorated stink bug Halyomorpha halys. Int. J. Biol. Macromol. 2022, 206, 759–767. [Google Scholar] [CrossRef]
  63. Liu, P.; Qin, Z.; Feng, M.; Zhang, L.; Huang, X.; Shi, W. The male-produced aggregation pheromone of the bean flower thrips Megalurothrips usitatus in China: Identification and attraction of conspecifics in the laboratory and field. Pest Manag. Sci. 2020, 76, 2986–2993. [Google Scholar] [CrossRef] [PubMed]
  64. Xiu, C.; Pan, H.; Zhang, F.; Luo, Z.; Bian, L.; Li, Z.; Fu, N.; Zhou, L.; Magsi, F.H.; Cai, X.; et al. Identification of aggregation pheromones released by the stick tea thrips (Dendrothrips minowai) larvae and their application for controlling thrips in tea plantations. Pest Manag. Sci. 2024, 80, 2528–2538. [Google Scholar] [CrossRef] [PubMed]
  65. Rong, H.; He, X.; Liu, Y.; Liu, M.; Liu, X.; Lu, M. Odorant binding protein 18 increases the pathogen resistance of the imported willow leaf beetle, Plagiodera versicolora. Front. Cell. Infect. Mi. 2024, 14, 1360680. [Google Scholar] [CrossRef] [PubMed]
  66. Chen, Y.W.; Yang, H.H.; Gu, N.; Li, J.Q.; Zhu, X.Y.; Zhang, Y.N. Identification of attractants for adult Spodoptera litura based on the interaction between odorant-binding protein 34 and host volatiles. Pestic. Biochem. Physiol. 2024, 203, 106005. [Google Scholar] [CrossRef] [PubMed]
  67. Zhong, Y.; Tang, R.; Lin, L.; Zhao, W.; Wei, S.; Zhang, F.; Uddin, M.K.; Xie, M.; Chen, H. RpedOBP1 plays key roles in aggregation pheromones reception of the Riptortus pedestris. Pestic. Biochem. Physiol. 2024, 204, 106073. [Google Scholar] [CrossRef] [PubMed]
  68. Yuan, T.; Mang, D.; Purba, E.R.; Ye, J.; Qian, J.; Rao, F.; Wang, H.; Wu, Z.; Zhang, W.; Zheng, Y.; et al. Identification and functional analysis of odorant binding proteins in Apriona germari (Hope). J. Agric. Food Chem. 2024, 72, 17248–17259. [Google Scholar] [CrossRef] [PubMed]
  69. Wang, W.W.; Han, K.R.; Jing, X.F.; Liu, T.X.; Zhang, S.Z. Odorant-binding protein CrufOBP1 in Cotesia ruficrus females plays a pivotal role in the detection of Spodoptera frugiperda larvae. Int. J. Biol. Macromol. 2024, 274, 133491. [Google Scholar] [CrossRef] [PubMed]
  70. Li, Y.; Song, W.; Wang, S.; Miao, W.; Liu, Z.; Wu, F.; Wang, J.; Sheng, S. Binding characteristics and structural dynamics of two general odorant-binding proteins with plant volatiles in the olfactory recognition of Glyphodes pyloalis. Insect Biochem. Mol. Biol. 2024, 173, 104177. [Google Scholar] [CrossRef]
Insects 16 00212 g001
Figure 1. Amino acid sequence alignment of OBPs without signal peptide in M. usitatus. (A) Alignment of Classic OBPs in M. usitatus. (B) Alignment of Minus-C OBPs in M. usitatus. The conservative cysteine residues (C1–C6) are indicated.
Figure 1. Amino acid sequence alignment of OBPs without signal peptide in M. usitatus. (A) Alignment of Classic OBPs in M. usitatus. (B) Alignment of Minus-C OBPs in M. usitatus. The conservative cysteine residues (C1–C6) are indicated.
Insects 16 00212 g001
Insects 16 00212 g002
Figure 2. Chromosome localization of the OBP genes in the M. usitatus genome.
Figure 2. Chromosome localization of the OBP genes in the M. usitatus genome.
Insects 16 00212 g002
Insects 16 00212 g003
Figure 3. Phylogenetic relationships, conservative motifs, domains, and gene structure analysis of OBPs in M. usitatus. Red, subgroup 1; yellow, subgroup 2; and blue, subgroup 3.
Figure 3. Phylogenetic relationships, conservative motifs, domains, and gene structure analysis of OBPs in M. usitatus. Red, subgroup 1; yellow, subgroup 2; and blue, subgroup 3.
Insects 16 00212 g003
Insects 16 00212 g004
Figure 4. Maximum likelihood tree of OBPs from M. usitatus and other ten species from seven insect orders. Musi: Megalurothrips usitatus (Thysanoptera); Olot: Odontothrips loti (Thysanoptera); Tpal: Thrips palmi (Thysanoptera); Focc: Frankliniella occidentalis (Thysanoptera); Fint: Frankliniella intonsa (Thysanoptera); Lmig: Locusta migratoria (Orthoptera); Apis: Acyrthosiphon pisum (Hemiptera); Dmel: Drosophila melanogaster (Diptera); Tcas: Tribolium castaneum (Coleoptera); Amel: Apis mellifera (Hymenoptera); Sexi: Spodoptera exigua (Lepidoptera). Bootstrap values (%) based on 1000 replicated are indicated.
Figure 4. Maximum likelihood tree of OBPs from M. usitatus and other ten species from seven insect orders. Musi: Megalurothrips usitatus (Thysanoptera); Olot: Odontothrips loti (Thysanoptera); Tpal: Thrips palmi (Thysanoptera); Focc: Frankliniella occidentalis (Thysanoptera); Fint: Frankliniella intonsa (Thysanoptera); Lmig: Locusta migratoria (Orthoptera); Apis: Acyrthosiphon pisum (Hemiptera); Dmel: Drosophila melanogaster (Diptera); Tcas: Tribolium castaneum (Coleoptera); Amel: Apis mellifera (Hymenoptera); Sexi: Spodoptera exigua (Lepidoptera). Bootstrap values (%) based on 1000 replicated are indicated.
Insects 16 00212 g004
Insects 16 00212 g005
Figure 5. Expression profile of OBP genes in different developmental stages of M. usitatus by RT-qPCR. The first instar nymphs (N1) are taken as the normalized sample. Different lowercase letters indicate significant differences (p < 0.05) by using a one-way analysis of variance followed by Tukey’s honestly significant difference test. Standard errors are indicated by error bars. N1: first instar nymphs; N2: second instar nymphs; P1: prepupae; P2: pseudo-pupae; F: female adults; M: male adults.
Figure 5. Expression profile of OBP genes in different developmental stages of M. usitatus by RT-qPCR. The first instar nymphs (N1) are taken as the normalized sample. Different lowercase letters indicate significant differences (p < 0.05) by using a one-way analysis of variance followed by Tukey’s honestly significant difference test. Standard errors are indicated by error bars. N1: first instar nymphs; N2: second instar nymphs; P1: prepupae; P2: pseudo-pupae; F: female adults; M: male adults.
Insects 16 00212 g005
Insects 16 00212 g006
Figure 6. Expression profile of OBP genes in different tissues of M. usitatus by RT-qPCR. The female adults without antennae are taken as the normalized sample. Asterisks indicate significant differences in different tissues and sexes by using Student’s t-test (* p < 0.05; ** p < 0.01; *** p < 0.001; ns, not significant). Standard errors are indicated by error bars. A−: adults without antennae; A+: adults with antennae.
Figure 6. Expression profile of OBP genes in different tissues of M. usitatus by RT-qPCR. The female adults without antennae are taken as the normalized sample. Asterisks indicate significant differences in different tissues and sexes by using Student’s t-test (* p < 0.05; ** p < 0.01; *** p < 0.001; ns, not significant). Standard errors are indicated by error bars. A−: adults without antennae; A+: adults with antennae.
Insects 16 00212 g006
Table 1. Primer information used for RT-qPCR.
Table 1. Primer information used for RT-qPCR.
Primer NamePrimer Sequence (5′-3′)Length (bp)
qMusiOBP1F: AAAAGCCCAAGATGCAGGTG162
R: TGCACTTTTCAATCCCAGCC
qMusiOBP2F: GCAAGGAGATGATGAAGGAC182
R: CTTGTACTCCTCGGACCAG
qMusiOBP3F: AGAACAATAAAGTGGACGCC160
R: TTTACGCAGCGAATGAAGTT
qMusiOBP4F: CGAGCTGACCCACATCAA155
R: TCAACTTGTCCTCTGGCG
qMusiOBP5F: GAGCTCACAGAGGACCAGAA153
R: CTGGTACACGCACTTCATGT
qMusiOBP6F: ACGATCCCATGATGAAGGCA160
R: AATCAGCAGCTATGTCCGGT
qMusiOBP7F: AGGCGAGGGAAATCAAGAGG174
R: TCGACCCTTCCTTGGAAAACT
qMusiOBP8F: TAAAGAAGCACGCGATGGAG158
R: CTCGTCCAGCACTTTGAAGG
qMusiOBP9F: CGACGATGTGTGCGAGAAAT188
R: ATGACCTTGCATGCCATTGG
qMusiOBP10F: AAGAACATGCTGGCCTGT211
R: ACATGTTCTTGGCCCGTT
qMusiOBP11F: CACCACCTCCAAAACCAGC160
R: CCATCTTCGGACAACATGCC
qMusiOBP12F: GCAACTTCAAGTGCATCATG100
R: GCGTGCATTTTCTCAGGT
qMusiOBP13F: CCGACAATTTGGAGGCCTAC153
R: ACTTTGTGGCAATGTCTCGC
qMusiOBP14F: TGCAAATGGATATGGACGCC162
R: CGAGTAGTAGGTGACCGTCC
qMusiACTF: ACGACGTACAACTCCATCAT125
R: GTAATCTCCTTCTGCATCCTGT
qMusiRPLF: ACATCGAGCTGGGTACTG122
R: CACCACCATTTACTGAGCAT
F: forward primer; R: reverse primer.
Table 2. Summary of odorant-binding proteins (OBPs) sequences identified in the genome of M. usitatus.
Table 2. Summary of odorant-binding proteins (OBPs) sequences identified in the genome of M. usitatus.
Gene NameGene IDORF (aa)Complete ORFSignal PeptideHomology Search with Known Proteins
SpeciesAcc. NumberE-ValueIdentityCoverage
MusiOBP1ONE63_000073142Yes1–20Nezara viridulaQCZ25102.10.0148.98%34%
MusiOBP2ONE63_005245126YesNoFrankliniella intonsaWBW64304.15 × 10−75 88.71%98%
MusiOBP3ONE63_006116106YesNoOdontothrips lotiWBU77197.16 × 10−43 87.65%76%
MusiOBP4ONE63_006437138Yes1–20Frankliniella fuscaKAK3931445.15 × 10−32 50.00%92%
MusiOBP5ONE63_006734147Yes1–19Odontothrips lotiWBU77195.11 × 10−7788.64%89%
MusiOBP6ONE63_006862155Yes1–20Macrosteles quadrilineatusXP_054263813.10.2225.64%71%
MusiOBP7ONE63_006863143Yes1–17Frankliniella occidentalisXP_026276672.15 × 10−7479.56%95%
MusiOBP8ONE63_006864144Yes1–19Odontothrips lotiWBU77200.11 × 10−5480.33%84%
MusiOBP9ONE63_006989211Yes1–29Frankliniella fuscaKAK3918161.12 × 10−9067.51%91%
MusiOBP10ONE63_007105157Yes1–17Zophobas morioXP_063907370.10.8629.00%63%
MusiOBP11ONE63_008094136Yes1-22Frankliniella fuscaKAK3914559.16 × 10−3948.12%97%
MusiOBP12ONE63_009400103YesNoFrankliniella fuscaKAK3914559.15 × 10−3366.27%80%
MusiOBP13ONE63_001264147Yes1–22Thrips palmiXP_034232292.11 × 10−3150.85%78%
MusiOBP14ONE63_002028136Yes1–18Odontothrips lotiWBU77199.12 × 10−8186.03%100%
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xia, G.; Yang, L.; Li, B.; Wang, Q.; Huang, L.; Tian, X.; Zhang, G. Genome-Wide Identification and Expression Profiling of Odorant-Binding Protein Genes in the Bean Flower Thrips Megalurothrips usitatus (Bagnall) (Thysanoptera: Thripidae). Insects 2025, 16, 212. https://doi.org/10.3390/insects16020212

AMA Style

Xia G, Yang L, Li B, Wang Q, Huang L, Tian X, Zhang G. Genome-Wide Identification and Expression Profiling of Odorant-Binding Protein Genes in the Bean Flower Thrips Megalurothrips usitatus (Bagnall) (Thysanoptera: Thripidae). Insects. 2025; 16(2):212. https://doi.org/10.3390/insects16020212

Chicago/Turabian Style

Xia, Gen, Lang Yang, Boliao Li, Qinli Wang, Lifei Huang, Xiaoli Tian, and Guohui Zhang. 2025. "Genome-Wide Identification and Expression Profiling of Odorant-Binding Protein Genes in the Bean Flower Thrips Megalurothrips usitatus (Bagnall) (Thysanoptera: Thripidae)" Insects 16, no. 2: 212. https://doi.org/10.3390/insects16020212

APA Style

Xia, G., Yang, L., Li, B., Wang, Q., Huang, L., Tian, X., & Zhang, G. (2025). Genome-Wide Identification and Expression Profiling of Odorant-Binding Protein Genes in the Bean Flower Thrips Megalurothrips usitatus (Bagnall) (Thysanoptera: Thripidae). Insects, 16(2), 212. https://doi.org/10.3390/insects16020212

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop