Survey and Molecular Diagnostics of Target Site Mutations Conferring Resistance to Insecticides in Populations of Aphis spiraecola from Greece
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Aphid Material
2.2. Genomic Extraction, PCR Amplification of Gene Targets and DNA Barcoding
2.3. Development of RFLP Diagnostics for the Detection of Susceptible A. spiraecola Alleles in Resistance Gene Targets
2.4. Statistical Analysis
3. Results and Discussion
3.1. New Molecular Diagnostics for Target Site Resistance Mechanisms
3.2. Frequency of Insecticide Resistance Mutations
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Blackman, R.L.; Eastop, V.F. Taxonomic Issues. In Aphids as Crop Pests; Van Emden, H.F., Harrington, R., Eds.; CAB International: Wallingford, UK, 2017; pp. 1–36. [Google Scholar]
- Kalaitzaki, A.; Awad, S.; Malandraki, E.; Papapetrou, P.; Livieratos, I.; Margaritopoulos, J. Aphid Species Composition in Populations from Citrus Orchards in a Region of the Island of Crete. Bull. Insectol. 2019, 72, 143–149. [Google Scholar]
- Elhaddad, A.; ElAmrani, A.; Fereres, A.; Moreno, A. Spatial and Temporal Spread of Citrus Tristeza Virus and Its Aphid Vectors in the North Western Area of Morocco. Insect Sci. 2016, 23, 903–912. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Foster, S.P.; Devine, G.; Devonshire, A.L. Insecticide Resistance. In Aphids as Crop Pests; Van Emden, H.F., Harrington, R., Eds.; CAB International: Wallingford, UK, 2017; pp. 426–446. [Google Scholar]
- Sparks, T.C.; Nauen, R. IRAC: Mode of Action Classification and Insecticide Resistance Management. Pestic. Biochem. Physiol. 2015, 121, 122–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bass, C.; Nauen, R. The Molecular Mechanisms of Insecticide Resistance in Aphid Crop Pests. Insect Biochem. Mol. Biol. 2023, 156, 103937. [Google Scholar] [CrossRef] [Scilit]
- Troczka, B.J.; Singh, K.S.; Zimmer, C.T.; Vontas, J.; Nauen, R.; Hayward, A.; Bass, C. Molecular Innovations Underlying Resistance to Nicotine and Neonicotinoids in the Aphid Myzus persicae. Pest Manag. Sci. 2021, 77, 5311–5320. [Google Scholar] [CrossRef] [Scilit]
- Cominelli, F.; Chiesa, O.; Panini, M.; Massimino Cocuzza, G.E.; Mazzoni, E. Survey of Target Site Mutations Linked with Insecticide Resistance in Italian Populations of Aphis gossypii. Pest Manag. Sci. 2024, 80, 4361–4370. [Google Scholar] [CrossRef] [Scilit]
- Nabeshima, T.; Kozaki, T.; Tomita, T.; Kono, Y. An Amino Acid Substitution on the Second Acetylcholinesterase in the Pirimicarb-Resistant Strains of the Peach Potato Aphid, Myzus Persicae. Biochem. Biophys. Res. Commun. 2003, 307, 15–22. [Google Scholar] [CrossRef] [Scilit]
- Andrews, M.C.; Callaghan, A.; Field, L.M.; Williamson, M.S.; Moores, G.D. Identification of Mutations Conferring Insecticide-Insensitive AChE in the Cotton-Melon Aphid, Aphis gossypii Glover. Insect Mol. Biol. 2004, 13, 555–561. [Google Scholar] [CrossRef] [Scilit]
- Toda, S.; Komazaki, S.; Tomita, T.; Kono, Y. Two Amino Acid Substitutions in Acetylcholinesterase Associated with Pirimicarb and Organophosphorous Insecticide Resistance in the Cotton Aphid, Aphis gossypii Glover (Homoptera: Aphididae). Insect Mol. Biol. 2004, 13, 549–553. [Google Scholar] [CrossRef] [Scilit]
- Eleftherianos, I.; Foster, S.P.; Williamson, M.S.; Denholm, I. Characterization of the M918T Sodium Channel Gene Mutation Associated with Strong Resistance to Pyrethroid Insecticides in the Peach-Potato Aphid, Myzus persicae (Sulzer). Bull. Entomol. Res. 2008, 98, 183–191. [Google Scholar] [CrossRef] [Scilit]
- Fontaine, S.; Caddoux, L.; Brazier, C.; Bertho, C.; Bertolla, P.; Micoud, A.; Roy, L. Uncommon Associations in Target Resistance among French Populations of Myzus persicae from Oilseed Rape Crops. Pest Manag. Sci. 2011, 67, 881–885. [Google Scholar] [CrossRef] [Scilit]
- Panini, M.; Dradi, D.; Marani, G.; Butturini, A.; Mazzoni, E. Detecting the Presence of Target-Site Resistance to Neonicotinoids and Pyrethroids in Italian Populations of Myzus persicae. Pest Manag. Sci. 2014, 70, 931–938. [Google Scholar] [CrossRef] [Scilit]
- Munkhbayar, O.; Liu, N.; Li, M.; Qiu, X. First Report of Voltage-Gated Sodium Channel M918V and Molecular Diagnostics of Nicotinic Acetylcholine Receptor R81T in the Cotton Aphid. J. Appl. Entomol. 2021, 145, 261–269. [Google Scholar] [CrossRef] [Scilit]
- Umina, P.A.; Bass, C.; van Rooyen, A.; Chirgwin, E.; Arthur, A.L.; Pym, A.; Mackisack, J.; Mathews, A.; Kirkland, L. Spirotetramat Resistance in Myzus persicae (Sulzer) (Hemiptera: Aphididae) and Its Association with the Presence of the A2666V Mutation. Pest Manag. Sci. 2022, 78, 4822–4831. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- George, A.; Rao, C.N.; Rahangadale, S. Current Status of Insecticide Resistance in Aphis gossypii and Aphis spiraecola (Hemiptera: Aphididae) under Central Indian Conditions in Citrus. Cogent Biol. 2019, 5, 1660494. [Google Scholar] [CrossRef] [Scilit]
- Smirle, M.J.; Zurowski, C.L.; Lowery, D.T.; Foottit, R.G. Relationship of Insecticide Tolerance to Esterase Enzyme Activity in Aphis pomi and Aphis spiraecola (Hemiptera: Aphididae). J. Econ. Entomol. 2010, 103, 374–378. [Google Scholar] [CrossRef] [Scilit]
- Powell, C.A.; Burton, M.S.; Pelosi, R.R.; Rundell, P.A.; Ritenour, M.A.; Bullock, R.C. Six-Year Evaluation of Brown Citrus and Spirea Aphid Populations in a Citrus Grove and the Effects of Insecticides on These Populations. HortScience 2006, 41, 688–690. [Google Scholar] [CrossRef] [Scilit]
- Tang, H.; Zhou, Y.; Zuo, J.; Wang, Y.; Piñero, J.C.; Peng, X.; Chen, M. Voltage-Gated Sodium Channel Gene Mutation and P450 Gene Expression Are Associated with the Resistance of Aphis spiraecola Patch (Hemiptera: Aphididae) to Lambda-Cyhalothrin. Bull. Entomol. Res. 2024, 114, 49–56. [Google Scholar] [CrossRef]
- Wang, K.; You, Y.; Liu, Y.; Xian, W.; Song, Y.; Ge, Y.; Lu, X.; Ma, Z. Widespread Resistance of the Apple Aphid Aphis spiraecola to Pyrethroids in China. Pestic. Biochem. Physiol. 2025, 208, 106289. [Google Scholar] [CrossRef] [Scilit]
- Tang, H.; Wu, K.; Peng, X.; Chen, M. Insecticide Resistance Monitoring of Aphis spiraecola (Hemiptera: Aphididae) to Neonicotinoids and Abamectin in a Major Apple-Growing Region. J. Econ. Entomol. 2025, 118, 2112–2122. [Google Scholar] [CrossRef] [Scilit]
- Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Rousset, F. Genepop’007: A Complete Re-Implementation of the Genepop Software for Windows and Linux. Mol. Ecol. Resour. 2008, 8, 103–106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Voudouris, C.C.; Kati, A.N.; Sadikoglou, E.; Williamson, M.; Skouras, P.J.; Dimotsiou, O.; Georgiou, S.; Fenton, B.; Skavdis, G.; Margaritopoulos, J.T. Insecticide Resistance Status of Myzus persicae in Greece: Long-Term Surveys and New Diagnostics for Resistance Mechanisms. Pest Manag. Sci. 2016, 72, 671–683. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mavridis, K.; Papapostolou, K.M.; Riga, M.; Ilias, A.; Michaelidou, K.; Bass, C.; Van Leeuwen, T.; Tsagkarakou, A.; Vontas, J. Multiple TaqMan qPCR and Droplet Digital PCR (ddPCR) Diagnostics for Pesticide Resistance Monitoring and Management, in the Major Agricultural Pest Tetranychus urticae. Pest Manag. Sci. 2022, 78, 263–273. [Google Scholar] [CrossRef] [Scilit]
- Van Leeuwen, T.; Dermauw, W.; Mavridis, K.; Vontas, J. Significance and Interpretation of Molecular Diagnostics for Insecticide Resistance Management of Agricultural Pests. Curr. Opin. Insect Sci. 2020, 39, 69–76. [Google Scholar] [CrossRef] [Scilit]
- Foster, S.P.; Denholm, I.; Devonshire, A.L. The Ups and Downs of Insecticide Resistance in Peach-Potato Aphids (Myzus Persicae) in the UK. Crop Prot. 2000, 19, 873–879. [Google Scholar] [CrossRef] [Scilit]
- Bass, C.; Puinean, A.M.; Zimmer, C.T.; Denholm, I.; Field, L.M.; Foster, S.P.; Gutbrod, O.; Nauen, R.; Slater, R.; Williamson, M.S. The Evolution of Insecticide Resistance in the Peach Potato Aphid, Myzus Persicae. Insect Biochem. Mol. Biol. 2014, 51, 41–51. [Google Scholar] [CrossRef] [Scilit]
- Voudouris, C.C.; Williamson, M.S.; Skouras, P.J.; Kati, A.N.; Sahinoglou, A.J.; Margaritopoulos, J.T. Evolution of Imidacloprid Resistance in Myzus persicae in Greece and Susceptibility Data for Spirotetramat. Pest Manag. Sci. 2017, 73, 1804–1812. [Google Scholar] [CrossRef] [Scilit]
- Foster, S.P.; Paul, V.L.; Slater, R.; Warren, A.; Denholm, I.; Field, L.M.; Williamson, M.S. A Mutation (L1014F) in the Voltage-Gated Sodium Channel of the Grain Aphid, Sitobion avenae, Is Associated with Resistance to Pyrethroid Insecticides. Pest Manag. Sci. 2014, 70, 1249–1253. [Google Scholar] [CrossRef] [Scilit]
- Margaritopoulos, J.T.; Kasprowicz, L.; Malloch, G.L.; Fenton, B. Tracking the Global Dispersal of a Cosmopolitan Insect Pest, the Peach Potato Aphid. BMC Ecol. 2009, 9, 13. [Google Scholar] [CrossRef] [Scilit]
- Fenton, B.; Margaritopoulos, J.T.; Malloch, G.L.; Foster, S.P. Micro-Evolutionary Change in Relation to Insecticide Resistance in the Peach–Potato Aphid, Myzus Persicae. Ecol. Entomol. 2010, 35, 131–146. [Google Scholar] [CrossRef] [Scilit]
- Kati, A.N.; Mandrioli, M.; Skouras, P.J.; Malloch, G.L.; Voudouris, C.C.; Venturelli, M.; Manicardi, G.C.; Tsitsipis, J.A.; Fenton, B.; Margaritopoulos, J.T. Recent Changes in the Distribution of Carboxylesterase Genes and Associated Chromosomal Rearrangements in Greek Populations of the Tobacco Aphid Myzus persicae nicotianae. Biol. J. Linn. Soc. 2014, 113, 455–470. [Google Scholar] [CrossRef] [Scilit]
- Foster, S.P.; Denholm, I.; Devonshire, A.L. Field-Simulator Studies of Insecticide Resistance to Dimethylcarbamates and Pyrethroids Conferred by Metabolic- and Target Site-Based Mechanisms in Peach-Potato Aphids, Myzus persicae (Hemiptera: Aphididae). Pest Manag. Sci. 2002, 58, 811–816. [Google Scholar] [CrossRef] [Scilit]
- Tieu, S.; Chen, Y.; Woolley, L.K.; Collins, D.; Barchia, I.; Lo, N.; Herron, G.A. A Significant Fitness Cost Associated with ACE1 Target Site Pirimicarb Resistance in a Field Isolate of Aphis Gossypii Glover from Australian Cotton. J. Pest Sci. 2017, 90, 773–779. [Google Scholar] [CrossRef] [Scilit]
- Zhu, K.Y.; Lee, S.H.; Clark, J.M. A Point Mutation of Acetylcholinesterase Associated with Azinphosmethyl Resistance and Reduced Fitness in Colorado Potato Beetle. Pestic. Biochem. Physiol. 1996, 55, 100–108. [Google Scholar] [CrossRef] [Scilit]
- Blackman, R.L.; Eastop, V.F. Aphids: On the World’s Herbaceous Plants and Shrubs; John Wiley & Sons, Ltd.: Chichester, UK, 2006. [Google Scholar]
- Blackman & Eastop’s Aphids on the World’s Plants. Available online: https://aphidsonworldsplants.info/ (accessed on 1 September 2025).


| Host-Plant | Region | Total | ||
|---|---|---|---|---|
| Crete | Argolida | Messenia | ||
| Citrus japonica | 1 | 1 | ||
| Citrus limon | 18 | 2 | 20 | |
| Citrus reticulata | 6 | 7 | 4 | 17 |
| Citrus sinensis | 29 | 2 | 3 | 34 |
| Total | 54 | 11 | 7 | 72 |
| Primer Name | Gene | Sequence (5′–3′) | Amplified Product (bp) | Resistance Mutation | Annealing T (°C) |
|---|---|---|---|---|---|
| Ag_AChE2_F1 | AChE2 | TATAAACGTAGTAGTGCCAAGG | 897 | A302S, S431F | 54 |
| Ag_AChE2_R1 | CCGACCATTTTGTCCAAAGC | ||||
| Ag_nAChR_β1_F1 | nAChR_β1 | TGCATACGTGGTACGTACATAA | 508 | R81T | 52 |
| Ag_nAChR_β1_R1 | TGAACGGTTTGCAGTCAAGC | ||||
| Ag_vgsc_F1 | VGSC | CTGCGGGTTACCAAGGACTCTC | 627 | M918L/T/I, L1014F | 55 |
| Ag_vgsc_R1 | ATCCACCTCGCCGTTTGCAT | ||||
| Mp_Ag_ACC_F1 | ACCase | AATTTGGTGCATACATTGTTGA | 150 | A2226V | 52 |
| Mp_Ag_ACC_R1 | CTGGATCTGCATACATCTCAATA | ||||
| Mp_Ag_ACC_diaR | GTCTTGGATTAATAGTAGTAgCTACA | 126 | |||
| LCO_1490 | COI | GGTCAACAAATCATAAAGATATTGG | 672 | DNA barcoding | 52 |
| HCO_2198 | TAAACTTCAGGGTGACCAAAAAATCA |
| Genotypes | Region | Total | |||
|---|---|---|---|---|---|
| Argolida | Chania | Heraklion | Messinia | ||
| RR | 0.0 | 4.8 | 0.0 | 0.0 | 2.8 |
| RS | 9.1 | 81.0 | 66.7 | 100 | 69.4 |
| SS | 90.9 | 14.3 | 33.3 | 0.0 | 27.8 |
| fR | 4.5 | 45.2 | 33.3 | 50.0 | 37.5 |
| N | 11 | 42 | 12 | 7 | 72 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ilias, A.; Skouras, P.J.; Kalaitzaki, A.; Roditakis, E.; Tsirikos, E.; Tsagkarakou, A.; Vontas, J.; Margaritopoulos, J.T. Survey and Molecular Diagnostics of Target Site Mutations Conferring Resistance to Insecticides in Populations of Aphis spiraecola from Greece. Insects 2025, 16, 1199. https://doi.org/10.3390/insects16121199
Ilias A, Skouras PJ, Kalaitzaki A, Roditakis E, Tsirikos E, Tsagkarakou A, Vontas J, Margaritopoulos JT. Survey and Molecular Diagnostics of Target Site Mutations Conferring Resistance to Insecticides in Populations of Aphis spiraecola from Greece. Insects. 2025; 16(12):1199. https://doi.org/10.3390/insects16121199
Chicago/Turabian StyleIlias, Aris, Panagiotis J. Skouras, Argyro Kalaitzaki, Emmanouil Roditakis, Evangelos Tsirikos, Anastasia Tsagkarakou, John Vontas, and John T. Margaritopoulos. 2025. "Survey and Molecular Diagnostics of Target Site Mutations Conferring Resistance to Insecticides in Populations of Aphis spiraecola from Greece" Insects 16, no. 12: 1199. https://doi.org/10.3390/insects16121199
APA StyleIlias, A., Skouras, P. J., Kalaitzaki, A., Roditakis, E., Tsirikos, E., Tsagkarakou, A., Vontas, J., & Margaritopoulos, J. T. (2025). Survey and Molecular Diagnostics of Target Site Mutations Conferring Resistance to Insecticides in Populations of Aphis spiraecola from Greece. Insects, 16(12), 1199. https://doi.org/10.3390/insects16121199

