New Record of Encarsia protransvena and Confirmed Occurrence of Encarsia hispida (Hymenoptera: Aphelinidae) as Parasitoids of Singhiella simplex (Hemiptera: Aleyrodidae) in Italy
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Hosts and Parasitoids Collection
2.2. Morphological Identification
2.3. Molecular Identification
3. Results
3.1. Morphological Identification
| E. protransvena (Figure 6, Figure 7 and Figure 8) |
--Antennal formula 1.1.4.2 | 2 |
| |
E. hispida (Figure 9) | |
--Body yellow with brown areas on mesosoma and metasoma; forewing slightly infuscate below marginal vein; mid tarsi 5-segmented, tarsal formula 5-5-5 | |
E. singhiellae |
3.2. Molecular Analysis
4. Discussion
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Legaspi, J.C.; Mannion, C.; Amalin, D.; Legaspi, B.C., Jr. Biology, ecology and control of the Ficus whitefly, Singhiella simplex (Hemiptera: Aleyrodidae). Potential Invasive Pests Agric. Crop. 2013, 3, 363. [Google Scholar]
- EPPO Global Database. Available online: https://gd.eppo.int/taxon/SINLSI/categorization (accessed on 21 September 2024).
- EPPO—European and Mediterranean Plant Protection Organization. Mini Data Sheet on Singhiella simplex (Hemiptera: Aleyrodidae) Ficus Whitefly. 2018. Available online: https://gd.eppo.int/taxon/SINLSI/documents (accessed on 22 October 2022).
- EPPO. First Report of Singhiella simplex in Cyprus: Addition to the EPPO Alert List. EPPO Reporting Service 11. 2014. Available online: https://gd.eppo.int/reporting/article-3306 (accessed on 21 September 2024).
- Ko, C.C.; Shih, Y.T.; Schmidt, S.; Polaszek, A. A new species of Encarsia (Hymenoptera, Aphelinidae) developing on ficus whitefly Singhiella simplex (Hemiptera, Aleyrodidae) in China and Taiwan. J. Hymenopt. Res. 2015, 46, 85–90. [Google Scholar]
- Ahmed, M.Z.; McKenzie, C.L.; Revynthi, A.M.; Evans, G.A.; Mottern, J.L.; Mannion, C.M.; Osborne, L.S. Pest status, suvey of natural enemies, and a management plan for the whitefly Singhiella simplex (Hemiptera: Aleyrodidae) in the United States. J. Integr. Pest Manag. 2022, 13, 1–14. [Google Scholar] [CrossRef]
- Yükselbaba, U.; Topakcı, N.; Göçmen, H. A new record of Turkey Aleyrodidae fauna, ficus whitefly Singhiella simplex (Singh) (Hemiptera: Aleyrodidae). Phytoparasitica 2017, 45, 715–717. [Google Scholar] [CrossRef]
- Germain, J.F.; Lemmet, S.; Balmès, V.; Streito, J.C. Incursion d’un nouvel aleurode nuisible aux ficus en France. Phytoma 2017, 705, 9–11. [Google Scholar]
- Dader Alonso, B.; Viñuela Sandoval, E.; Medina Vélez, M.P.; Budia Marigil, M.F.; Adán del Río, A.; del Estal Padillo, P. Presencia en España de la mosca blanca del Ficus spp., Singhiella simplex (Singh, 1931) (Hemiptera: Aleyrodidae). Libro de Resúmenes XI Congreso de la Sociedad Española de Entomología Aplicada (Madrid, 2019-11-04/08), p. 108. Available online: https://www.upm.es/observatorio/vi/index.jsp?pageac=actividad.jsp&id_actividad=324992 (accessed on 21 September 2024).
- Šimala, M.; Pintar, M.; Masten Milek, T. Interception of Ficus whitefly [Singhiella simplex (Singh, 1931)] in Croatia. Glas. Biljn. Zaštite 2020, 20, 540–547. [Google Scholar]
- Malumphy, C.; Guillem, R. Seven species of whitefly new for Gibraltar, including fig whitefly Singhiella simplex (Singh) (Hemiptera: Aleyrodidae). Entomol.’s Mon. Mag. 2021, 157, 168–172. [Google Scholar] [CrossRef]
- Kamel, M.K.B.H.; Zouari, S.; Adouani, R.; Ben Cheik, Z. Nouveau signalement de Singhiella simplex (Singh, 1931) (Aleyrodidae) sur Ficus en Tunisie. EPPO Bull. 2022, 52, 460462. [Google Scholar]
- Laarif, A.; Bouslama, T. The Ficus Whitefly Singhiella simplex (Singh, 1931) (Hemiptera: Aleyrodidae): A new exotic whitefly found on urban Ficus species in Tunisia. Orient. Insects 2022, 56, 584–592. [Google Scholar] [CrossRef]
- Longo, S.; Rapisarda, C.; Siscaro, G. La mosca bianca dei Ficus, Singhiella simplex, nuovamente alla ribalta. Georgofili. Info. 2019. Available online: https://www.georgofili.info/contenuti/la-moscabianca-dei-ficus-singhiella-simplex-nuovamente-alla-ribalta/13601 (accessed on 5 December 2024).
- Laudani, F.; Giunti, G.; Zimbalatti, G.; Campolo, O.; Palmeri, V. Singhiella simplex (Singh) (Hemiptera: Aleyrodidae), a new aleyrodid species for Italy causing damage on Ficus. EPPO Bull. 2020, 50, 268–270. [Google Scholar] [CrossRef]
- Fois, F.; Lallai, A.; Foddi, F.; Nannini, M. Prima segnalazione per la Sardegna di Singhiella simplex (Singh, 1931) (Hemiptera: Aleyrodidae) reperita su Ficus benjamina L. e Ficus microcarpa L.f. (Moraceae) [First report of Singhiella simplex (Singh, 1931) (Hemiptera: Aleyrodidae) from Sardinia, on Ficus benjamina L. and Ficus microcarpa L.f. (Moraceae)]. Mediterr. Online/Nat. 2020, 35, 35–39. (In Italian) [Google Scholar]
- Zugno, M.; Tapparo, A.; Colombini, M.; Galimberti, G.; Sacchi, S.; Siena, F.; Cavagna, B.; Ciampitti, M.; Giordano, L. First report of the ficus whitefly Singhiella simplex (Singh, 1931) (Hemiptera: Aleyrodidae) in Northern Italy and first observation of its association with the parasitoid wasp Encarsia hispida De Santis, 1948 (Hymenoptera: Aphelinidae) in Europe. EPPO Bull. 2024, 54, 182–188. [Google Scholar] [CrossRef]
- Šimala, M.; Pintar, M.; Milek, T.M. First records of new insect pests in Croatia between two Slovenian conferences on plant protection (2019–2022). In Proceedings of the Zbornik Predavanj in Referatov 15. Slovenskega Posvetovanja o Varstvu Rastlin z Mednarodno Udeležbo, Portorož, Slovenia, 1–2 March 2022. [Google Scholar]
- Kondo, T.; Evans, G. Singhiella simplex (Singh) (Hemiptera: Aleyrodidae), a new aleyrodid invasive species for Colombia. Bol. Mus. Entomol. Univ. Val. 2012, 13, 31–34. [Google Scholar]
- Torres-Barragán, A.; Anaya, A.L.; Alatorre, R.; Toriello, C. Entomopathogenic fungi from ‘El Eden’ Ecological Reserve, Quintana Roo, Mexico. Mycopathologia 2004, 158, 61–71. [Google Scholar] [CrossRef]
- Mannion, C. Ficus Whitefly, Management in the Landscape. UF/IFAS Extension. Available online: https://cisr.ucr.edu/sites/default/files/2019-07/ficus_whitefly_feb2010_fact_sheet.pdf (accessed on 20 August 2024).
- Avery, P.B.; Mannion, C.M.; Powell, C.A.; McKenzie, C.L.; Osborne, L.S. Natural enemies managing the invasion of the fig whitefly, Singhiella simplex (Hemiptera: Aleyrodidae), infesting a Ficus benjamina hedge. Fla. Entomol. 2011, 94, 696–698. [Google Scholar] [CrossRef]
- Elliot, S.; Sabelis, M.; Janssen, A.; Der Geest, V.; Beerling, E.; Fransen, J. Can plants use entomopathogens as bodyguards? Ecol. Lett. 2000, 3, 228–235. [Google Scholar] [CrossRef]
- Yükselbaba, U. Survey of the Ficus whitefly, Singhiella simplex (Hemiptera: Aleyrodidae), and its natural enemies in the Western Mediterranean Region of Turkey. Fla. Entomol. 2023, 106, 22–28. [Google Scholar] [CrossRef]
- van Roermund, H.J.W.; van Lenteren, J.C. The parasite-host relationship between Encarsia formosa (Hymenoptera: Aphelinidae) and Trialeurodes vaporariorum (Homoptera: Aleyrodidae) XXXV. Life-history parameters of the greenhouse whitefly parasitoid Encarsia formosa as a function of host stage and temperature. Wagening. Agric. Univ. Pap. 1992, 92–93, 1–147. [Google Scholar]
- Melone, G.; Ascolese, R.; Nugnes, F.; Porcelli, F.; Rapisarda, C.; Farina, A.; Picciotti, U.; Garganese, F.; Laudonia, S. An Eretmocerus species, parasitoid of Aleurocanthus spiniferus, was found in Europe: The secret savior of threatened plants. Sustainability 2024, 16, 2970. [Google Scholar] [CrossRef]
- Myartseva, N.S.; González-Julián, P.; Ruíz-Cancino, E.; Coronado-Blanco, C.M.J.; Muñoz-Viveros, L.A. Parasitoides de la mosquita blanca Singhiella simplex (Singh, 1931) en México (Hymenoptera: Chalcidoidea: Aphelinidae). [Parasitoids of ficus whitefly Singhiella simplex (Singh, 1931) in Mexico]. Entomol. Mex. 2014, 1, 1113–1117. (In Spanish) [Google Scholar]
- Ahmed, M.Z.; Hernandez, Y.; Francis, A.; Evans, G.; Rohrig, E.; Osborne, L.; Mannion, C. Balios eulophid Baeoentendon balios Wang, Huang & Polaszek (Insecta: Hymenoptera: Eulophidae). In Featured Creatures, EDIS-IFAS EENY-676; University of Florida: Gainesville, FL, USA, 2017. [Google Scholar]
- Sánchez-Flores, O.A.; Coronado-Blanco, J.M. Parasitoide de Singhiella simplex (Singh, 1931) (Hemiptera: Aleyrodidae) en Tamaulipas, México. Boletín Soc. Mex. Entomol. 2020, 6, 9–14. [Google Scholar]
- Hodges, G. The Fig Whitefly Singhiella simplex (Singh) (Hemiptera: Aleyrodidae): A New Exotic Whitefly Found on Ficus Species in South Florida. Pest Alert DPI-FDACS. 2007. Available online: http://www.freshfromflorida.com/pi/enpp/ento/Singhiella%20simplex.html (accessed on 21 September 2024).
- Lahey, Z.J.; Polaszek, A. Baeoentedon balios (Hymenoptera: Eulophidae): A parasitoid of ficus whitefly, Singhiella simplex (Singh) (Hemiptera: Aleyrodidae), new to the United States. Int. J. Pest Manag. 2017, 63, 349–351. [Google Scholar] [CrossRef]
- Hadley, A.; Combine, Z.P. 2011. Available online: https://combinezp.software.informer.com/ (accessed on 10 May 2019).
- Martin, J.H. The whitefly fauna of Australia (Sternorrhyncha: Aleyrodidae), a taxonomic account and identification guide. Tech. Pap. CSIRO Entomol. 1999, 38, 1–197. [Google Scholar]
- Pizza, M.; Porcelli, F. Sull’allestimento di preparati microscopici di pupari di Aleirodidi (Homoptera). Boll. Soc. Entomol. Ital. 1993, 125, 3–5. [Google Scholar]
- Noyes, J.S. Collecting and preserving chalcid wasps (Hymenoptera: Chalcidoidea). J. Nat. Hist. 1982, 16, 315–334. [Google Scholar] [CrossRef]
- Polaszek, A.; Ayshford, T.; Yahya, B.E.; Fusu, L. Wallaceaphytis: An unusual new genus of parasitoid wasp (Hymenoptera: Aphelinidae) from Borneo. J. Nat. Hist. 2014, 48, 1111–1123. [Google Scholar] [CrossRef]
- Jensen, A.S. A cladistic analysis of Dialeurodes, Massilieurodes, and Singhiella, with notes and keys to the Nearctic species and descriptions of four new Massilieurodes species (Hemiptera: Aleyrodidae). Syst. Entomol. 2001, 26, 279–310. [Google Scholar] [CrossRef]
- Suh, S.; Evans, G.A.; Oh, S. A checklist of intercepted whiteflies (Hemiptera: Aleyrodidae) at the Republic of Korea ports of entry. J. Asia-Pac. Entomol. 2008, 11, 37–43. [Google Scholar] [CrossRef]
- Viggiani, G. Notes on a few Aphelinidae, with description of five new species of Encarsia Foerster (Hymenoptera: Chalcidoidea). Boll. Lab. Entomol. Agrar. Filippo Silvestri 1985, 42, 81–94. [Google Scholar]
- Heraty, J.M.; Polaszek, A. Morphometric analysis and descriptions of selected species in the Encarsia strenua group (Hymenoptera: Aphelinidae). J. Hymenopt. Res. 2000, 9, 142–169. [Google Scholar]
- Polaszek, A.; Manzari, S.; Quicke, D.L.J. Morphological and molecular taxonomic analysis of the Encarsia meritoria species-complex (Hymenoptera, Aphelinidae), parasitoids of whiteflies (Hemiptera, Aleyrodidae) of economic importance. Zool. Scr. 2004, 33, 403–421. [Google Scholar] [CrossRef]
- Campbell, B.; Heraty, J.; Rasplus, J.Y.; Chan, K.; Steffen-Campbell, J.; Babcock, C. Molecular systematics of the Chalcidoidea using 28S-D2 rDNA. In Hymenoptera Evolution, Biodiversity and Biological Control; CSIRO Publishing: Collingwood, Australia, 2000; pp. 59–73. [Google Scholar]
- Monti, M.M.; Nappo, A.G.; Giorgini, M. Molecular characterization of closely related species in the parasitic genus Encarsia (Hymenoptera: Aphelinidae) based on the mitochondrial cytochrome oxidase subunit I gene. Bull. Entomol. Res. 2005, 95, 401–408. [Google Scholar] [CrossRef]
- Gebiola, M.; Monti, M.M.; Johnson, R.C.; Woolley, J.B.; Hunter, M.S.; Giorgini, M.; Pedata, P.A. A revision of the Encarsia pergandiella species complex (Hymenoptera: Aphelinidae) shows cryptic diversity in parasitoids of whitefly pests. Syst. Entomol. 2017, 42, 31–59. [Google Scholar] [CrossRef]
- Gebiola, M.; Bernardo, U.; Monti, M.M.; Navone, P.; Viggiani, G. Pnigalio agraules (Walker) and Pnigalio mediterraneus Ferrière and Delucchi (Hymenoptera: Eulophidae): Two closely related valid species. J. Nat. Hist. 2009, 43, 2465–2480. [Google Scholar] [CrossRef]
- Simon, C.; Frati, F.; Beckenbach, A.; Crespi, B.; Liu, H.; Flook, P. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 1994, 87, 651–701. [Google Scholar] [CrossRef]
- Campbell, B.C.; Steffen-Campbell, J.D.; Werren, J.H. Phylogeny of the Nasonia species complex (Hymenoptera: Pteromalidae) inferred from an internal transcribed spacer (ITS2) and 28S rDNA sequences. Insect Mol. Biol. 1994, 2, 225–237. [Google Scholar] [CrossRef]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Universal Chalcidoidea Database (UCD) Curated in TaxonWorks. Available online: https://sfg.taxonworks.org (accessed on 20 September 2024).
- Polaszek, A.; Abd-Rabou, S.; Huang, J. The Egyptian species of Encarsia (Hymenoptera: Aphelinidae): A preliminary review. Zool. Meded. 1999, 73, 131–163. [Google Scholar]
- Shih, Y.T.; Ko, C.C.; Polaszek, A. Encarsia (Hymenoptera: Aphelinidae) parasitoids of Bemisia species in Taiwan (Hemiptera: Aleyrodidae). J. Nat. Hist. 2008, 42, 2923–2941. [Google Scholar] [CrossRef]
- Nguyen, R.; Hamon, A.B. Dialeurodes kirkaldyi (Kotinsky), in Florida (Homoptera: Aleyrodidae: Aleyrodinae). Entomol. Circ. 1989, 323, 2. [Google Scholar]
- Schmidt, S.; Naumann, I.D.; De Barro, P.J. Encarsia species (Hymenoptera: Aphelinidae) of Australia and the Pacific Islands attacking Bemisia tabaci and Trialeurodes vaporariorum (Hemiptera: Aleyrodidae)—A pictorial key and descriptions of four new species. Bull. Entomol. Res. 2001, 91, 369–387. [Google Scholar] [CrossRef]
- Abd-Rabou, S. Revision of Aphelinidae (Hymenoptera) from Egypt. In Proceedings of the Second International Conference of Plant Protection Research Institute; Dokki: Giza, Egypt, 2002; Volume 1, p. 281. [Google Scholar]
- Giorgini, M. Induction of males in thelytokous populations of Encarsia meritoria and Encarsia protransvena: A systematic tool. BioControl 2001, 46, 427–438. [Google Scholar] [CrossRef]
- Viggiani, G. Host-range increase and phenology of Encarsia meritoria Gahan in Europe (Hymenoptera: Aphelinidae). In Parasitic Wasps: Evolution, Systematics, Biodiversity and Biological Control, Proceedings of the International Symposium: “Parasitic Hymenoptera: Taxonomy and Biological Control”, Köszeg, Hungary, 14–17 May 2001; Melika, G., Thuróczy, C., Eds.; 2002; pp. 335–339. Available online: https://iris.cnr.it/handle/20.500.14243/103624 (accessed on 21 September 2024).
- Myartseva, S.N.; Evans, G.A. Genus Encarsia Förster of Mexico (Hymenoptera: Chalcidoidea: Aphelinidae). A revision, key and description of new species. Ser. Avis. Parasit. Plagas Otros Insectos 2008, 3, 1–320. [Google Scholar]
- Abd-Rabou, S.; Ghahari, H. A revision of Encarsia (Hymenoptera: Aphelinidae) species from Iran. Egypt. J. Agric. Res. 2004, 82, 647–684. [Google Scholar]
- Hayat, M. A revision of the species of Encarsia Foerster (Hymenoptera: Aphelinidae) from India and the adjacent countries. Orient. Insects 1989, 23, 1–131. [Google Scholar] [CrossRef]
- De Santis, L. Adiciones a la fauna Argentina de Afelínidos (Hymenoptera: Chalcidoidea). Notas Mus. Plata Buenos Aires 1948, 13, 45. [Google Scholar]
- Babcock, C.S.; Heraty, J.M.; De Barro, P.J.; Driver, F.; Schmidt, S. Preliminary phylogeny of Encarsia Förster (Hymenoptera: Aphelinidae) based on morphology and 28S rDNA. Mol. Phylogenet. Evol. 2001, 18, 306–323. [Google Scholar] [CrossRef]
- Heraty, J.M.; Polaszek, A.; Schauff, M.E. Systematics and Biology of Encarsia. In Classical Biological Control of Bemisia tabaci in the United States—A Review of Interagency Research and Implementation; Gould, J., Hoelmer, K., Goolsby, J., Eds.; Progress in Biological Control; Springer: Dordrecht, The Netherlands, 2008; Volume 4. [Google Scholar] [CrossRef]
- Viggiani, G. Notes on some Nearctic and Neotropical Encarsia Förster (Hymenoptera: Aphelinidae). Boll. Lab. Entomol. Agrar. Filippo Silvestri Portici 1989, 46, 207–221. [Google Scholar]
- Polaszek, A.; Evans, G.A.; Bennett, F.D. Encarsia parasitoids of Bemisia tabaci (Hymenoptera: Aphelinidae, Homoptera: Aleyrodidae): A preliminary guide to identification. Bull. Entomol. Res. 1992, 82, 375–392. [Google Scholar] [CrossRef]
- Dozier, H.L. Two undescribed chalcid parasites of the woolly whitefly, Aleurothrixus floccosus (Maskell) from Haiti. Proc. Entomol. Soc. Wash. 1932, 34, 118–122. [Google Scholar]
- Giorgini, M.; Monti, M.M.; Caprio, E.; Stouthamer, R.; Hunter, M.S. Feminization and the collapse of haplodiploidy in an asexual parasitoid wasp harboring the bacterial symbiont Cardinium. Heredity 2009, 102, 365–371. [Google Scholar] [CrossRef]
- Hernández-Suárez, E.; Carnero, A.; Aguiar, A.; Prinsloo, G.; LaSalle, J.; Polaszek, A. Parasitoids of whiteflies (Hymenoptera: Aphelinidae, Eulophidae, Platygastridae; Hemiptera: Aleyrodidae) from the Macaronesian archipelagos of the Canary Islands, Madeira, and the Azores. Syst. Biodivers. 2003, 1, 55–108. [Google Scholar] [CrossRef]
- Andreason, S.A.; Triapitsyn, S.V.; Perring, T.M. Untangling the Anagyrus pseudococci species complex (Hymenoptera: Encyrtidae), parasitoids of worldwide importance for biological control of mealybugs (Hemiptera: Pseudococcidae): Genetic data corroborates separation of two new, previously misidentified species. Biol. Control 2019, 129, 65–82. [Google Scholar]
- Miller, K.E.; Polaszek, A.; Evans, D.M. A dearth of data: Fitting parasitoids into ecological networks. Trends Parasitol. 2021, 37, 863–874. [Google Scholar] [CrossRef] [PubMed]
Sampling Sites (Province) | Coordinates | Host Plant | Date |
---|---|---|---|
Palermo (PA) | 38°06′20″ N; 13°20′57″ E | F. microcarpa | 9.II.2024 16.II.2024 |
Catania (CT) | 37°31′09″ N; 15°06′19″ E | F. microcarpa | 6.X.2024 |
Acicastello (CT) | 37°33′28″ N; 15°09′01″ E | F. microcarpa | 12.X.2024 |
Acireale (CT) | 37°37′44″ N; 15°09′33″ E | F. microcarpa | 7.X.2024 |
Reggio Calabria (RC) | 38°07′21″ N; 15°39′32″ E 38°07′13″ N; 15°39′29″ E 38°07′32″ N; 15°39′17″ E | F. microcarpa | 7.X.2024 |
Santa Maria Capua Vetere (CE) | 41°05′01″ N; 14°15′56″ E 41°04′42″ N; 14°15′42″ E | F. microcarpa F. benjamina | 30.IX.2024 30.IX.2024 |
Salerno (SA) | 40°40′38″ N; 14°45′53″ E 40°40′12″ N; 14°47′15″ E 40°38′33″ N; 14°51′26″ E | F. benjamina | 25.X.2024 18.X.2024 8.XI.2024 |
Naples (NA) | 40°51′35″ N; 14°16′14″ E | F. benjamina | 27.XI.2024 |
Formia (LT) | 41°15′48″ N; 13°37′33″ E | F. benjamina | 5.X.2024 |
Bari (BA) | 41°05′46″ N; 16°53′20″ E 41°06′31″ N; 16°52′23″ E | F. microcarpa | 6.III.2024; 5.VI.2024; 15.VIII.2024; 17.IX.2024; 14.X.2024; 21–22.XI.2024 (in both sites, only S. simplex) |
Name | Nucleotide Sequence (5′-3′) | Melt. Temp. (°C) | Target Gene |
---|---|---|---|
C1-J-2183 C1-J-2195 TL2-N-3014 | CAACATTTATTTTGATTTTTTGG TTGATTTTTTGGTCATCCAGAAGT TCCAATGCACTAATCTGCCATATTA | 55 55 63 | COI |
D2F D2R | AGTCGTGTTGCTTGATAGTGCAG TTGGTCCGTGTTTCAAGACGGG | 57 62 | 28S-D2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cerasa, G.; Tomasello, L.; Melone, G.; Russo, E.; Siscaro, G.; Cavallaro, C.; Ienco, A.; Laudani, F.; Palmeri, V.; Campolo, O.; et al. New Record of Encarsia protransvena and Confirmed Occurrence of Encarsia hispida (Hymenoptera: Aphelinidae) as Parasitoids of Singhiella simplex (Hemiptera: Aleyrodidae) in Italy. Insects 2025, 16, 40. https://doi.org/10.3390/insects16010040
Cerasa G, Tomasello L, Melone G, Russo E, Siscaro G, Cavallaro C, Ienco A, Laudani F, Palmeri V, Campolo O, et al. New Record of Encarsia protransvena and Confirmed Occurrence of Encarsia hispida (Hymenoptera: Aphelinidae) as Parasitoids of Singhiella simplex (Hemiptera: Aleyrodidae) in Italy. Insects. 2025; 16(1):40. https://doi.org/10.3390/insects16010040
Chicago/Turabian StyleCerasa, Giuliano, Luigi Tomasello, Gianluca Melone, Elia Russo, Gaetano Siscaro, Carmelo Cavallaro, Annamaria Ienco, Francesca Laudani, Vincenzo Palmeri, Orlando Campolo, and et al. 2025. "New Record of Encarsia protransvena and Confirmed Occurrence of Encarsia hispida (Hymenoptera: Aphelinidae) as Parasitoids of Singhiella simplex (Hemiptera: Aleyrodidae) in Italy" Insects 16, no. 1: 40. https://doi.org/10.3390/insects16010040
APA StyleCerasa, G., Tomasello, L., Melone, G., Russo, E., Siscaro, G., Cavallaro, C., Ienco, A., Laudani, F., Palmeri, V., Campolo, O., Garganese, F., Porcelli, F., Pedata, P. A., Farina, V., Gugliuzza, G., Rizzo, R., Laudonia, S., & Lo Verde, G. (2025). New Record of Encarsia protransvena and Confirmed Occurrence of Encarsia hispida (Hymenoptera: Aphelinidae) as Parasitoids of Singhiella simplex (Hemiptera: Aleyrodidae) in Italy. Insects, 16(1), 40. https://doi.org/10.3390/insects16010040