Next Article in Journal
Guium nebulum gen. et sp. nov., a New Cup Moth from Southern China Based on Morphological and Molecular Analysis (Lepidoptera: Zygaenoidea: Limacodidae)
Next Article in Special Issue
New Records of Phenacoccus solenopsis Natural Enemies in Europe and Taxonomic Additions on Anagyrus matritensis
Previous Article in Journal
Current Status, Challenges, and Perspectives in the Conservation of Native Honeybees and Beekeeping in Cambodia
Previous Article in Special Issue
Parasitoids of Insect Pests Feeding on Scaevola taccada (Goodeniaceae) from Yongxing Island in South China Sea
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

New Record of Encarsia protransvena and Confirmed Occurrence of Encarsia hispida (Hymenoptera: Aphelinidae) as Parasitoids of Singhiella simplex (Hemiptera: Aleyrodidae) in Italy

by
Giuliano Cerasa
1,
Luigi Tomasello
1,
Gianluca Melone
2,
Elia Russo
3,
Gaetano Siscaro
4,
Carmelo Cavallaro
4,
Annamaria Ienco
5,
Francesca Laudani
5,
Vincenzo Palmeri
5,
Orlando Campolo
5,
Francesca Garganese
6,
Francesco Porcelli
6,
Paolo A. Pedata
2,
Vittorio Farina
1,
Giovanni Gugliuzza
7,
Roberto Rizzo
7,
Stefania Laudonia
3,* and
Gabriella Lo Verde
1,*
1
Department of Agricultural, Food and Forestry Science, University of Palermo (UNIPA), Viale delle Scienze, Ed. 5, 90128 Palermo, Italy
2
National Research Council, Institute for Sustainable Plant Protection, P. le E. Fermi 1, 80055 Portici, Italy
3
Department of Agricultural Sciences, University of Naples Federico II (UNINA), Via Università 100, 80055 Portici, Italy
4
Department of Agriculture, Food and Environment, University of Catania (UNICT), Via Santa Sofia, 100, 95123 Catania, Italy
5
Department of Agriculture, Mediterranean University of Reggio Calabria (UNIRC), Loc Feo di Vito, 89100 Reggio Calabria, Italy
6
Department of Soil Sciences, Plants and Food, University of Bari Aldo Moro (UNIBA), Via Amendola 165/A, 70126 Bari, Italy
7
CREA-Research Centre for Plant Protection and Certification, c/o Department of Agricultural, Food and Forestry Science, University of Palermo (UNIPA), Viale delle Scienze, Ed. 5, 90128 Palermo, Italy
*
Authors to whom correspondence should be addressed.
Insects 2025, 16(1), 40; https://doi.org/10.3390/insects16010040
Submission received: 5 December 2024 / Revised: 29 December 2024 / Accepted: 1 January 2025 / Published: 3 January 2025
(This article belongs to the Collection Hymenoptera: Biology, Taxonomy and Integrated Management)

Simple Summary

We report the detection of Encarsia protransvena and confirm Encarsia hispida as parasitoids of the exotic invasive whitefly Singhiella simplex (Hemiptera: Aleyrodidae) in Italy. Native to the Oriental region, S. simplex has now spread worldwide, causing significant damage to exotic fig plants in southern Italy, providing a unique opportunity to study its natural interactions. The whitefly and its parasitoids were collected in some south Italian regions, obtaining two species of Chalcidoidea Aphelinidae. Using a combination of morphological and molecular analyses, we identified E. protransvena, a species reported as the only known natural enemy in the Mediterranean region. This discovery increases our understanding of the biology of both the pest and its parasitoid, offering valuable insights for future biological control programs. As we write this note, we also have obtained specimens of Encarsia hispida from the host collected in Campania. We aim to provide bio-ethological information about the species in the future.

Abstract

Encarsia protransvena (Hymenoptera: Aphelinidae) is recorded here for the first time in Italy as a parasitoid of the whitefly Singhiella simplex (Hemiptera: Aleyrodidae), one of the most invasive alien pests of exotic Ficus species. Singhiella simplex, originating from the Oriental region, has established a global presence. Monitoring of the whitefly and its parasitoids was conducted in the southern areas of Italy, providing crucial insights into their distribution and interactions. The taxonomic identity of E. protransvena, was confirmed by scrutiny of morphological and molecular taxonomic characters. At the time of writing, we also obtained some specimens of Encarsia hispida from the host collected in Campania. We reserve the right to provide bio-ethological information on the species in the future. Comprehensive illustrations and diagnostic features are provided for the host and the parasitoids. An identification key is included for all Encarsia species associated with S. simplex, which provides a valuable tool to distinguish these aphelinid wasps for future research and applications in biological control programs.

1. Introduction

The fig whitefly Singhiella simplex (Singh, 1931) (Hemiptera: Aleyrodidae) is an invasive sap-feeding pest native to Southeast Asia that primarily infests ornamental plants of the genus Ficus, mainly Ficus benjamina L. and Ficus microcarpa L.f., but can also target lesser host plant species, such as Hibiscus spp. (Malvaceae) and Mangifera indica L. (Anacardiaceae) [1,2,3,4,5,6].
After its first record as an invasive species in the United States (Hodges, 2007), the pest spread to Central and South America and the Caribbean [5]. In 2014, the fig whitefly was found in Europe on several fig species in Cyprus [4] after its European recording, S. simplex spread across several Mediterranean countries [7,8,9,10,11,12,13], including Italy, where it has significantly impacted urban trees in roadsides, parks, and gardens [14,15,16,17]. Due to the significant phytosanitary risks associated with S. simplex, the pest was included in the EPPO Alert List from 2014 to 2018 [2].
Recent studies on the biology of S. simplex indicate that, under favourable climatic conditions such as those in Mediterranean countries, this whitefly can develop several overlapping generations per year [18].
The direct damage caused by S. simplex is mainly due to sap-sucking by the nymphs, which gradually weakens and yellows the infested leaves. Unlike most whitefly species, S. simplex feeds on both sides of the leaf [19]. It excretes considerable honeydew, promoting intense sooty mold that extensively coats the host plant. Infestations cause extensive defoliation and twig dieback, posing an additional threat to the overall plant health [6,7].
Several natural enemies of S. simplex have been reported in the literature, including predators and entomopathogens [6,20,21,22,23,24]. Different species of hymenopteran parasitoids belonging to the genus Encarsia Förster (Hymenoptera: Aphelinidae) are present worldwide and associated with the whiteflies, among them the worldwide species Trialeurodes vaporariorum (Westwood) [25] and Aleurocanthus spiniferus (Quaintance, 1903), recently introduced in Europe [26]. Three species of hymenopteran parasitoids in the genus Encarsia are reported as associated with the fig whitefly: Encarsia singhiellae Shih and Polaszek, 2015; E. hispida De Santis, 1948 and E. protransvena Viggiani, 1985 [5,27,28,29]. The recording of E. tricolor Förster, 1878 [30] has been considered a misidentification based on the aphelinid known species distribution [5]. The platigastrid Amitus bennetti Viggiani and Evans, 1992, and the eulophid Baeoentedon balios Wang, Huang and Polaszek, 2014, have also been reported [28,31]. Occasionally, males of E. variegata Howard, 1908, develop as hyperparasitoids on the eulophid previously mentioned [6,28]. Encarsia protransvena is the only confirmed parasitoid of S. simplex in the Mediterranean region [24]. At the same time, the recent report of E. hispida [17] deserves confirmation. In particular, the iconography reported in the article does not show morphological characteristics of E. hispida at all. A confirmation has come while we write this note, thanks to a recent collection of S. simplex in the Campania region with parasitization activity of E. hispida, currently in reduced numbers, contextual with that due to E. protransvena.
In 2024, surveys in southern and central Italy (Apulia, Basilicata, Calabria, Campania, Lazio, and Sicily regions) monitored the presence of the invasive S. simplex, and female parasitoids belonging to the genus Encarsia were detected in multi-site collections of the whitefly.
Here, we combined morphological analysis and molecular data from mitochondrial and nuclear markers to confirm the taxonomic identity of E. protransvena and E. hispida. We also documented the distribution of E. protransvena in Italy and provided a detailed morphological characterization to improve its identification. Finally, we propose an identification key for all Encarsia species associated with S. simplex, which will aid in distinguishing these aphelinid wasps in the following research and biocontrol programs management.

2. Materials and Methods

2.1. Hosts and Parasitoids Collection

Surveys have been conducted on F. microcarpa and F. benjamina trees planted in urban greeneries, parks, and roadsides in Sicily (Provinces of Palermo and Catania), Calabria (Province of Reggio Calabria), Apulia (Bari, metropolitan city), and on isolated plants of private gardens in Lazio (Province of Latina), in Campania (Provinces of Naples, Caserta and Salerno), and in Basilicata (Province of Matera). The collecting sites in which the whitefly was present are listed in Table 1. During each collection, infested leaves with S. simplex immature stages were gathered and then examined by a stereoscopic microscope in the laboratory. The collected material was isolated in small rearing cages and kept under laboratory conditions (26° C, 70% RH) until the whitefly or the parasitoid adult emergence. The whitefly nymphs and adults of both the host and the parasitoid were preserved in ethanol (EtOH 90%, V/V water). Adults of whitefly and parasitoids and leaves bearing the whitefly instars were photographed using a Wild-Heerbrugg M8 stereoscopic microscope equipped with a digital camera (Canon 7D, Canon Inc., Tokyo, Japan). Single montage images were obtained from image stacks with the freeware CombineZP [32] and then processed in Adobe Photoshop CS4.

2.2. Morphological Identification

Whitefly slide mounting followed standard methods reported by Martin [33] and Pizza and Porcelli [34], whereas slide mounting of parasitoids was carried out according to Noyes [35] and Polaszek et al. [36].
Mounted insects were examined in a bright field on a Zeiss Universal Photomicroscope III and photographed using a Leica DFC420C camera mounted on a Leica DM 2005 compound microscope (Leica Application Suite software, Leica Microsystems Ltd., Buccinasco (MI), Italy). CombineZP [32] produced image stacks post-processed in Adobe Photoshop CS4.
Identification of both adult and pupae of the whitefly was carried out according to Jensen [37], Hodges [30], Suh et al. [38], and Kondo and Evans [19]. The parasitoid identifications were carried out following the original description by Viggiani [39] and the identification keys reported by Heraty and Polaszek [40] and Polaszek et al. [41]. The specimens of Encarsia collected in different areas (see Examined material) and prepared on slides were compared with type material deposited in the Silvestri Museum of the University of Naples collection.

2.3. Molecular Identification

Sequencing of the parasitoid specimens emerged from S. simplex (see Examined material) targeted a portion of the mitochondrial cytochrome c oxidase subunit 1 (COI) gene and the nuclear D2 expansion segment of 28S (28S-D2) rDNA. These molecular markers were selected for their wide application in the taxonomy of Chalcidoidea [42,43,44]. Newly emerged parasitoids were individually killed in 96% ethanol, and genomic DNA was extracted using the non-destructive Chelex-proteinase K protocol by Gebiola et al. [45], preserving the morphological details of specimens.
The COI segment was amplified with the forward primers C1-J-2183 or C1-J-2195 paired with the reverse TL2-N-3014 [46], previously used for molecular characterization of Encarsia species [43,44]. The 28S-D2 region was amplified using the universal primers D2F and D2R developed by Campbell et al. [47]. Table 2 lists the oligonucleotide sequences and their characteristics. The polymerase chain reaction (PCR) runs were performed using DreamTaq Green PCR Master Mix (Thermo Fisher Scientific, Ferentino (FR), Italy) in a total volume of 25 µL, comprising 12.5 µL PCR Master Mix (2X), 2 µL DNA template, 1 µL of each primer (10 µM), and 8.5 µL nuclease-free water. Thermal cycling conditions included an initial denaturation at 95 °C for 3 min, followed by 40 cycles of 95 °C for 30″, 50–55 °C (depending on melting temperatures of the primer) for 30″, and 72 °C for 1′. The protocol concluded with a final extension at 72 °C for 7 min. PCR products were separated on a 1% agarose gel stained with SYBR™ Safe DNA Gel Stain (Thermo Fisher Scientific) and observed under a ChemiDoc (Bio-Rad, Segrate (MI), Italy) transilluminator. Positive amplicons were sent to Eurofins Genomics (Ebersberg, Germany) for purification and bi-directional sequencing.
Forward and reverse reads were manually edited using BioEdit version 7.2.5 [48] (Hall, 1999) to correct overlapping peaks in the electropherograms. Low-quality bases were trimmed from both ends, and consensus sequences were generated. The COI sequences were virtually translated into protein using the Transeq (EMBOSS) tool to check for frameshifts or premature stop codons. All sequences were submitted to NCBI’s BLASTn protocol in GenBank to verify matches against standard databases using default parameters.

3. Results

3.1. Morphological Identification

The identity of S. simplex was confirmed based on the morphology of both adults and immature instars (Figure 1, Figure 2, Figure 3 and Figure 4). The insect was found in all sampled sites only in Sicily and Calabria. In Apulia, the whitefly was recorded only in two out of six sites, where Macrohomotoma gladiata Kuwayama, 1908 (Hemiptera: Psylloidea: Homotomidae), another fig pest introduced in the EPPO area [48], was always present. Finally, no S. simplex was found in the only sampling site in the Basilicata region (Policoro, Matera province).
Parasitoids were obtained from all sampled sites where the whitefly was found, except the Apulia sites. Based on morphological features, the emerged parasitoid species were identified as E. protransvena and E. hispida (Hymenoptera: Aphelinidae). Their taxonomy, host association, and distribution are briefly discussed below.
Encarsia protransvena Viggiani, 1985
Examined material.
12 ♀♀ on slides, (ITALY: Sicily, Palermo, 9.II.2024, ex S. simplex (Singh, 1931) on F. microcarpa L. f., leg. G. Cerasa). 9 ♀♀ on slides, (ITALY: Sicily, Palermo, 16.II.2024, ex S. simplex (Singh, 1931) on F. microcarpa L. f., leg. L. Tomasello) (Department of Agricultural, Food and Forest Sciences, University of Palermo).
20 ♀♀ on slides, (ITALY: Calabria, Reggio Calabria, 7.X.2024, ex S. simplex (Singh, 1931) on F. microcarpa L. f., leg. V. Palmeri) (Department of Agriculture-Mediterranean University of Reggio Calabria).
2 ♀♀ in ethanol (ITALY: Sicily, Catania, 6.X.2024, ex S. simplex (Singh, 1931) on F. microcarpa L. f., leg. G. Siscaro). 10 ♀♀ on slides and 30 ♀♀ in ethanol (ITALY: Sicily, Acicastello (CT), 12.X.2024, ex S. simplex (Singh, 1931) on F. microcarpa L. f., leg. G. Siscaro). 10 ♀♀ in ethanol (ITALY: Sicily, Acireale (CT), 7.X.2024, ex S. simplex (Singh, 1931) on F. microcarpa L. f., leg. G. Siscaro) (Department of Agriculture, Food and Environment, University of Catania).
10 ♀♀ on slides and 11 ♀♀ in ethanol (ITALY: Sicily, Palermo, 9.II.2024, ex S. simplex (Singh, 1931) on F. microcarpa L. f., leg. G. Cerasa). 3 ♀♀ in ethanol (ITALY: Campania, Santa Maria Capua Vetere, 30.IX.2024, ex S. simplex (Singh, 1931) on F. microcarpa L. f., leg. P. A. Pedata). 5 ♀♀ in ethanol (ITALY: Lazio, Formia, 5.X.2024, ex S. simplex (Singh, 1931) on F. benjamina L., leg. P. A. Pedata). 2 ♀ in ethanol (ITALY, Campania, Naples, 27.XI.2024, ex S. simplex (Singh, 1931) on F. benjamina L. f., leg. P. A. Pedata) (Department of Agricultural Sciences, University of Naples Federico II).
Original description: Viggiani [39] described the species based on 1 ♀, holotype ex Dialeurodes kirkaldyi (Kotinsky, 1907) collected in U.S.A, Florida, Sept. ’84, leg. C.R.R. Thomson; 6 ♀, paratypes, same data.
Distribution: Argentina, China, Colombia, Egypt, French Polynesia, Georgia, Honduras, Indonesia, Iran, Italy, Malaysia, Mexico, Puerto Rico, Spain, Taiwan, Turkey, USA, Western Australia [24,27,49]. We first report E. protransvena associated with the invasive whitefly S. simplex in Italy.
Hosts: The known hosts of E. protransvena are Acaudaleyrodes citri (Priesner et Hosny, 1934) [50], Aleurotrachelus rubi Takahashi, 1933, Aleurothrixus floccosus (Maskell, 1896), Bemisia porteri Corbett, 1935 [51], B. tabaci (Gennadius, 1889) [40,50,52,53], Dialeurodes citri (Ashmead, 1885) [40,53,54], D. citrifolii (Morgan, 1893) [40,50,52,53], D. kirkaldyi (Kotinsky, 1907) [39,40,50,52,53], Parabemisia myricae (Kuwana, 1927) [40,55,56], Singhiella citrifolii (Morgan, 1893) [56], S. simplex [24], Tetraleurodes acaciae (Quintance, 1900) [57], Trialeurodes abutiloneus (Haldeman, 1850) [40], T. packardi (Morrill, 1903) [40,50,53,58], T. vaporariorum Westwood, 1856 [52,54], T. variabilis (Quaintance, 1900) [40].
Diagnosis: The species has been included in the strenua-group [59], which includes about 40 species [40]. The authors previously mentioned redescribed E. protransvena, E. citri (Ishii, 1938), and E. strenua (Silvestri, 1927), adding two new species to the strenua-group: E. neocala Heraty and Polaszek, 2000 and E. bimaculata Heraty and Polaszek, 2000. The authors stressed that univariate and bivariate measures of morphological characters could not distinguish all five species because their ranges overlapped. However, by performing a multivariate morphometric analysis, all species could be discriminated. The authors then developed an identification key for females of the strenua-group species. Furthermore, they described the males of all these species except E. neocala but did not use them in the separation of the species, probably because their differences were minimal and sometimes the males are scarce, as for the thelytokous species E. protransvena (2 males out of 360 females examined) [55].
Members of the strenua-group are identified by the combination of two–three marginal setae along the dorsal margin of the costal cell at the apex, a bare area just above the stigmal vein, and scutellar sensillae that are closely placed or touching (Figure 6A,B). According to Heraty and Polaszek [40], within the strenua-group, E. protransvena is distinguished from closely related species of the same group by the following characteristics: mid-lobe of mesosoma usually with four pairs of setae, preapical pair not reaching the base of apical pair (Figure 7A); forewing (Figure 6A) usually more than 2.7 times as long as broad, if between 2.6 and 2.7 times, antennal club less than 0.14 mm in dorsal length; ovipositor slender with tip always straight (Figure 8A), clearly shorter than the length of gaster, less than 1.5 times as long as the middle tibia and more than 2.0 times as long as club (Figure 8B); apex of gaster (tergite 7 with spiracles) with six setae, four long setae medial to cerci (Figure 8C); basal seta of third valvula not reaching base of subapical seta, subapical seta located beyond halfway (0.65) between basal seta of third valvula and apex (Figure 8D).
Encarsia hispida De Santis, 1948
Examined material.
1 ♀ on slide and 1 ♀ in ethanol (ITALY, Campania, Naples, 27.XI.2024, ex S. simplex (Singh, 1931) on F. benjamina L. f., leg. P. A. Pedata) (Department of Agricultural Sciences, University of Naples Federico II).
Original description: De Santis [60] described the species based on 1 ♀, holotype ex an unidentified aleyrodid on Salvia splendens (Schultes, 1820) [s/aleirodoideo en coral rojo] collected in Argentina, Santa Fe, Rosario, 1947 leg. Hack; 2 ♀, paratypes, same data.
Distribution: Argentina, Barbados, Brazil, Chile, Colombia, Dominican Republic, France (Guadeloupe, mainland), Guatemala, Honduras, Italy, Jamaica, Mexico, Netherlands (indoors), Peru, Portugal (Madeira), Puerto Rico, South Africa, Spain (Canary Islands, mainland), U.S.A., Venezuela [41].
Hosts: Aleurodicus dugesii Cockerell 1896, Aleuroglandulus subtilis Bondar 1923 [=A. malangae Russell 1944], A. floccosus, Aleurothrixus porteri Quaintance and Baker 1916, A. rhamnicola, Aleurotrachelus trachoides (Back 1912), Aleyrodes spiraeoides Quaintance 1900, B. tabaci, Dialeurodes sp., Lipaleyrodes sp., Metaleurodicus minimus (Quaintance 1900), P. myricae [41], S. simplex [17,27,29], S. phillyreae, T. acaciae, T. abutiloneus, Trialeurodes floridensis (Quaintance 1900), T. vaporariorum, T. variabilis (Quaintance 1900) [41].
Diagnosis: The species belongs to the luteola-group, which is characterized by four-segmented mid tarsus, fore wing without an asetose area around the stigmal vein, antennal formula 1:1:4:2 [61,62]. Polaszek et al. [41] included it in the E. meritoria species-complex of the luteola group, together with three more species (E. dispersa Polaszek, E. haitiensis Dozier and E. meritoria Gahan). They are all characterized by the typical female body color, generally mostly yellow, and by the tibial spur of the midleg, only slightly shorter than the corresponding basitarsus. Based on this latter character and molecular analysis of the 28S rDNA D2 region, a fifth yellow species, E. californica Polaszek, was not included in the species-complex and considered more closely related to E. formosa Gahan and E. luteola Howard. The authors could separate these very similar species based on the proportion of funicular segments, since these differences, even though very subtle, were consistently supported by multivariate and molecular analysis.
According to Polaszek et al. [41], the female of E. hispida can be separated from the other members of the meritoria complex by the following combination of characters: relative length of funicular segments, with F2 intermediate between F1 and F3; F6 1.2× as long as F5; scape less than 1.6× as long as F6; pedicel elongate, 1.2–1.3× as long as F1, mid tibial spur 0.75–0.8× as long as corresponding basitarsus (Figure 9A–E). The most closely related species in the complex is E. meritoria, whose males have antennae with F5 and F6 partially fused, while males of E. hispida have F5 and F6 separated.
Due to these similarities, these two species have passed through a complex taxonomic history since, after the synonymy proposed by Viggiani [63], Polaszek et al. [64] revalidated E. hispida. Considering that E. meritoria is known only from two series, both collected in Miami Beach, Florida, in 1918 and 1927, the taxonomic status of the two entities will not be fully understood as long as fresh material of E. meritoria from type locality will be available for molecular and biological analysis.
Moreover, E. hispida was successively considered conspecific with E. brasiliensis (Hempel) [41]. The authors proposed to maintain the name of the former species with respect to the senior synonym by reversal of precedence, considering that the type material of E. brasiliensis has been lost and that, due to a misidentification of Dozier [65], the name E. brasiliensis has been consistently applied to a distant taxonomic species belonging to the E. opulenta group.
Key to the females of Encarsia spp. reared from S. simplex:
1.
Antennal formula 1.1.3.3
E. protransvena (Figure 6, Figure 7 and Figure 8)
--Antennal formula 1.1.4.22
2.
Body entirely yellow; forewing hyaline; mid tarsi 4-segmented, tarsal formula 5-4-5
E. hispida (Figure 9)
--Body yellow with brown areas on mesosoma and metasoma; forewing slightly infuscate below marginal vein; mid tarsi 5-segmented, tarsal formula 5-5-5
E. singhiellae

3.2. Molecular Analysis

Two E. protransvena specimens collected in Palermo on 9.II.2024 and one E. hispida found in Naples on 27.XI.2024 (see Examined material) were further validated through sequence analysis of the mitochondrial COI locus and the nuclear 28S-D2 region. The expected sequences of parasitoids that emerged from S. simplex hosts were successfully amplified, sequenced, and uploaded to GenBank under accession numbers PQ451909 (COI) and PQ451935 (28S-D2) for E. protransvena, and PQ725685 (COI) and PQ725690 (28S-D2) for E. hispida.
The amplified COI portion and the 28S-D2 nuclear region were 774 and 598 bp long, respectively, in both parasitoids. The mitochondrial sequence of E. protransvena was truncated from its original size of 910 bp to exclude the non-transcribed region between the locus and the tRNA-leu gene, as previously described in molecular studies on Encarsia species [43].
For E. protransvena, the BLASTn analyses of the obtained COI sequences confirmed a complete match with the only sequence available in GenBank (AY264341.1) referring to specimens collected in Naples (Campania region, Italy) parasitizing P. myricae on Citrus spp. [43]. In addition, the 28S-D2 nuclear dataset showed 100% identity with the two sequences in the database (AF254209.1; AF254208.1) associated with Californian samples [61].
The identity of E. hispida was also confirmed, with its mitochondrial sequence perfectly aligning with a GenBank entry (EU488723.1) from specimens in Naples (Campania region, Italy) and San Diego (California) emerging from Bemisia tabaci Gennadius and Aleurodicus dugesii Cockerell hosts, respectively [66]. At the nuclear level, a single nucleotide substitution in the 28S-D2 region resulted in 99.83% similarity to Californian specimens reported in the NCBI database (AF223370.1). These mitochondrial and nuclear sequences provided strong genetic support for the molecular comparative identification of both Encarsia species associated with the fig whitefly.

4. Discussion

Since its first detection in Italy, S. simplex has caused significant damage to ornamental Ficus plants in several regions [14,15,16,17]. The insect was probably introduced through the trade of plants from infested areas, such as Southeast Asia [15]. Given the ornamental function of many Ficus plants and their location mainly in public places, where the application of pesticides is limited and problematic, it is essential to monitor the presence and effectiveness of natural enemies before implementing any management action, whether chemical or agronomic. In addition to the activities of predators, especially coccinellids, several A.A. report an average parasitization rate of whiteflies of 10% due to Encarsia spp. [22,29]. Although B. balios and A. bennetti appear to be the more effective parasitoids of S. simplex in the U.S.A. [6,28], E. protransvena provides a limited level of control in Turkey, where the highest natural parasitism rate was found to be 32.88% and 21.66% in October 2018 and 2019, respectively [24]. Preliminary data from sampling in the study site at Palermo (Sicily) from May 2024 confirm that the highest parasitism rate, about 20%, was recorded in October (unpublished data). The neotropical species E. hispida has been reported parasitizing Aleurodicus dispersus Russel, 1965 on F. macrophylla Pers. and Ficus spp. in the Canary Islands and Madeira [67]. This species, belonging to the luteola-group, was recently reported as a parasitoid of S. simplex in Northern Italy [17]. However, comparing the E. hispida description with the figures of the slide-mounted specimen reported, the identification appears to be doubtful. Encarsia hispida, as described by De Santis [60], is similar to E. protransvena in body color and easily distinguishable from the latter by the antennal and tarsal formulas (see the key to female species reported in the previous paragraph). The molecular characterization of E. hispida reported by Zugno et al. [17] and the slide image, clearly attributable to E. protransvena, suggest the possibility of a mixed population of the two parasitoids in the sampled area, as confirmed in Campania. Additionally, Zugno et al. [17] relied on COI sequences to support their identification of E. hispida but did not provide GenBank accession numbers for their data, instead directly using the BLASTn tool for sequence comparison, limiting reproducibility and broader comparative analyses. It is worth noting that these observations do not detract from the contributions of Zugno et al. [17] about the distribution of these parasitoids in Italy.
Integrating morphological and molecular analyses for the identification of parasitic Hymenoptera provides a robust and reliable method for enhancing taxonomic accuracy [68,69]. In this study, we applied a combined morphological and molecular approach to comprehensively identify E. protransvena and E. hispida using two informative molecular markers, COI and 28S, corroborating our morphological findings. Molecular evidence derived from BLASTn analysis confirmed that the E. protransvena population we studied is genetically indistinguishable from the previously described in Italy [42] and California [61], as it shares identical mitochondrial and nuclear haplotypes.
This complete genetic identity among populations from geographically distant regions raises intriguing questions about dispersal mechanisms of this aphelinid wasp, highlighting the need for future investigation. Similarly, E. hispida showed high genetic homogeneity, with its mitochondrial sequence fully matching specimens from Italy and California [66]. A single nucleotide substitution in the 28S-D2 region indicated slight intraspecific nuclear variation (0.17% divergence), potentially reflecting regional adaptation or sequencing variability.
The high-resolution molecular dataset generated in this work represents a valuable resource for future research on the population genetics, phylogeography, and evolutionary dynamics of these aphelinid wasps, with important implications for ecological studies and potential biocontrol strategies against whiteflies.
Finally, the integrated taxonomy method allowed us to report for the first time in Italy the association of E. protransvena with the fig whitefly S. simplex and to confirm the association of E. hispida, already known in Italy, as a parasitoid of this invasive species.

Author Contributions

Investigation, experimental design, methodology, software, data curation, writing original draft preparation, writing and editing, supervision, G.C., S.L., G.S., V.P., O.C., F.P., P.A.P. and G.L.V.; investigation, experimental operation and revision of the article, G.M., E.R., C.C., A.I., F.L., F.G., R.R., G.G., V.F. and L.T. All authors have read and agreed to the published version of the manuscript.

Funding

This research was partially funded by Campania Region URCOFI IV “Unità di coordinamento e potenziamento delle attività di sorveglianza, ricerca, sperimentazione, monitoraggio e formazione in campo fitosanitario”.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author(s).

Conflicts of Interest

The authors declare no conflicts of interest.

Correction Statement

This article has been republished with a minor correction to an author's ORCID. This change does not affect the scientific content of the article.

References

  1. Legaspi, J.C.; Mannion, C.; Amalin, D.; Legaspi, B.C., Jr. Biology, ecology and control of the Ficus whitefly, Singhiella simplex (Hemiptera: Aleyrodidae). Potential Invasive Pests Agric. Crop. 2013, 3, 363. [Google Scholar]
  2. EPPO Global Database. Available online: https://gd.eppo.int/taxon/SINLSI/categorization (accessed on 21 September 2024).
  3. EPPO—European and Mediterranean Plant Protection Organization. Mini Data Sheet on Singhiella simplex (Hemiptera: Aleyrodidae) Ficus Whitefly. 2018. Available online: https://gd.eppo.int/taxon/SINLSI/documents (accessed on 22 October 2022).
  4. EPPO. First Report of Singhiella simplex in Cyprus: Addition to the EPPO Alert List. EPPO Reporting Service 11. 2014. Available online: https://gd.eppo.int/reporting/article-3306 (accessed on 21 September 2024).
  5. Ko, C.C.; Shih, Y.T.; Schmidt, S.; Polaszek, A. A new species of Encarsia (Hymenoptera, Aphelinidae) developing on ficus whitefly Singhiella simplex (Hemiptera, Aleyrodidae) in China and Taiwan. J. Hymenopt. Res. 2015, 46, 85–90. [Google Scholar]
  6. Ahmed, M.Z.; McKenzie, C.L.; Revynthi, A.M.; Evans, G.A.; Mottern, J.L.; Mannion, C.M.; Osborne, L.S. Pest status, suvey of natural enemies, and a management plan for the whitefly Singhiella simplex (Hemiptera: Aleyrodidae) in the United States. J. Integr. Pest Manag. 2022, 13, 1–14. [Google Scholar] [CrossRef]
  7. Yükselbaba, U.; Topakcı, N.; Göçmen, H. A new record of Turkey Aleyrodidae fauna, ficus whitefly Singhiella simplex (Singh) (Hemiptera: Aleyrodidae). Phytoparasitica 2017, 45, 715–717. [Google Scholar] [CrossRef]
  8. Germain, J.F.; Lemmet, S.; Balmès, V.; Streito, J.C. Incursion d’un nouvel aleurode nuisible aux ficus en France. Phytoma 2017, 705, 9–11. [Google Scholar]
  9. Dader Alonso, B.; Viñuela Sandoval, E.; Medina Vélez, M.P.; Budia Marigil, M.F.; Adán del Río, A.; del Estal Padillo, P. Presencia en España de la mosca blanca del Ficus spp., Singhiella simplex (Singh, 1931) (Hemiptera: Aleyrodidae). Libro de Resúmenes XI Congreso de la Sociedad Española de Entomología Aplicada (Madrid, 2019-11-04/08), p. 108. Available online: https://www.upm.es/observatorio/vi/index.jsp?pageac=actividad.jsp&id_actividad=324992 (accessed on 21 September 2024).
  10. Šimala, M.; Pintar, M.; Masten Milek, T. Interception of Ficus whitefly [Singhiella simplex (Singh, 1931)] in Croatia. Glas. Biljn. Zaštite 2020, 20, 540–547. [Google Scholar]
  11. Malumphy, C.; Guillem, R. Seven species of whitefly new for Gibraltar, including fig whitefly Singhiella simplex (Singh) (Hemiptera: Aleyrodidae). Entomol.’s Mon. Mag. 2021, 157, 168–172. [Google Scholar] [CrossRef]
  12. Kamel, M.K.B.H.; Zouari, S.; Adouani, R.; Ben Cheik, Z. Nouveau signalement de Singhiella simplex (Singh, 1931) (Aleyrodidae) sur Ficus en Tunisie. EPPO Bull. 2022, 52, 460462. [Google Scholar]
  13. Laarif, A.; Bouslama, T. The Ficus Whitefly Singhiella simplex (Singh, 1931) (Hemiptera: Aleyrodidae): A new exotic whitefly found on urban Ficus species in Tunisia. Orient. Insects 2022, 56, 584–592. [Google Scholar] [CrossRef]
  14. Longo, S.; Rapisarda, C.; Siscaro, G. La mosca bianca dei Ficus, Singhiella simplex, nuovamente alla ribalta. Georgofili. Info. 2019. Available online: https://www.georgofili.info/contenuti/la-moscabianca-dei-ficus-singhiella-simplex-nuovamente-alla-ribalta/13601 (accessed on 5 December 2024).
  15. Laudani, F.; Giunti, G.; Zimbalatti, G.; Campolo, O.; Palmeri, V. Singhiella simplex (Singh) (Hemiptera: Aleyrodidae), a new aleyrodid species for Italy causing damage on Ficus. EPPO Bull. 2020, 50, 268–270. [Google Scholar] [CrossRef]
  16. Fois, F.; Lallai, A.; Foddi, F.; Nannini, M. Prima segnalazione per la Sardegna di Singhiella simplex (Singh, 1931) (Hemiptera: Aleyrodidae) reperita su Ficus benjamina L. e Ficus microcarpa L.f. (Moraceae) [First report of Singhiella simplex (Singh, 1931) (Hemiptera: Aleyrodidae) from Sardinia, on Ficus benjamina L. and Ficus microcarpa L.f. (Moraceae)]. Mediterr. Online/Nat. 2020, 35, 35–39. (In Italian) [Google Scholar]
  17. Zugno, M.; Tapparo, A.; Colombini, M.; Galimberti, G.; Sacchi, S.; Siena, F.; Cavagna, B.; Ciampitti, M.; Giordano, L. First report of the ficus whitefly Singhiella simplex (Singh, 1931) (Hemiptera: Aleyrodidae) in Northern Italy and first observation of its association with the parasitoid wasp Encarsia hispida De Santis, 1948 (Hymenoptera: Aphelinidae) in Europe. EPPO Bull. 2024, 54, 182–188. [Google Scholar] [CrossRef]
  18. Šimala, M.; Pintar, M.; Milek, T.M. First records of new insect pests in Croatia between two Slovenian conferences on plant protection (2019–2022). In Proceedings of the Zbornik Predavanj in Referatov 15. Slovenskega Posvetovanja o Varstvu Rastlin z Mednarodno Udeležbo, Portorož, Slovenia, 1–2 March 2022. [Google Scholar]
  19. Kondo, T.; Evans, G. Singhiella simplex (Singh) (Hemiptera: Aleyrodidae), a new aleyrodid invasive species for Colombia. Bol. Mus. Entomol. Univ. Val. 2012, 13, 31–34. [Google Scholar]
  20. Torres-Barragán, A.; Anaya, A.L.; Alatorre, R.; Toriello, C. Entomopathogenic fungi from ‘El Eden’ Ecological Reserve, Quintana Roo, Mexico. Mycopathologia 2004, 158, 61–71. [Google Scholar] [CrossRef]
  21. Mannion, C. Ficus Whitefly, Management in the Landscape. UF/IFAS Extension. Available online: https://cisr.ucr.edu/sites/default/files/2019-07/ficus_whitefly_feb2010_fact_sheet.pdf (accessed on 20 August 2024).
  22. Avery, P.B.; Mannion, C.M.; Powell, C.A.; McKenzie, C.L.; Osborne, L.S. Natural enemies managing the invasion of the fig whitefly, Singhiella simplex (Hemiptera: Aleyrodidae), infesting a Ficus benjamina hedge. Fla. Entomol. 2011, 94, 696–698. [Google Scholar] [CrossRef]
  23. Elliot, S.; Sabelis, M.; Janssen, A.; Der Geest, V.; Beerling, E.; Fransen, J. Can plants use entomopathogens as bodyguards? Ecol. Lett. 2000, 3, 228–235. [Google Scholar] [CrossRef]
  24. Yükselbaba, U. Survey of the Ficus whitefly, Singhiella simplex (Hemiptera: Aleyrodidae), and its natural enemies in the Western Mediterranean Region of Turkey. Fla. Entomol. 2023, 106, 22–28. [Google Scholar] [CrossRef]
  25. van Roermund, H.J.W.; van Lenteren, J.C. The parasite-host relationship between Encarsia formosa (Hymenoptera: Aphelinidae) and Trialeurodes vaporariorum (Homoptera: Aleyrodidae) XXXV. Life-history parameters of the greenhouse whitefly parasitoid Encarsia formosa as a function of host stage and temperature. Wagening. Agric. Univ. Pap. 1992, 92–93, 1–147. [Google Scholar]
  26. Melone, G.; Ascolese, R.; Nugnes, F.; Porcelli, F.; Rapisarda, C.; Farina, A.; Picciotti, U.; Garganese, F.; Laudonia, S. An Eretmocerus species, parasitoid of Aleurocanthus spiniferus, was found in Europe: The secret savior of threatened plants. Sustainability 2024, 16, 2970. [Google Scholar] [CrossRef]
  27. Myartseva, N.S.; González-Julián, P.; Ruíz-Cancino, E.; Coronado-Blanco, C.M.J.; Muñoz-Viveros, L.A. Parasitoides de la mosquita blanca Singhiella simplex (Singh, 1931) en México (Hymenoptera: Chalcidoidea: Aphelinidae). [Parasitoids of ficus whitefly Singhiella simplex (Singh, 1931) in Mexico]. Entomol. Mex. 2014, 1, 1113–1117. (In Spanish) [Google Scholar]
  28. Ahmed, M.Z.; Hernandez, Y.; Francis, A.; Evans, G.; Rohrig, E.; Osborne, L.; Mannion, C. Balios eulophid Baeoentendon balios Wang, Huang & Polaszek (Insecta: Hymenoptera: Eulophidae). In Featured Creatures, EDIS-IFAS EENY-676; University of Florida: Gainesville, FL, USA, 2017. [Google Scholar]
  29. Sánchez-Flores, O.A.; Coronado-Blanco, J.M. Parasitoide de Singhiella simplex (Singh, 1931) (Hemiptera: Aleyrodidae) en Tamaulipas, México. Boletín Soc. Mex. Entomol. 2020, 6, 9–14. [Google Scholar]
  30. Hodges, G. The Fig Whitefly Singhiella simplex (Singh) (Hemiptera: Aleyrodidae): A New Exotic Whitefly Found on Ficus Species in South Florida. Pest Alert DPI-FDACS. 2007. Available online: http://www.freshfromflorida.com/pi/enpp/ento/Singhiella%20simplex.html (accessed on 21 September 2024).
  31. Lahey, Z.J.; Polaszek, A. Baeoentedon balios (Hymenoptera: Eulophidae): A parasitoid of ficus whitefly, Singhiella simplex (Singh) (Hemiptera: Aleyrodidae), new to the United States. Int. J. Pest Manag. 2017, 63, 349–351. [Google Scholar] [CrossRef]
  32. Hadley, A.; Combine, Z.P. 2011. Available online: https://combinezp.software.informer.com/ (accessed on 10 May 2019).
  33. Martin, J.H. The whitefly fauna of Australia (Sternorrhyncha: Aleyrodidae), a taxonomic account and identification guide. Tech. Pap. CSIRO Entomol. 1999, 38, 1–197. [Google Scholar]
  34. Pizza, M.; Porcelli, F. Sull’allestimento di preparati microscopici di pupari di Aleirodidi (Homoptera). Boll. Soc. Entomol. Ital. 1993, 125, 3–5. [Google Scholar]
  35. Noyes, J.S. Collecting and preserving chalcid wasps (Hymenoptera: Chalcidoidea). J. Nat. Hist. 1982, 16, 315–334. [Google Scholar] [CrossRef]
  36. Polaszek, A.; Ayshford, T.; Yahya, B.E.; Fusu, L. Wallaceaphytis: An unusual new genus of parasitoid wasp (Hymenoptera: Aphelinidae) from Borneo. J. Nat. Hist. 2014, 48, 1111–1123. [Google Scholar] [CrossRef]
  37. Jensen, A.S. A cladistic analysis of Dialeurodes, Massilieurodes, and Singhiella, with notes and keys to the Nearctic species and descriptions of four new Massilieurodes species (Hemiptera: Aleyrodidae). Syst. Entomol. 2001, 26, 279–310. [Google Scholar] [CrossRef]
  38. Suh, S.; Evans, G.A.; Oh, S. A checklist of intercepted whiteflies (Hemiptera: Aleyrodidae) at the Republic of Korea ports of entry. J. Asia-Pac. Entomol. 2008, 11, 37–43. [Google Scholar] [CrossRef]
  39. Viggiani, G. Notes on a few Aphelinidae, with description of five new species of Encarsia Foerster (Hymenoptera: Chalcidoidea). Boll. Lab. Entomol. Agrar. Filippo Silvestri 1985, 42, 81–94. [Google Scholar]
  40. Heraty, J.M.; Polaszek, A. Morphometric analysis and descriptions of selected species in the Encarsia strenua group (Hymenoptera: Aphelinidae). J. Hymenopt. Res. 2000, 9, 142–169. [Google Scholar]
  41. Polaszek, A.; Manzari, S.; Quicke, D.L.J. Morphological and molecular taxonomic analysis of the Encarsia meritoria species-complex (Hymenoptera, Aphelinidae), parasitoids of whiteflies (Hemiptera, Aleyrodidae) of economic importance. Zool. Scr. 2004, 33, 403–421. [Google Scholar] [CrossRef]
  42. Campbell, B.; Heraty, J.; Rasplus, J.Y.; Chan, K.; Steffen-Campbell, J.; Babcock, C. Molecular systematics of the Chalcidoidea using 28S-D2 rDNA. In Hymenoptera Evolution, Biodiversity and Biological Control; CSIRO Publishing: Collingwood, Australia, 2000; pp. 59–73. [Google Scholar]
  43. Monti, M.M.; Nappo, A.G.; Giorgini, M. Molecular characterization of closely related species in the parasitic genus Encarsia (Hymenoptera: Aphelinidae) based on the mitochondrial cytochrome oxidase subunit I gene. Bull. Entomol. Res. 2005, 95, 401–408. [Google Scholar] [CrossRef]
  44. Gebiola, M.; Monti, M.M.; Johnson, R.C.; Woolley, J.B.; Hunter, M.S.; Giorgini, M.; Pedata, P.A. A revision of the Encarsia pergandiella species complex (Hymenoptera: Aphelinidae) shows cryptic diversity in parasitoids of whitefly pests. Syst. Entomol. 2017, 42, 31–59. [Google Scholar] [CrossRef]
  45. Gebiola, M.; Bernardo, U.; Monti, M.M.; Navone, P.; Viggiani, G. Pnigalio agraules (Walker) and Pnigalio mediterraneus Ferrière and Delucchi (Hymenoptera: Eulophidae): Two closely related valid species. J. Nat. Hist. 2009, 43, 2465–2480. [Google Scholar] [CrossRef]
  46. Simon, C.; Frati, F.; Beckenbach, A.; Crespi, B.; Liu, H.; Flook, P. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 1994, 87, 651–701. [Google Scholar] [CrossRef]
  47. Campbell, B.C.; Steffen-Campbell, J.D.; Werren, J.H. Phylogeny of the Nasonia species complex (Hymenoptera: Pteromalidae) inferred from an internal transcribed spacer (ITS2) and 28S rDNA sequences. Insect Mol. Biol. 1994, 2, 225–237. [Google Scholar] [CrossRef]
  48. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  49. Universal Chalcidoidea Database (UCD) Curated in TaxonWorks. Available online: https://sfg.taxonworks.org (accessed on 20 September 2024).
  50. Polaszek, A.; Abd-Rabou, S.; Huang, J. The Egyptian species of Encarsia (Hymenoptera: Aphelinidae): A preliminary review. Zool. Meded. 1999, 73, 131–163. [Google Scholar]
  51. Shih, Y.T.; Ko, C.C.; Polaszek, A. Encarsia (Hymenoptera: Aphelinidae) parasitoids of Bemisia species in Taiwan (Hemiptera: Aleyrodidae). J. Nat. Hist. 2008, 42, 2923–2941. [Google Scholar] [CrossRef]
  52. Nguyen, R.; Hamon, A.B. Dialeurodes kirkaldyi (Kotinsky), in Florida (Homoptera: Aleyrodidae: Aleyrodinae). Entomol. Circ. 1989, 323, 2. [Google Scholar]
  53. Schmidt, S.; Naumann, I.D.; De Barro, P.J. Encarsia species (Hymenoptera: Aphelinidae) of Australia and the Pacific Islands attacking Bemisia tabaci and Trialeurodes vaporariorum (Hemiptera: Aleyrodidae)—A pictorial key and descriptions of four new species. Bull. Entomol. Res. 2001, 91, 369–387. [Google Scholar] [CrossRef]
  54. Abd-Rabou, S. Revision of Aphelinidae (Hymenoptera) from Egypt. In Proceedings of the Second International Conference of Plant Protection Research Institute; Dokki: Giza, Egypt, 2002; Volume 1, p. 281. [Google Scholar]
  55. Giorgini, M. Induction of males in thelytokous populations of Encarsia meritoria and Encarsia protransvena: A systematic tool. BioControl 2001, 46, 427–438. [Google Scholar] [CrossRef]
  56. Viggiani, G. Host-range increase and phenology of Encarsia meritoria Gahan in Europe (Hymenoptera: Aphelinidae). In Parasitic Wasps: Evolution, Systematics, Biodiversity and Biological Control, Proceedings of the International Symposium: “Parasitic Hymenoptera: Taxonomy and Biological Control”, Köszeg, Hungary, 14–17 May 2001; Melika, G., Thuróczy, C., Eds.; 2002; pp. 335–339. Available online: https://iris.cnr.it/handle/20.500.14243/103624 (accessed on 21 September 2024).
  57. Myartseva, S.N.; Evans, G.A. Genus Encarsia Förster of Mexico (Hymenoptera: Chalcidoidea: Aphelinidae). A revision, key and description of new species. Ser. Avis. Parasit. Plagas Otros Insectos 2008, 3, 1–320. [Google Scholar]
  58. Abd-Rabou, S.; Ghahari, H. A revision of Encarsia (Hymenoptera: Aphelinidae) species from Iran. Egypt. J. Agric. Res. 2004, 82, 647–684. [Google Scholar]
  59. Hayat, M. A revision of the species of Encarsia Foerster (Hymenoptera: Aphelinidae) from India and the adjacent countries. Orient. Insects 1989, 23, 1–131. [Google Scholar] [CrossRef]
  60. De Santis, L. Adiciones a la fauna Argentina de Afelínidos (Hymenoptera: Chalcidoidea). Notas Mus. Plata Buenos Aires 1948, 13, 45. [Google Scholar]
  61. Babcock, C.S.; Heraty, J.M.; De Barro, P.J.; Driver, F.; Schmidt, S. Preliminary phylogeny of Encarsia Förster (Hymenoptera: Aphelinidae) based on morphology and 28S rDNA. Mol. Phylogenet. Evol. 2001, 18, 306–323. [Google Scholar] [CrossRef]
  62. Heraty, J.M.; Polaszek, A.; Schauff, M.E. Systematics and Biology of Encarsia. In Classical Biological Control of Bemisia tabaci in the United States—A Review of Interagency Research and Implementation; Gould, J., Hoelmer, K., Goolsby, J., Eds.; Progress in Biological Control; Springer: Dordrecht, The Netherlands, 2008; Volume 4. [Google Scholar] [CrossRef]
  63. Viggiani, G. Notes on some Nearctic and Neotropical Encarsia Förster (Hymenoptera: Aphelinidae). Boll. Lab. Entomol. Agrar. Filippo Silvestri Portici 1989, 46, 207–221. [Google Scholar]
  64. Polaszek, A.; Evans, G.A.; Bennett, F.D. Encarsia parasitoids of Bemisia tabaci (Hymenoptera: Aphelinidae, Homoptera: Aleyrodidae): A preliminary guide to identification. Bull. Entomol. Res. 1992, 82, 375–392. [Google Scholar] [CrossRef]
  65. Dozier, H.L. Two undescribed chalcid parasites of the woolly whitefly, Aleurothrixus floccosus (Maskell) from Haiti. Proc. Entomol. Soc. Wash. 1932, 34, 118–122. [Google Scholar]
  66. Giorgini, M.; Monti, M.M.; Caprio, E.; Stouthamer, R.; Hunter, M.S. Feminization and the collapse of haplodiploidy in an asexual parasitoid wasp harboring the bacterial symbiont Cardinium. Heredity 2009, 102, 365–371. [Google Scholar] [CrossRef]
  67. Hernández-Suárez, E.; Carnero, A.; Aguiar, A.; Prinsloo, G.; LaSalle, J.; Polaszek, A. Parasitoids of whiteflies (Hymenoptera: Aphelinidae, Eulophidae, Platygastridae; Hemiptera: Aleyrodidae) from the Macaronesian archipelagos of the Canary Islands, Madeira, and the Azores. Syst. Biodivers. 2003, 1, 55–108. [Google Scholar] [CrossRef]
  68. Andreason, S.A.; Triapitsyn, S.V.; Perring, T.M. Untangling the Anagyrus pseudococci species complex (Hymenoptera: Encyrtidae), parasitoids of worldwide importance for biological control of mealybugs (Hemiptera: Pseudococcidae): Genetic data corroborates separation of two new, previously misidentified species. Biol. Control 2019, 129, 65–82. [Google Scholar]
  69. Miller, K.E.; Polaszek, A.; Evans, D.M. A dearth of data: Fitting parasitoids into ecological networks. Trends Parasitol. 2021, 37, 863–874. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Singhiella simplex: (A) slide-mounted adult female, arrows show eggs retained in the abdomen; (BF) whitefly eggs.
Figure 1. Singhiella simplex: (A) slide-mounted adult female, arrows show eggs retained in the abdomen; (BF) whitefly eggs.
Insects 16 00040 g001
Figure 2. Immature stages of Singhiella simplex: (A) whitefly first instar; (BE) second to fourth instar; (FI) prepupa and pupa.
Figure 2. Immature stages of Singhiella simplex: (A) whitefly first instar; (BE) second to fourth instar; (FI) prepupa and pupa.
Insects 16 00040 g002
Figure 3. Singhiella simplex: (A,B) emerging adults; (C) exuvia (pupal case); (DG) adults in dorsal, lateral and ventral view (scale bar: 300 µm, except in (D)).
Figure 3. Singhiella simplex: (A,B) emerging adults; (C) exuvia (pupal case); (DG) adults in dorsal, lateral and ventral view (scale bar: 300 µm, except in (D)).
Insects 16 00040 g003
Figure 4. Singhiella simplex, microscope slide mounted: (A) first instar; (B,C) pupal case and enlargement shows vasiform orifice and caudal furrow; (D) antenna of male; (E) antenna of female; (F) needle-like mouthparts; (G) genital capsule, claspers and aedeagus of the male; (H) female genitalia (scale bar: 50 µm, except in (B)).
Figure 4. Singhiella simplex, microscope slide mounted: (A) first instar; (B,C) pupal case and enlargement shows vasiform orifice and caudal furrow; (D) antenna of male; (E) antenna of female; (F) needle-like mouthparts; (G) genital capsule, claspers and aedeagus of the male; (H) female genitalia (scale bar: 50 µm, except in (B)).
Insects 16 00040 g004
Figure 5. Encarsia protransvena: (AC) larvae; (D) pupa; (E), pupa ready to emerge; (F,G) dissection showing the emerging adult and pupal remains; (H,I) puparia cases of S. simplex with E. protransvena emerging hole; (J) meconium of E. protransvena (scale bar: 300 µm, except in (J)).
Figure 5. Encarsia protransvena: (AC) larvae; (D) pupa; (E), pupa ready to emerge; (F,G) dissection showing the emerging adult and pupal remains; (H,I) puparia cases of S. simplex with E. protransvena emerging hole; (J) meconium of E. protransvena (scale bar: 300 µm, except in (J)).
Insects 16 00040 g005
Figure 6. Encarsia protransvena: (A) forewing and hindwing, the black arrow indicating the presence of two large setae on the submarginal vein and the white arrow a bare area just above the stigmal vein; (B) scutellar sensillae (black arrows) closely placed or touching, ovoid and separated by less than their maximum diameter, rarely by a full diameter (left-right black arrow indicates the distance between the sensilla).
Figure 6. Encarsia protransvena: (A) forewing and hindwing, the black arrow indicating the presence of two large setae on the submarginal vein and the white arrow a bare area just above the stigmal vein; (B) scutellar sensillae (black arrows) closely placed or touching, ovoid and separated by less than their maximum diameter, rarely by a full diameter (left-right black arrow indicates the distance between the sensilla).
Insects 16 00040 g006
Figure 7. Encarsia protransvena: (A) body, dorsal view, mid-lobe of mesosoma with 4 pairs of setae, preapical pair not reaching the base of apical pair; (B) head, ventrolateral view; (C) body, lateral view; (D) stemmaticum, reticulate; (E) apex of middle tibia and tarsus.
Figure 7. Encarsia protransvena: (A) body, dorsal view, mid-lobe of mesosoma with 4 pairs of setae, preapical pair not reaching the base of apical pair; (B) head, ventrolateral view; (C) body, lateral view; (D) stemmaticum, reticulate; (E) apex of middle tibia and tarsus.
Insects 16 00040 g007
Figure 8. Encarsia protransvena: (A) ovipositor slender and with straight tip; (B) body, ventral view, the arrows indicate ovipositor, antennal clava and middle tibia length; (C) seventh metasomal tergum (Mt7) with 6 setae, 4 long setae medial to cerci; (D) basal seta (BS) of third valvula (TVL) not reaching base of subapical seta (SB); subapical seta located beyond halfway (0.65) between basal seta of third valvula and apex.
Figure 8. Encarsia protransvena: (A) ovipositor slender and with straight tip; (B) body, ventral view, the arrows indicate ovipositor, antennal clava and middle tibia length; (C) seventh metasomal tergum (Mt7) with 6 setae, 4 long setae medial to cerci; (D) basal seta (BS) of third valvula (TVL) not reaching base of subapical seta (SB); subapical seta located beyond halfway (0.65) between basal seta of third valvula and apex.
Insects 16 00040 g008
Figure 9. Encarsia hispida (AF) and Encarsia protransvena (G): (A) adult female, dorsal view; (B) ovipositor, middle and hind tibia; (C) antenna; (D) forewing, the black arrow indicates the absence of a bare area around the stigmal vein; (E) apex of middle tibia, showing mid tarsus segments and the spur-to-basitarsus relative length; (F) pupa of E. hispida and (G) pupa of E. protransvena.
Figure 9. Encarsia hispida (AF) and Encarsia protransvena (G): (A) adult female, dorsal view; (B) ovipositor, middle and hind tibia; (C) antenna; (D) forewing, the black arrow indicates the absence of a bare area around the stigmal vein; (E) apex of middle tibia, showing mid tarsus segments and the spur-to-basitarsus relative length; (F) pupa of E. hispida and (G) pupa of E. protransvena.
Insects 16 00040 g009
Table 1. Sampling sites, coordinates, host plants, and dates of Singhiella simplex, Encarsia hispida and Encarsia protransvena monitoring activities in central and south Italy.
Table 1. Sampling sites, coordinates, host plants, and dates of Singhiella simplex, Encarsia hispida and Encarsia protransvena monitoring activities in central and south Italy.
Sampling Sites (Province)CoordinatesHost PlantDate
Palermo (PA)38°06′20″ N; 13°20′57″ EF. microcarpa9.II.2024
16.II.2024
Catania (CT)37°31′09″ N; 15°06′19″ EF. microcarpa6.X.2024
Acicastello (CT)37°33′28″ N; 15°09′01″ EF. microcarpa12.X.2024
Acireale (CT)37°37′44″ N; 15°09′33″ EF. microcarpa7.X.2024
Reggio Calabria (RC)38°07′21″ N; 15°39′32″ E
38°07′13″ N; 15°39′29″ E
38°07′32″ N; 15°39′17″ E
F. microcarpa7.X.2024
Santa Maria Capua Vetere (CE)41°05′01″ N; 14°15′56″ E
41°04′42″ N; 14°15′42″ E
F. microcarpa
F. benjamina
30.IX.2024
30.IX.2024
Salerno (SA)40°40′38″ N; 14°45′53″ E
40°40′12″ N; 14°47′15″ E
40°38′33″ N; 14°51′26″ E
F. benjamina25.X.2024
18.X.2024
8.XI.2024
Naples (NA)40°51′35″ N; 14°16′14″ EF. benjamina27.XI.2024
Formia (LT)41°15′48″ N; 13°37′33″ EF. benjamina5.X.2024
Bari (BA)41°05′46″ N; 16°53′20″ E
41°06′31″ N; 16°52′23″ E
F. microcarpa6.III.2024; 5.VI.2024; 15.VIII.2024; 17.IX.2024; 14.X.2024; 21–22.XI.2024
(in both sites, only S. simplex)
Table 2. Primers used for PCR analysis targeting the DNA barcoding regions of Encarsia protransvena and Encarsia hispida for molecular identification.
Table 2. Primers used for PCR analysis targeting the DNA barcoding regions of Encarsia protransvena and Encarsia hispida for molecular identification.
NameNucleotide Sequence (5′-3′)Melt. Temp. (°C)Target Gene
C1-J-2183
C1-J-2195
TL2-N-3014
CAACATTTATTTTGATTTTTTGG
TTGATTTTTTGGTCATCCAGAAGT
TCCAATGCACTAATCTGCCATATTA
55
55
63
COI
D2F
D2R
AGTCGTGTTGCTTGATAGTGCAG
TTGGTCCGTGTTTCAAGACGGG
57
62
28S-D2
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cerasa, G.; Tomasello, L.; Melone, G.; Russo, E.; Siscaro, G.; Cavallaro, C.; Ienco, A.; Laudani, F.; Palmeri, V.; Campolo, O.; et al. New Record of Encarsia protransvena and Confirmed Occurrence of Encarsia hispida (Hymenoptera: Aphelinidae) as Parasitoids of Singhiella simplex (Hemiptera: Aleyrodidae) in Italy. Insects 2025, 16, 40. https://doi.org/10.3390/insects16010040

AMA Style

Cerasa G, Tomasello L, Melone G, Russo E, Siscaro G, Cavallaro C, Ienco A, Laudani F, Palmeri V, Campolo O, et al. New Record of Encarsia protransvena and Confirmed Occurrence of Encarsia hispida (Hymenoptera: Aphelinidae) as Parasitoids of Singhiella simplex (Hemiptera: Aleyrodidae) in Italy. Insects. 2025; 16(1):40. https://doi.org/10.3390/insects16010040

Chicago/Turabian Style

Cerasa, Giuliano, Luigi Tomasello, Gianluca Melone, Elia Russo, Gaetano Siscaro, Carmelo Cavallaro, Annamaria Ienco, Francesca Laudani, Vincenzo Palmeri, Orlando Campolo, and et al. 2025. "New Record of Encarsia protransvena and Confirmed Occurrence of Encarsia hispida (Hymenoptera: Aphelinidae) as Parasitoids of Singhiella simplex (Hemiptera: Aleyrodidae) in Italy" Insects 16, no. 1: 40. https://doi.org/10.3390/insects16010040

APA Style

Cerasa, G., Tomasello, L., Melone, G., Russo, E., Siscaro, G., Cavallaro, C., Ienco, A., Laudani, F., Palmeri, V., Campolo, O., Garganese, F., Porcelli, F., Pedata, P. A., Farina, V., Gugliuzza, G., Rizzo, R., Laudonia, S., & Lo Verde, G. (2025). New Record of Encarsia protransvena and Confirmed Occurrence of Encarsia hispida (Hymenoptera: Aphelinidae) as Parasitoids of Singhiella simplex (Hemiptera: Aleyrodidae) in Italy. Insects, 16(1), 40. https://doi.org/10.3390/insects16010040

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop