Divergence in the Morphology and Energy Metabolism of Adult Polyphenism in the Cowpea Beetle Callosobruchus maculatus
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Rearing
2.2. Wing Measurement
2.3. Three-Dimensional (3D) Reconstruction
2.4. Transcriptome Sequencing
2.5. Quantitative Real-Time PCR (qPCR)
2.6. Energy Metabolism Substance Measurement
2.7. External Morphology of Reproductive Organs
2.8. Egg-Laying Assay
2.9. Statistical Analysis
3. Results
3.1. External Morphology of Flight Form and Normal Form
3.2. Internal Muscles of Flight Form and Normal Form
3.3. Identification of Differential Gene Expression
3.4. The Flight Form Maintains Higher Energy Metabolism
3.5. Abnormal Fecundity of the Flight Form
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pener, M.P.; Simpson, S.J. Locust phase polyphenism: An update. Adv. Insect Phys. 2009, 36, 1–272. [Google Scholar]
- Ding, D.; Liu, G.; Hou, L.; Gui, W.; Chen, B.; Kang, L. Genetic variation in PTPN1 contributes to metabolic adaptation to high-altitude hypoxia in Tibetan migratory locusts. Nat. Commun. 2018, 9, 4991. [Google Scholar] [CrossRef] [PubMed]
- Du, B.; Ding, D.; Ma, C.; Guo, W.; Kang, L. Locust density shapes energy metabolism and oxidative stress resulting in divergence of flight traits. Proc. Natl. Acad. Sci. USA 2022, 119, e2115753118. [Google Scholar] [CrossRef]
- Simpson, S.J.; Sword, G.A.; Lo, N. Polyphenism in insects. Curr. Biol. 2011, 21, 738–749. [Google Scholar] [CrossRef]
- Braendle, C.; Davis, G.K.; Brisson, J.A.; Stern, D.L. Wing dimorphism in aphids. Heredity 2006, 97, 192–199. [Google Scholar] [CrossRef] [PubMed]
- Campbell, A.; Mackauer, M. Reproduction and population growth of the pea aphid (Homoptera: Aphididae) under laboratory and field conditions. Can. Entomol. 1977, 109, 277–284. [Google Scholar] [CrossRef]
- Wratten, S.D. Reproductive strategy of winged and wingless morphs of the aphids Sitobion avenae and Metopolophium dirhodum. Ann. Appl. Biol. 2010, 85, 319–331. [Google Scholar] [CrossRef] [PubMed]
- Pang, Y.; Zeng, Y.; Zhu, D.H. Flight and flight energy accumulation related to the daily rhythm of juvenile hormone titer in the wing-dimorphic cricket Velarifictorus aspersus. Entomol. Exp. Appl. 2023, 171, 878–886. [Google Scholar] [CrossRef]
- Zeng, Y.; Zhu, D.H. Analysis of the classical model of juvenile hormone control of wing polymorphism in the cricket Velarifictorus aspersus (Orthoptera: Gryllidae). Ann. Entomol. Soc. Am. 2015, 108, 1053–1059. [Google Scholar] [CrossRef]
- Zhao, L.Q.; Zhu, D.H.; Zeng, Y. Physiological trade-offs between flight muscle and reproductive development in the wing-dimorphic cricket Velarifictorus ornatus. Entomol. Exp. Appl. 2010, 135, 288–294. [Google Scholar] [CrossRef]
- Tanaka, S. Allocation of resources to egg production and flight muscle development in a wing dimorphic cricket, Modicogryllus confirmatus. J. Insect Physiol. 1993, 39, 493–498. [Google Scholar] [CrossRef]
- Utida, S. “Phase” dimorphism observed in the laboratory population of the cowpea weevil, Callosobruchus quadrimaculatus 2nd report. Popul. Ecol. 1956, 3, 93–104. [Google Scholar] [CrossRef]
- Ouedraogo, P.A.; Monge, J.P.; Huignard, J. Importance of temperature and seed water content on the induction of imaginal polymorphism in Callosobruchus maculatus. Entomol. Exp. Appl. 2011, 59, 59–66. [Google Scholar] [CrossRef]
- Zannou, E.T.; Glitho, I.A.; Huignard, J.; Monge, J.P. Life history of flight morph females of Callosobruchus maculatus F.: Evidence of a reproductive diapause. J. Insect Physiol. 2003, 49, 575–582. [Google Scholar] [CrossRef]
- Pajni, H.R.; Airi, M. Phenotypic plasticity in Callosobruchus maculatus (Fab.)—A critical review (Bruchidae: Coleoptera). J. Entomol. Zool. Stud. 2017, 5, 163–168. [Google Scholar]
- Messina, F.J.; Renwick, J.A.A. Mechanism of egg recognition by the cowpea weevil Callosobruchus maculatus. Entomol. Exp. Appl. 1985, 37, 241–245. [Google Scholar] [CrossRef]
- Wu, F.M.; Du, Z.; Zhang, T.H.; Jiang, L.; Zhang, L.J.; Ge, S.Q. A neurotransmitter histamine mediating phototransduction and photopreference in Callosobruchus maculatus. Pest. Manag. Sci. 2023, 79, 3002–3011. [Google Scholar] [CrossRef]
- Kalpna; Hajam, Y.A.; Kumar, R. Management of stored grain pest with special reference to Callosobruchus maculatus, a major pest of cowpea: A review. Heliyon 2022, 8, e08703. [Google Scholar] [CrossRef]
- Naseri, B.; Ebadollahi, A.; Hamzavi, F. Oviposition preference and life-history parameters of Callosobruchus maculatus (Coleoptera: Chrysomelidae) on different soybean (Glycine max) cultivars. Pest. Manag. Sci. 2022, 78, 4882–4891. [Google Scholar] [CrossRef]
- Pumnuan, J.; Sarapothong, K.; Sikhao, P.; Pattamadilok, C.; Insung, A. Film seeds coating with hexane extracts from Illicium verum Hook.f. and Syzygium aromaticum (L.) Merrill & Perry for controlling Callosobruchus maculatus (F.) and Callosobruchus chinensis L. Pest. Manag. Sci. 2021, 77, 2512–2521. [Google Scholar] [PubMed]
- Lu, H.R.; Mao, C.Y.; Zhang, L.J.; He, J.W.; Wang, X.S.; Zhang, X.Y.; Fan, W.L.; Huang, Z.Z.; Zong, L.; Cui, C.H.; et al. High-quality reference genome of cowpea beetle Callosobruchus maculatus. Sci. Data 2024, 11, 799. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Palanker, L.; Tennessen, J.M.; Lam, G.; Thummel, C.S. Drosophila HNF4 regulates lipid mobilization and beta-oxidation. Cell Metab. 2009, 9, 228–239. [Google Scholar] [CrossRef]
- Sieber, M.H.; Thummel, C.S. The DHR96 nuclear receptor controls triacylglycerol homeostasis in Drosophila. Cell Metab. 2009, 10, 481–490. [Google Scholar] [CrossRef]
- Friedrich, F.; Beutel, R.G. The thorax of Zorotypus (Hexapoda, Zoraptera) and a new nomenclature for the musculature of Neoptera. Arthropod Struct. Dev. 2008, 37, 29–54. [Google Scholar] [CrossRef] [PubMed]
- Gáliková, M.; Klepsatel, P. Endocrine control of glycogen and triacylglycerol breakdown in the fly model. Semin. Cell Dev. Biol. 2023, 138, 104–116. [Google Scholar] [CrossRef]
- Cao, H.; Wang, X.; Wang, J.; Lu, Z.; Liu, T. Wing plasticity is associated with growth and energy metabolism in two color morphs of the Pea Aphid. Insects 2024, 15, 279. [Google Scholar] [CrossRef] [PubMed]
- Ding, B.Y.; Niu, J.; Shang, F.; Yang, L.; Zhang, W.; Smagghe, G.; Wang, J.J. Parental silencing of a horizontally transferred carotenoid desaturase gene causes a reduction of red pigment and fitness in the pea aphid. Pest. Manag. Sci. 2020, 76, 2423–2433. [Google Scholar] [CrossRef] [PubMed]
- Schuett, W.; Dall, S.R.; Kloesener, M.H.; Baeumer, J.; Beinlich, F.; Eggers, T. Life-history trade-offs mediate ’personality’ variation in two colour morphs of the pea aphid, Acyrthosiphon pisum. J. Anim. Ecol. 2015, 84, 90–101. [Google Scholar] [CrossRef] [PubMed]
- Utida, S. Density dependent polymorphism in the adult of Callosobruchus maculatus (Coleoptera, Bruchidae). J. Stored Prod. Res. 1972, 8, 111–125. [Google Scholar] [CrossRef]
- Wipfler, B.; Klug, R.; Ge, S.Q.; Bai, M.; Göbbels, J.; Yang, X.K.; Hörnschemeyer, T. The thorax of Mantophasmatodea, the morphology of flightlessness, and the evolution of the neopteran insects. Cladistics 2014, 31, 50–70. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.P.; Wipfler, B.; Niitsu, S.; Beutel, R.G. The thoracic anatomy of the male and female winter moth Nyssiodes lefuarius (Lepidoptera: Geometridae) and evolutionary changes in the thorax of moths and butterflies. Org. Divers. Evol. 2017, 17, 565–594. [Google Scholar] [CrossRef]
- Zhang, Z.Y.; Ren, J.; Chu, F.; Guan, J.X.; Yang, G.Y.; Liu, Y.T.; Zhang, X.Y.; Ge, S.Q.; Huang, Q.Y. Biochemical, molecular, and morphological variations of flight muscles before and after dispersal flight in a eusocial termite, Reticulitermes chinensis. Insect Sci. 2020, 28, 77–92. [Google Scholar] [CrossRef]
- Rankin, M.A.; Burchsted, J.C.A. The cost of migration in insects. Annu. Rev. Entomol. 1992, 37, 533–559. [Google Scholar] [CrossRef]
- Martin, M.M.; Lieb, T.J. Patterns of fuel utilization by the thoracic muscles of adult worker ants. The use of lipid by a hymenopteran. Comp. Biochem. Physiol. B 1979, 64, 387–390. [Google Scholar] [CrossRef]
- Suarez, R.K.; Darveau, C.A.; Welch, K.C.; O’Brien, D.M.; Roubik, D.W.; Hochachka, P.W. Energy metabolism in orchid bee flight muscles: Carbohydrate fuels all. J. Exp. Biol. 2005, 208, 3573–3579. [Google Scholar] [CrossRef] [PubMed]
- Harrison, J.F.; Fewell, J.H. Environmental and genetic influences on flight metabolic rate in the honey bee, Apis mellifera. Comp. Biochem. Physiol. A 2002, 133, 323–333. [Google Scholar] [CrossRef] [PubMed]
- Hansford, R.G.; Johnson, R.N. The nature and control of the tricarboxylate cycle in beetle flight muscle. Biochem. J. 1975, 148, 389–401. [Google Scholar] [CrossRef]
- Brown, J.J. Haemolymph protein reserves of diapausing and nondiapausing codling moth larvae, Cydia pomonella (L.) (Lepidoptera: Tortricidae). J. Insect Physiol. 1980, 26, 487–491. [Google Scholar] [CrossRef]
- Raikhel, A.S.; Dhadialla, T.S. Accumulation of yolk proteins in insect oocytes. Annu. Rev. Entomol. 1992, 37, 217–251. [Google Scholar] [CrossRef]
- Zera, A.J.; Denno, R.F. Physiology and ecology of dispersal polymorphism in insects. Annu. Rev. Entomol. 1997, 42, 207–230. [Google Scholar] [CrossRef] [PubMed]
- Guerra, P.A. Evaluating the life-history trade-off between dispersal capability and reproduction in wing dimorphic insects: A meta-analysis. Biol. Rev. Camb. Philos. Soc. 2011, 86, 813–835. [Google Scholar] [CrossRef] [PubMed]
- Nishide, Y.; Tanaka, S. The occurrence in the migratory locust, Locusta migratoria (Orthoptera: Acrididae), of a short-winged morph with no obvious fitness advantages over the long-winged morph. Eur. J. Entomol. 2013, 110, 577–583. [Google Scholar] [CrossRef]






| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| PFK | CATCCACCATCAGTAACAACG | CAGTATCCGCCCATAACTTCTA |
| ENO | ACTCAGCAGACCGAAATAGACG | GAAGGCAGGCACAGGTAGAA |
| FBP | TTTCCCGCAATGACGACT | TGTGGCTCCCTTATGCTTTT |
| PC | AGACTGAAAGCCGACGAATC | TCTGAAAGGAACCCATAGCC |
| ACO | AAATGCGTGCGGTCCAT | TCCGGTGAAGTTACGGTTGT |
| maeB | CGTGTCAGAAGTTTGGGTTG | GTCCGTCACTACGATTGCTTT |
| IDH3 | TTGTGGTTTGGTTGGTGGTG | GCCAATAACATTGCTGTAGGGT |
| ATPeF0F | GCTACTACGGAAAGGCCGATAC | ACGACTGACAGCTCCAGCGATA |
| ATPeF0O | AATGGCAGGCCGAACGATA | GCTTGGTTGCAGCAGAATACA |
| ATPeF0D | TCCTGTAGCTGGAATGGTTGA | TATGCGAGCATTAGACTCTGC |
| QCR7 | AAAAGGCACAAGATGGGTCA | CAACAGCAAGTGGTGGAACA |
| QCR8 | GCGTACAATCTTTCTGGCTTCA | CCAACTTCGTCCACTGTTCTTT |
| BTF3 | TGTCCGTCAACACGATACCC | CCATGACCAGTGATAGCGAAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Du, Z.; Liu, X.; Liu, S.; Jiang, L.; Zong, L.; Li, W.; Fan, W.; Zhang, L.; Wu, F.; Ge, S. Divergence in the Morphology and Energy Metabolism of Adult Polyphenism in the Cowpea Beetle Callosobruchus maculatus. Insects 2025, 16, 29. https://doi.org/10.3390/insects16010029
Du Z, Liu X, Liu S, Jiang L, Zong L, Li W, Fan W, Zhang L, Wu F, Ge S. Divergence in the Morphology and Energy Metabolism of Adult Polyphenism in the Cowpea Beetle Callosobruchus maculatus. Insects. 2025; 16(1):29. https://doi.org/10.3390/insects16010029
Chicago/Turabian StyleDu, Zhong, Xiaokun Liu, Sipei Liu, Lei Jiang, Le Zong, Wenjie Li, Weili Fan, Lijie Zhang, Fengming Wu, and Siqin Ge. 2025. "Divergence in the Morphology and Energy Metabolism of Adult Polyphenism in the Cowpea Beetle Callosobruchus maculatus" Insects 16, no. 1: 29. https://doi.org/10.3390/insects16010029
APA StyleDu, Z., Liu, X., Liu, S., Jiang, L., Zong, L., Li, W., Fan, W., Zhang, L., Wu, F., & Ge, S. (2025). Divergence in the Morphology and Energy Metabolism of Adult Polyphenism in the Cowpea Beetle Callosobruchus maculatus. Insects, 16(1), 29. https://doi.org/10.3390/insects16010029

