Selection and Validation of Reference Genes for Quantitative Real-Time PCR Analysis in Cockroach Parasitoid Tetrastichus hagenowii (Ratzeburg)
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Rearing and Sample Preparation
2.2. Candidate Reference Genes and Primer Design
2.3. RNA Isolation and cDNA Synthesis
2.4. Absolute Quantitative Real-Time PCR
2.5. RT-qPCR Procedure
2.6. Stability Analysis
2.7. Validation of Candidate Reference Genes across Different Developmental Stages
2.8. Statistical Analysis
3. Results
3.1. Specificity and Efficiency of Reference Gene Primers
3.2. Expression Level of Reference Genes in Larvae, Pupae, and Adults of T. hagenowii
3.3. Comprehensive Ranking of Candidate Reference Genes across Different Developmental Stages of T. hagenowii
3.3.1. Delta Ct Method
3.3.2. BestKeeper Method
3.3.3. NormFinder Method
3.3.4. geNorm Method
3.3.5. RefFinder Method
3.4. Optimal Reference Gene across Different Developmental Stages
3.5. Validation of Candidate Reference Genes across Different Developmental Stages
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pan, X.Y.; Zhang, F. Advances in biological control of the German cockroach, Blattella germanica (L.). Biol. Control 2020, 142, 104104. [Google Scholar] [CrossRef]
- Zha, C.; Wang, C.; Buckley, B.; Yang, I.; Wang, D.; Eiden, A.L.; Cooper, R. Pest Prevalence and Evaluation of Community-Wide Integrated Pest Management for Reducing Cockroach Infestations and Indoor Insecticide Residues. J. Econ. Entomol. 2018, 111, 795–802. [Google Scholar] [CrossRef] [PubMed]
- Patterson, R.S.; Hagenbuch, B.E.; Koehler, P.G.; Brenner, R.J. Efficiency of Tetrastichus hagenowii (Hymenoptera: Eulophidae) to control the American Cockroach, Periplaneta americana (Orthoptera: Blattellidae). In Advances in Parasitic Hymenoptera Research, Proceedings of the II Conference on the Taxonomy and Biology of Parasitic Hymenoptera; Gupta, V.K., Ed.; University of Florida: Gainesville, FL, USA, 1988; pp. 433–443. [Google Scholar]
- Cameron, E. On the Parasites and Predators of the Cockroach. Bull. Entomol. Res. 1955, 46, 137–147. [Google Scholar]
- Tee, H.S.; Saad, A.R.; Lee, C.Y. Evaluation of Aprostocetus hagenowii (Hymenoptera: Eulophidae) for the control of American cockroaches (Dictyoptera: Blattidae) in sewers and crevices around buildings. J. Econ. Entomol. 2011, 104, 2031–2038. [Google Scholar] [CrossRef]
- Tee, H.S.; Lee, C.Y. Water balance profiles, humidity preference and survival of two sympatric cockroach egg parasitoids Evania appendigaster and Aprostocetus hagenowii (Hymenoptera: Evaniidae; Eulophidae). J. Insect Physiol. 2015, 77, 45–54. [Google Scholar] [CrossRef]
- Peter, M. Studies on Mass Rearing and Field Release of Tetrastichus hagenowii and Evania Appendigaster for the Control of Periplaneta americana. Master’s Thesis, University of Sri Jayawardenepura, Nugegoda, Sri Lanka, 1991; 248p. [Google Scholar]
- Shen, C.H.; Peng, L.J.; Zhang, Y.X.; Zeng, H.R.; Yu, H.F.; Jin, L.; Li, G.Q. Reference Genes for Expression Analyses by qRT-PCR in Phthorimaea operculella (Lepidoptera: Gelechiidae). Insects 2022, 13, 140. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar]
- Thellin, O.; Zorzi, W.; Lakaye, B.; De Borman, B.; Coumans, B.; Hennen, G.; Grisar, T.; Igout, A.; Heinen, E. Housekeeping genes as internal standards: Use and limits. J. Biotechnol. 1999, 75, 291–295. [Google Scholar] [CrossRef]
- Tu, C.; Xu, P.; Han, R.; Luo, J.; Xu, L. Defining Suitable Reference Genes for qRT-PCR in Plagiodera versicolora (Coleoptera: Chrysomelidae) under Different Biotic or Abiotic Conditions. Agronomy 2022, 12, 1192. [Google Scholar] [CrossRef]
- Sagri, E.; Koskinioti, P.; Gregoriou, M.E.; Tsoumani, K.T.; Bassiakos, Y.C.; Mathiopoulos, K.D. Housekeeping in Tephritid insects: The best gene choice for expression analyses in the medfly and the olive fly. Sci. Rep. 2017, 7, 45634. [Google Scholar] [CrossRef]
- Kim, Y.; Kim, Y.; Kim, D.; Kim, S.; Seo, G.; Shin, S.; Lee, J.; Kim, Y.H. Validation of reference genes for quantitative real-time polymerase chain reaction in Drosophila melanogaster exposed to two chemicals. Entomol. Res. 2019, 49, 277–283. [Google Scholar] [CrossRef]
- Shu, B.; Yu, H.; Dai, J.; Xie, Z.; Qian, W.; Lin, J. Stability evaluation of reference genes for real-time quantitative PCR normalization in Spodoptera frugiperda (Lepidoptera: Noctuidae). J. Integr. Agric. 2021, 20, 2471–2482. [Google Scholar] [CrossRef]
- Li, Q.Y.; Li, Z.L.; Lu, M.X.; Cao, S.S.; Du, Y.Z. Selection of valid reference genes for quantitative real-time PCR in Cotesia chilonis (Hymenoptera: Braconidae) exposed to different temperatures. PLoS ONE 2019, 14, e0226139. [Google Scholar] [CrossRef]
- Lü, J.; Yang, C.; Zhang, Y.; Pan, H. Selection of reference genes for the normalization of RT-qPCR data in gene expression studies in insects: A systematic review. Front. Physiol. 2018, 9, 1560. [Google Scholar]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar] [CrossRef]
- Whelan, J.; Russell, N.; Whelan, M. A method for the absolute quantification of cDNA using real-time PCR. J. Immunol. Methods 2003, 278, 261–269. [Google Scholar] [PubMed]
- Jia, Q.; Yang, L.; Wen, J.; Liu, S.; Wen, D.; Luo, W.; Wang, W.; Palli, S.R.; Sheng, L. Cyp6g2 is the major P450 epoxidase responsible for juvenile hormone biosynthesis in Drosophila melanogaster. BMC Biol. 2024, 22, 111. [Google Scholar] [CrossRef]
- Wang, W.; Ling, X.; Bashir, N.H.; Lu, Q.; Zhang, J.; Li, T.; Chen, H. Selection and evaluation of reference genes for quantitative real-time PCR analysis in lac insect (Kerria lacca). Entomol. Res. 2022, 52, 57–67. [Google Scholar] [CrossRef]
- Pfaffl, W.P.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
- Xie, F.; Wang, J.; Zhang, B. RefFinder: A web-based tool for comprehensively analyzing and identifying reference genes. Funct. Integr. Genom. 2023, 23, 125. [Google Scholar] [CrossRef]
- Zhai, Y.; Lin, Q.; Zhou, X.; Zhang, X.; Liu, T.; Yu, Y. Identification and validation of reference genes for quantitative real-time PCR in Drosophila suzukii (Diptera: Drosophilidae). PLoS ONE 2014, 9, e106800. [Google Scholar] [CrossRef]
- Li, H.B.; Dai, C.G.; Zhang, C.R.; He, Y.F.; Ran, H.Y.; Chen, S.H. Screening potential reference genes for quantitative real-time PCR analysis in the oriental armyworm, Mythimna separata. PLoS ONE 2018, 13, e0195096. [Google Scholar] [CrossRef]
- Najat, D.; Karima, N.R.; Azlan, A.; Ishak, I.H.; Azzam, G. Evaluation of reference genes at different developmental stages for quantitative real-time PCR in Aedes aegypti. Sci. Rep. 2017, 7, 43618. [Google Scholar] [CrossRef]
- Yang, X.J.; Zheng, H.L.; Liu, Y.Y.; Li, H.W.; Jiang, Y.H.; Lin, L.B.; Deng, X.Y.; Zhang, Q.L. Selection of Reference Genes for Quantitative Real-Time PCR in Aquatica leii (Coleoptera: Lampyridae) Under Five Different Experimental Conditions. Front. Physiol. 2020, 11, 555233. [Google Scholar] [CrossRef]
- Zhu, X.; Yuan, M.; Shakeel, M.; Zhang, Y.; Wang, S.; Wang, X.; Zhan, S.; Kang, T.; Li, J. Selection and evaluation of reference genes for expression analysis using qRT-PCR in the beet armyworm Spodoptera exigua (Hubner) (Lepidoptera: Noctuidae). PLoS ONE 2014, 9, e84730. [Google Scholar] [CrossRef]
- Wang, L.; Yang, C.; Liu, Q.; Zhang, X.; Mei, X.; Zhang, T.; Ning, J. Validation and Evaluation of Reference Genes for Quantitative Real-Time PCR Analysis in Mythimna loreyi (Lepidoptera: Noctuidae). Insects 2024, 15, 185. [Google Scholar] [CrossRef] [PubMed]
- Omondi, B.A.; Latorre-Estivalis, J.M.; Rocha Oliveira, I.H.; Ignell, R.; Lorenzo, M.G. Evaluation of reference genes for insect olfaction studies. Parasit. Vectors 2015, 8, 243. [Google Scholar] [CrossRef]
- Shen, G.M.; Jiang, H.B.; Wang, X.N.; Wang, J.J. Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae). BMC Mol. Biol. 2010, 11, 76. [Google Scholar] [CrossRef]
- Charles, J.P. The regulation of expression of insect cuticle protein genes. Insect Biochem. Mol. Biol. 2010, 40, 205–213. [Google Scholar] [CrossRef]
- Volovych, O.; Lin, Z.; Du, J.; Jiang, H.; Zou, Z. Identification and temporal expression profiles of cuticular proteins in the endoparasitoid wasp, Microplitis mediator. Insect Sci. 2020, 27, 998–1018. [Google Scholar] [CrossRef]
- Wang, J.; Jin, H.; Yang, L.; Ye, X.; Xiao, S.; Song, Q.; Fang, Q. Genome-wide identification and analysis of genes encoding cuticular proteins in the endoparasitoid wasp Pteromalus puparum (Hymenoptera: Pteromalidae). Arch. Insect Biochem. Physiol. 2020, 103, e21628. [Google Scholar] [CrossRef]
- Tufail, M.; Nagaba, Y.; Elgendy, A.M.; Takeda, M. Regulation of vitellogenin genes in insects. Entomol. Sci. 2014, 17, 269–282. [Google Scholar] [CrossRef]
- Dominguez, R.; Holmes, K.C. Actin structure and function. Annu. Rev. Biophys. 2011, 40, 169–186. [Google Scholar] [CrossRef]
- Shakeel, M.; Rodriguez, A.; Tahir, U.B.; Jin, F. Gene expression studies of reference genes for quantitative real-time PCR: An overview in insects. Biotechnol. Lett. 2018, 40, 227–236. [Google Scholar] [CrossRef]
- Chang, Y.W.; Chen, J.Y.; Lu, M.X.; Gao, Y.; Tian, Z.H.; Gong, W.R.; Zhu, W.; Du, Y.Z. Selection and validation of reference genes for quantitative real-time PCR analysis under different experimental conditions in the leafminer Liriomyza trifolii (Diptera: Agromyzidae). PLoS ONE 2017, 12, e0181862. [Google Scholar] [CrossRef]
- Qu, C.; Wang, R.; Che, W.; Zhu, X.; Li, F.; Luo, C. Selection and evaluation of reference genes for expression analysis using quantitative real-time PCR in the Asian Ladybird Harmonia axyridis (Coleoptera: Coccinellidae). PLoS ONE 2018, 13, e0192521. [Google Scholar] [CrossRef]
- Yang, C.; Pan, H.; Liu, Y.; Zhou, X. Selection of reference genes for expression analysis using quantitative real-time PCR in the pea aphid, Acyrthosiphon pisum (Harris) (Hemiptera, Aphidiae). PLoS ONE 2014, 9, e110454. [Google Scholar] [CrossRef]
- Pinheiro, D.H.; Moreira, R.O.; Leite, N.A.; Redoan, A.C.; Xavier, A.D.S.; Barros, B.A.; Carneiro, N.P. Suitable reference genes for RT-qPCR analysis in Dichelops melacanthus (Hemiptera: Pentatomidae). Mol. Biol. Rep. 2020, 47, 4989–5000. [Google Scholar] [CrossRef] [PubMed]
- Bansal, R.; Mamidala, P.; Mian, M.A.; Mittapalli, O.; Michel, A.P. Validation of reference genes for gene expression studies in Aphis glycines (Hemiptera: Aphididae). J. Econ. Entomol. 2012, 105, 1432–1438. [Google Scholar] [CrossRef]
- Teng, X.L.; Zhang, Z.; He, G.; Yang, L.W.; Li, F. Validation of reference genes for quantitative expression analysis by real-time rt-PCR in four lepidopteran insects. J. Insect Sci. 2012, 12, 60. [Google Scholar] [CrossRef]





| Gene Name | Primer Sequence (5′-3′) | Product Length (bp) | Regression Coefficient (R2) | Amplification Efficiency (E) |
|---|---|---|---|---|
| α-TUB | F: TACCGTGGTGATGTCGTTCC | 206 | 0.992 | 95.61% |
| R: GCCTCAGCGATAGCAGTTGT | ||||
| EF-1α | F: CAGATCAGCAACGGCTACAC | 198 | 0.996 | 90.60% |
| R: CTCCTGGAAGGACTCTACGC | ||||
| Actin | F: GCACCCAGTCCTCCTCACAG | 249 | 0.994 | 98.10% |
| R: CGACCAGCCAAGTCCAAACG | ||||
| RP49 | F: GGAATAGATGCGATAGACAAGCC | 223 | 0.999 | 96.94% |
| R: ATCCACAAATAGTATGGGCTTCA | ||||
| GAPDH | F: GAGGGTGGTGCCAAGAAAGT | 93 | 0.991 | 98.15% |
| R: TGGCTTGGGTCGTAGGCATCA | ||||
| NADH | F: GAAGGAGAATGGGCAGTGAA | 104 | 0.995 | 97.58% |
| R: CGATGAGAATACGCCACCAG | ||||
| EF2 | F: GTCGCTGTTGAGCCCAAGAACC | 97 | 0.995 | 98.79% |
| R: CGATGATACATTGGACCATAGGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dong, R.; Cao, F.; Yu, J.; Yuan, Y.; Wang, J.; Li, Z.; Zhu, C.; Li, S.; Li, N. Selection and Validation of Reference Genes for Quantitative Real-Time PCR Analysis in Cockroach Parasitoid Tetrastichus hagenowii (Ratzeburg). Insects 2024, 15, 668. https://doi.org/10.3390/insects15090668
Dong R, Cao F, Yu J, Yuan Y, Wang J, Li Z, Zhu C, Li S, Li N. Selection and Validation of Reference Genes for Quantitative Real-Time PCR Analysis in Cockroach Parasitoid Tetrastichus hagenowii (Ratzeburg). Insects. 2024; 15(9):668. https://doi.org/10.3390/insects15090668
Chicago/Turabian StyleDong, Renke, Fengming Cao, Jincong Yu, Yuan Yuan, Jiahui Wang, Zining Li, Chunxue Zhu, Sheng Li, and Na Li. 2024. "Selection and Validation of Reference Genes for Quantitative Real-Time PCR Analysis in Cockroach Parasitoid Tetrastichus hagenowii (Ratzeburg)" Insects 15, no. 9: 668. https://doi.org/10.3390/insects15090668
APA StyleDong, R., Cao, F., Yu, J., Yuan, Y., Wang, J., Li, Z., Zhu, C., Li, S., & Li, N. (2024). Selection and Validation of Reference Genes for Quantitative Real-Time PCR Analysis in Cockroach Parasitoid Tetrastichus hagenowii (Ratzeburg). Insects, 15(9), 668. https://doi.org/10.3390/insects15090668

