Transcriptomic Characterization of Phototransduction Genes of the Asian Citrus Psyllid Diaphorina citri Kuwayama
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insects
2.2. RNA Extraction and dsRNA Synthesis
2.3. RNA Interference of LW-Opsin
2.4. Transcriptome Sequencing
2.5. Gene Function Annotation and Phototransduction Gene Enrichment
2.6. Validation of Phototransduction Gene Expression by RT-qPCR
2.7. Statistical Analysis
3. Results
3.1. RNA Interference of LW-Opsin
3.2. Illumina Sequencing Analysis
3.3. Phototransduction Genes
3.4. KEGG Pathway Enrichment of Phototransduction Genes
3.5. Gene Function Annotation Based on Phototransduction-Fly Pathway
3.6. Knockdown of LW-Opsin Gene Changes the Gene Expression of the Phototransduction Pathway
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Gottwald, T.R. Current epidemiological understanding of citrus Huanglongbing. Annu. Rev. Phytopathol. 2010, 48, 119–139. [Google Scholar] [CrossRef]
- Grafton-Cardwell, E.E.; Stelinski, L.L.; Stansly, P.A. Biology and management of Asian citrus psyllid, vector of the Huanglongbing pathogens. Annu. Rev. Entomol. 2013, 58, 413–432. [Google Scholar] [CrossRef] [PubMed]
- Bové, J.M. Huanglongbing: A destructive, newly-emerging, century-old disease of citrus. J. Plant Pathol. 2006, 88, 7–37. [Google Scholar] [CrossRef]
- Neupane, D.; Moss, C.B.; Van Bruggen, A.H.C. Estimating citrus production loss due to citrus Huanglongbing in Florida. In Proceedings of the Southern Agricultural Economics Association Annual Meeting, San Antonio, TX, USA, 6–9 February 2016; Available online: https://ageconsearch.umn.edu/bitstream/230093/2/Estimating%20CitrusFinal.pdf (accessed on 28 July 2024).
- Lee, J.A.; Halbert, S.E.; Dawson, W.O.; Robertson, C.J.; Keesling, J.E.; Singer, B.H. Asymptomatic spread of Huanglongbing and implications for disease control. Proc. Natl. Acad. Sci. USA 2015, 112, 7605–7610. [Google Scholar] [CrossRef] [PubMed]
- Paris, T.M.; Allan, S.A.; Udell, B.J.; Stansly, P.A. Wavelength and polarization affect phototaxis of the Asian citrus Psyllid. Insects 2017, 8, 88. [Google Scholar] [CrossRef] [PubMed]
- Paris, T.M.; Croxton, S.D.; Stansly, P.A.; Allan, S.A. Temporal response and attraction of Diaphorina citri to visual stimuli. Entomol. Exp. Appl. 2015, 155, 137–147. [Google Scholar] [CrossRef]
- Li, C.; Tian, F.; Lin, T.; Wang, Z.; Liu, J.; Zeng, X. The expression and function of opsin genes related to the phototactic behavior of Asian citrus psyllid. Pest Manag. Sci. 2020, 76, 1578–1587. [Google Scholar] [CrossRef]
- Terakita, A. The Opsins. Genome Biol. 2005, 6, 213. [Google Scholar] [CrossRef]
- Wang, T.; Montell, C. Phototransduction and retinal degeneration in Drosophila. Pflug. Arch. Eur. J. Physiol. 2007, 454, 821–847. [Google Scholar] [CrossRef]
- Arendt, D.; Tessmar-Raible, K.; Snyman, H.; Dorresteijn, A.W.; Wittbrodt, J. Ciliary photoreceptors with a vertebrate-type opsin in an invertebrate brain. Science 2004, 306, 869–871. [Google Scholar] [CrossRef]
- Ullrich-Lüter, E.M.; D’Aniello, S.; Arnone, M.I. C-opsin expressing photoreceptors in echinoderms. Integr. Comp. Biol. 2013, 53, 27–38. [Google Scholar] [CrossRef] [PubMed]
- Yau, K.W.; Hardie, R.C. Phototransduction motifs and variations. Cell 2009, 139, 246–264. [Google Scholar] [CrossRef] [PubMed]
- Briscoe, A.D.; Chittka, L. The evolution of color vision in insects. Annu. Rev. Entomol. 2001, 46, 471–510. [Google Scholar] [CrossRef] [PubMed]
- Feuda, R.; Marletaz, F.; Bentley, M.A.; Holland, P.W.H. Conservation, duplication, and divergence of five opsin genes in insect evolution. Genome Biol. Evol. 2016, 8, 579–587. [Google Scholar] [CrossRef]
- Lebhardt, F.; Desplan, C. Retinal perception and ecological significance of color vision in insects. Curr. Opin. Insect Sci. 2017, 24, 75–83. [Google Scholar] [CrossRef]
- Mcculloch, K.J.; Macias-Muñoz, A.; Briscoe, A.D. Insect opsins and evo-devo: What have we learned in 25 Years? Philos. Trans. R. Soc. Lond. B Biol. Sci. 2022, 377, 20210288. [Google Scholar] [CrossRef]
- Charlton-Perkins, M.; Cook, T.A. Building a fly eye: Terminal differentiation events of the retina, corneal lens, and pigmented epithelia. Curr. Top. Dev. Biol. 2010, 93, 129–173. [Google Scholar] [CrossRef]
- Salcedo, E.; Huber, A.; Henrich, S.; Chadwell, L.V.; Chou, W.H.; Paulsen, R.; Britt, S.G. Blue- and green-absorbing visual pigments of Drosophila: Ectopic expression and physiological characterization of the R8 photoreceptor cell-specific Rh5 and Rh6 rhodopsins. J. Neurosci. 1999, 19, 10716–10726. [Google Scholar] [CrossRef]
- Senthilan, P.R.; Helfrich-Förster, C. Rhodopsin 7-The unusual Rhodopsin in Drosophila. PeerJ 2016, 4, e2427. [Google Scholar] [CrossRef]
- Ni, J.D.; Baik, L.S.; Holmes, T.C.; Montell, C. A rhodopsin in the brain functions in circadian photoentrainment in Drosophila. Nature 2017, 545, 340–344. [Google Scholar] [CrossRef]
- Jackowska, M.; Bao, R.; Liu, Z.; Mcdonald, E.C.; Cook, T.A.; Friedrich, M. Genomic and gene regulatory signatures of cryptozoic adaptation: Loss of blue sensitive photoreceptors through expansion of long wavelength-opsin expression in the red flour beetle Tribolium castaneum. Front. Zool. 2007, 4, 24. [Google Scholar] [CrossRef] [PubMed]
- Friedrich, M. Parallel losses of blue opsin correlate with compensatory neofunctionalization of UV-opsin gene duplicates in aphids and planthoppers. Insects 2023, 14, 774. [Google Scholar] [CrossRef] [PubMed]
- Montell, C. Drosophila visual transduction. Trends Neurosci. 2012, 35, 356–363. [Google Scholar] [CrossRef] [PubMed]
- Katz, B.; Minke, B. The Drosophila light-activated TRP and TRPL channels—Targets of the phosphoinositide signaling cascade. Prog. Retin. Eye Res. 2018, 66, 200–219. [Google Scholar] [CrossRef]
- Landry, C.R.; Castillo-Davis, C.I.; Ogura, A.; Liu, J.S.; Hartl, D.L. Systems-level analysis and evolution of the phototransduction network in Drosophila. Proc. Natl. Acad. Sci. USA 2007, 104, 3283–3288. [Google Scholar] [CrossRef] [PubMed]
- Hardie, R.C.; Juusola, M. Phototransduction in Drosophila. Curr. Opin. Neurobiol. 2015, 34, 37–45. [Google Scholar] [CrossRef]
- Chen, S.P.; Lin, X.L.; Qiu, R.Z.; Chi, M.X.; Yang, G. An LW-opsin mutation changes the gene expression of the phototransduction pathway: A cryptochrome1 mutation enhances the phototaxis of male Plutella xylostella (Lepidoptera: Plutellidae). Insects 2023, 14, 72. [Google Scholar] [CrossRef]
- Duan, Y.; Gong, Z.J.; Wu, R.H.; Miao, J.; Jiang, Y.L.; Li, T.; Wu, X.B.; Wu, Y.Q. Transcriptome analysis of molecular mechanisms responsible for light-stress response in Mythimna separata (Walker). Sci. Rep. 2017, 7, 45188. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Macias-Muñoz, A.; Rangel Olguin, A.G.; Briscoe, A.D.; Li, W.H. Evolution of phototransduction genes in Lepidoptera. Genome Biol. Evol. 2019, 11, 2107–2124. [Google Scholar] [CrossRef]
- Friedrich, M.; Chen, R.; Daines, B.; Bao, R.; Caravas, J.; Rai, P.K.; Zagmajster, M.; Peck, S.B. Phototransduction and clock gene expression in the troglobiont beetle Ptomaphagus hirtus of Mammoth cave. J. Exp. Biol. 2011, 214, 3532–3541. [Google Scholar] [CrossRef] [PubMed]
- Macias-Munoz, A.; Smith, G.; Monteiro, A.; Briscoe, A.D. Transcriptome-wide differential gene expression in Bicyclus anynana butterflies: Female vision-related genes are more plastic. Mol. Biol. Evol. 2016, 33, 79–92. [Google Scholar] [CrossRef] [PubMed]
- Scott, K.; Becker, A.; Sun, Y.; Hardy, R.; Zuker, C. Gqα protein function in vivo: Genetic dissection of its role in photoreceptor cell physiology. Neuron 1995, 15, 919–927. [Google Scholar] [CrossRef] [PubMed]
- Dolph, P.J.; Man-Son-Hing, H.; Yarfitz, S.; Colley, N.J.; Deer, J.R.; Spencer, M.; Hurley, J.B.; Zuker, C.S. An eye-specific G beta subunit essential for termination of the phototransduction cascade. Nature 1994, 370, 59–61. [Google Scholar] [CrossRef] [PubMed]
- Schillo, S.; Belusic, G.; Hartmann, K.; Franz, C.; Kühl, B.; Brenner-weiss, G.; Paulsen, R.; Huber, A. Targeted mutagenesis of the farnesylation site of Drosophila Gγe disrupts membrane association of the G protein bγ complex and affects the light sensitivity of the visual system. J. Biol. Chem. 2004, 279, 36309–36316. [Google Scholar] [CrossRef]
- Dolph, P.J.; Ranganathan, R.; Colley, N.J.; Hardy, R.W.; Socolich, M.; Zuker, C.S. Arrestin function in inactivation of G protein-coupled receptor rhodopsin in vivo. Science 1993, 260, 1910–1916. [Google Scholar] [CrossRef]
- Srikanth, S.; Wang, Z.; Tu, H.; Nair, S.; Mathew, M.K.; Hasan, G.; Bezprozvanny, I. Functional properties of the Drosophila melanogaster inositol 1,4,5-trisphosphate receptor mutants. Biophys. J. 2004, 86, 3634–3646. [Google Scholar] [CrossRef]
- Vázquez-Martínez, O.; Loranca, A.; Palma-Tirado, L.; Wischin-Fuentes, S.; Villalobos-Leal, M.; Antaramián, A.; Riesgo-Escovar, J.; Hernández-Muñoz, R.; Díaz-Muñoz, M. Time course of retinal degeneration associated with the absence of 1, 4, 5-inositol trisphosphate receptor in Drosophila melanogaster. Exp. Biol. Med. 2010, 235, 365–372. [Google Scholar] [CrossRef]
- Porter, J.A.; Yu, M.; Doberstein, S.K.; Pollard, T.D.; Montell, C. Dependence of calmodulin localization in the retina on the NINAC unconventional myosin. Science 1993, 262, 1038–1042. [Google Scholar] [CrossRef]
- Li, H.S.; Porter, J.A.; Montell, C. Requirement for the NINAC kinase/myosin for stable termination of the visual cascade. J. Neurosci. 1998, 18, 9601–9606. [Google Scholar] [CrossRef]
- Lee, S.J.; Montell, C. Light-dependent translocation of visual arrestin regulated by the NINAC myosin III. Neuron 2004, 43, 95–103. [Google Scholar] [CrossRef] [PubMed]
- Wakakuwa, M.; Stewart, F.; Matsumoto, Y.; Matsunaga, S.; Arikawa, K. Physiological basis of phototaxis to near-infrared light in Nephotettix cincticeps. J. Comp. Physiol. A 2014, 200, 527–536. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.J.; Yan, S.; Shen, Z.J.; Li, Z.; Zhang, X.F.; Liu, X.M.; Zhang, Q.W.; Liu, X.X. The expression of three opsin genes and phototactic behavior of Spodoptera exigua (Lepidoptera: Noctuidae): Evidence for visual function of Opsin in phototaxis. Insect Biochem. Mol. Biol. 2018, 96, 27–35. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.P.; Liu, Z.X.; Chen, Y.T.; Wang, Y.; Chen, J.Z.; Fu, S.; Ma, W.F.; Xia, S.; Liu, D.; Wu, T.; et al. CRISPR/Cas9-mediated knockout of LW-opsin reduces the efficiency of phototaxis in the diamondback moth Plutella xylostella. Pest Manag. Sci. 2021, 77, 3519–3528. [Google Scholar] [CrossRef]
- Huang, M.; Meng, J.Y.; Zhou, L.; Yu, C.; Zhang, C.Y. Expression and function of opsin genes associated with phototaxis in Zeugodacus cucurbitae Coquillett (Diptera: Tephritidae). Pest Manag. Sci. 2023, 79, 4490–4500. [Google Scholar] [CrossRef]




| Gene ID in NCBI | Homolog Name | Forward Primer Sequence (5′ to 3′) | Reverse Primer Sequence (5′ to 3′) |
|---|---|---|---|
| LOC103507937 | IP3R | aggcctcgtcagaaagaata | gagctcagcacacttttaca |
| LOC103507998 | Gqγ | tccatcatgtaactacccgt | tgttcaggtgacgatcattg |
| LOC103509434 | PLCβ | tactcacgggaaagctatgt | cgttttgcagcagtgatttt |
| LOC103513214 | Gqβ | agggagaagaaatgtgtcca | ctatctgttgatctgcacgg |
| LOC103514397 | RK | caatgaacgacttctccgtt | cattttaccggtatccgctt |
| LOC103516584 | Gqα | catatccttggttccagcac | tttgacagcgcagaatacaa |
| LOC103517132 | PKC | cagatcggcaaattcaagga | aaatggaggttgtcccacta |
| LOC103518375 | NINAC | aagagaggaagacatcaggg | gggcaaatctccttgttgat |
| LOC103524308 | Arr2 | cgctctgaagaagtcgaaaa | cagttgtttattcgtccggt |
| KO ID | KO Name | Gene IDs | Gene Number |
|---|---|---|---|
| K00910 | GRK | LOC103505361, LOC103505365, LOC103519341, LOC103523400, LOC103524942, LOC103514397 | 6 |
| K02183 | CALM | LOC103505048, LOC103509805, LOC103509868, LOC103510651, LOC103511026, LOC103511569, LOC103511781, LOC103512666, LOC103513726, LOC103514274, LOC103517588, LOC103521078, LOC113468030, LOC103507684, LOC113465625 | 15 |
| K02677 | PRKCA | LOC108253019, LOC108253020, LOC103517132 | 3 |
| K04255 | Rh2_7 | LOC103506067, LOC103506845, LOC103516743, LOC103516911, LOC103516912, LOC103517452, LOC103517454, LOC103521071, LOC103524061, LOC113473058 | 10 |
| K04515 | CAMK2 | LOC103509280, LOC113471771, MSTRG.19456 | 3 |
| K04536 | GNB1 | LOC103515883, LOC103515885 | 2 |
| K04547 | GNG13 | LOC103507998 | 1 |
| K04634 | GNAQ | LOC103516584 | 1 |
| K04952 | CNGB1 | LOC103517837, LOC103522372, LOC103520508 | 3 |
| K04958 | ITPR1 | LOC103507937 | 1 |
| K04967 | TRPC4 | LOC113472687, LOC108252237, LOC108252236, MSTRG.12236 | 4 |
| K05858 | PLCB | LOC103508056, LOC103513753, LOC103519973, LOC103509434 | 4 |
| K06636 | SMC1 | LOC113465618, LOC113466617, LOC113466908, LOC113467623, LOC113467958, LOC113467961, LOC113470296, LOC113473712, LOC113473717, LOC113473739 | 10 |
| K07972 | GNB | LOC103513214 | 1 |
| K08834 | MYO3 | LOC103509649, LOC103513890, LOC103514755, LOC103515283, LOC103515285, LOC103515286, LOC103517045, LOC103517041, LOC103517042, LOC103517043, LOC103518375, MSTRG.45354, MSTRG.43624, MSTRG.48618, MSTRG.5326, MSTRG.17197, MSTRG.35405 | 17 |
| K12322 | GUCY2F | LOC103508103 | 1 |
| K13803 | TRPL | LOC103508643, LOC103522058 | 2 |
| K13805 | ARR2 | LOC103524308 | 1 |
| K13806 | DAGL | LOC103515251, MSTRG.11676 | 2 |
| Gene Name | Gene IDs | Gene Number |
|---|---|---|
| Gq | LOC103516584, LOC103513214, LOC103507998 | 3 |
| PLCβ | LOC103519973, LOC103509434, LOC103513753, LOC103508056 | 4 |
| TRP | LOC113472687, LOC108252236, LOC108252237, MSTRG.12236 | 4 |
| TRPL | LOC103508643, LOC103522058 | 2 |
| PKC | LOC103517132, LOC108253019, LOC108253020 | 3 |
| CaM | LOC103505048, LOC103509805, LOC103509868, LOC103510651, LOC103511026, LOC103511569, LOC103511781, LOC103512666, LOC103513726, LOC103514274, LOC103517588, LOC103521078, LOC113468030, LOC103507684, LOC113465625 | 15 |
| Arr2 | LOC103524308 | 1 |
| NINAC | LOC103509649, LOC103513890, LOC103514755, LOC103515283, LOC103515285, LOC103515286, LOC103517045, LOC103517041, LOC103517042, LOC103517043, LOC103518375, MSTRG.5326, MSTRG.17197, MSTRG.35405, MSTRG.43624, MSTRG.45354, MSTRG.48618 | 17 |
| Actin | LOC113465618, LOC113466617, LOC113466908, LOC113467623, LOC113467958, LOC113467961, LOC113470296, LOC113473712, LOC113473717, LOC113473739 | 10 |
| IP3R | LOC103507937 | 1 |
| DAGL | LOC103515251, MSTRG.11676 | 2 |
| CamKII | LOC113471771, LOC103509280, MSTRG.19456 | 3 |
| RK | LOC103505361, LOC103505365, LOC103519341, LOC103523400, LOC103524942, LOC103514397 | 6 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, S.-P.; Chu, X.-M.; Chi, M.-X.; Zhao, J.; Qiu, R.-Z. Transcriptomic Characterization of Phototransduction Genes of the Asian Citrus Psyllid Diaphorina citri Kuwayama. Insects 2024, 15, 966. https://doi.org/10.3390/insects15120966
Chen S-P, Chu X-M, Chi M-X, Zhao J, Qiu R-Z. Transcriptomic Characterization of Phototransduction Genes of the Asian Citrus Psyllid Diaphorina citri Kuwayama. Insects. 2024; 15(12):966. https://doi.org/10.3390/insects15120966
Chicago/Turabian StyleChen, Shao-Ping, Xue-Mei Chu, Mei-Xiang Chi, Jian Zhao, and Rong-Zhou Qiu. 2024. "Transcriptomic Characterization of Phototransduction Genes of the Asian Citrus Psyllid Diaphorina citri Kuwayama" Insects 15, no. 12: 966. https://doi.org/10.3390/insects15120966
APA StyleChen, S.-P., Chu, X.-M., Chi, M.-X., Zhao, J., & Qiu, R.-Z. (2024). Transcriptomic Characterization of Phototransduction Genes of the Asian Citrus Psyllid Diaphorina citri Kuwayama. Insects, 15(12), 966. https://doi.org/10.3390/insects15120966

