Next Article in Journal
Adapting to Uncertainty: Foraging Strategies in Dinoponera quadriceps (Formicidae: Ponerinae)
Previous Article in Journal
The Phytochemical Properties of Low-Grade Longan Syrup and Its Potential Use as a Dietary Supplement for Honey Bees
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 15
Issue 12
10.3390/insects15120947
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Gut Bacteria on the Fitness of Rice Leaf Folder Cnaphalocrocis medinalis

by
Qinjian Pan
1,
Qingpeng Wang
2,
Ikkei Shikano
3,
Fang Liu
2,* and
Zhichao Yao
2,*
1
Institutes of Agricultural Science and Technology Development, Joint International Research Laboratory of Agriculture and Agri–Product Safety, Yangzhou University, The Ministry of Education of China, Yangzhou 225009, China
2
College of Plant Protection, Yangzhou University, Yangzhou 225009, China
3
Department of Plant and Environmental Protection Sciences, University of Hawai’i at Mānoa, Honolulu, HI 96822, USA
*
Authors to whom correspondence should be addressed.
Insects 2024, 15(12), 947; https://doi.org/10.3390/insects15120947
Submission received: 25 October 2024 / Revised: 21 November 2024 / Accepted: 28 November 2024 / Published: 29 November 2024
(This article belongs to the Section Insect Behavior and Pathology)
Browse Figures
Review Reports Versions Notes

Simple Summary

Most insects harbor diverse bacterial communities in their guts, which can influence host behavior and physiology. The rice leaf folder C. medinalis, a significant migratory pest in Asia, also possesses diverse bacterial communities, but the functions of these bacteria in modulating host’s growth and fitness remain unclear. In this study, we isolated 15 bacterial species from field–collected C. medinalis larvae using a culture–dependent method. When C. medinalis larvae were orally inoculated with individual bacterial isolates, we found that many isolates had nonessential or deleterious roles in the development and reproduction of C. medinalis. Among these isolates, 10 caused high mortality, highlighting their potential as biocontrol agents. Antibiotic treatment to eliminate gut bacteria negatively affected the fitness of C. medinalis, which included prolonged larval and pupal development, and decreased adult longevity and fecundity. Inoculation of a bacterial community to antibiotic–treated larvae recovered some of the negative effects, including fecundity. Our results reveal that C. medinalis possesses bacteria capable of both mutualistic and pathogenic interactions.

Abstract

The rice leaf folder Cnaphalocrocis medinalis is an important migratory pest in Asia. Although this pest possesses diverse bacterial communities in its gut, functions of these bacteria in modulating host fitness, including development durations, pupal weight, adult longevity, and fecundity, remain unknown. We isolated gut bacteria from field–collected C. medinalis larvae using a culture–dependent method and identified 15 bacterial isolates. Six of the isolates (Klebsiella aerogenes, Klebsiella pneumoniae, Enterobacter ludwigii, Enterobacter asburiae, Pantoea dispersa, and Pantoea ananatis) were newly discovered in C. medinalis. When larvae were orally inoculated with individual bacterial isolates, 15 isolates showed varying degrees of effects on C. medinalis fitness. Importantly, we found that 10 bacterial isolates induced significant larval mortality. Specifically, the inoculation of Pseudomonas mosselii, P. dispersa, Chryseobacterium culicis, P. ananatis, and Myroides odoratus caused high mortality ranging from 40.0% to 56.7%. However, reducing the entire gut bacterial community with antibiotic treatment negatively impacted C. medinalis fitness, while the reinoculation of a bacterial community to antibiotic–treated larvae recovered some of the adverse effects. In particular, control and bacterial community–inoculated C. medinalis laid approximately 37.6% more eggs than antibiotic–treated C. medinalis. This suggests that these bacteria affect their hosts differently when they are together as compared to alone. Our results reveal that C. medinalis harbors gut bacteria capable of both mutualistic and pathogenic interactions, suggesting their potential as biocontrol agents and indicating that targeting the gut bacterial community could be an effective strategy for controlling C. medinalis infestations.

Graphical Abstract

1. Introduction

The research over the past two decades has revealed functional relationships between some of the gut microorganisms and their insect hosts [1,2,3]. Some bacterial isolates can directly influence the fitness of their host insects by aiding protein digestion, fixing nitrogen, and producing essential nutrients [4,5,6,7]. Other isolates may indirectly influence the growth of insect populations by detoxifying toxic plant chemicals, degrading insecticides, and boosting the immune systems of host insects [8,9,10]. Since insects harbor an astonishing diversity of microbes in their guts, the microbial community may contribute to maintaining host homeostasis and health by regulating nutrient metabolism and immune system responses [11,12,13]. Hence, enhancing our understanding of the roles of individual bacteria and bacterial communities in the growth and reproduction of their insect hosts may be helpful in developing methods to regulate insect pest populations.
Although gut microbes are usually commensal in healthy herbivores, their roles can change from beneficial to harmful depending on host condition. Some gut bacteria may emerge as opportunistic pathogens if the host’s modulation of intestinal microbes deteriorates [14,15]. For example, the effects of Enterococcus and Serratia isolates collected from the guts of healthy Manduca sexta and Spodoptera frugiperda larvae changed from commensal to pathogenic when the larvae were fed a toxic diet [16,17]. Thus, a better understanding of the functions of gut bacteria for host survival would aid in developing pathogenic bacteria as biocontrol agents. Recent advancements in next–generation sequencing (NGS) technology have revealed a diversity of microbial communities associated with insects [18], yet the research on the functions of these gut microbes remains limited. The culture–dependent method is another option for identifying bacteria, but it has limitations due to culturing conditions, such as temperature, nutrition, and humidity, which may prevent the growth and identification of many bacteria species. Despite this major drawback, a huge advantage of this method is that it offers the possibility to culture specific bacteria and allows for assessments of bacterial functions. In this study, we investigated the positive and negative effects of gut bacterial isolates and community on the fitness and reproduction of a major lepidopteran rice pest.
Cnaphalocrocis medinalis (Lepidoptera: Pyralidae) is a devastating pest of rice (Oryza sativa), affecting yields significantly across Asia [19]. The larvae can cause extensive damage to rice leaves by rolling and defoliating them, ultimately leading to significant yield losses, reduced crop quality, increased vulnerability to diseases, and additional economic burdens on farmers [20,21]. Moreover, C. medinalis adults have a strong migratory propensity and flight capability [22]. To our knowledge, there are few effective commercial microbial insecticides and biocontrol agents to control this pest. Farmers often resort to chemical insecticides, but their excessive use has led to adverse effects on the environment and human health. Therefore, there is a pressing need to develop alternative, safe, sustainable, and eco–friendly strategies to manage C. medinalis infestations.
Existing reports on gut microbes of C. medinalis have primarily used NGS technology to compare variations in gut bacteria species diversity associated with differences in host plants, geographic locations, and life stages [23,24,25]. However, the role of gut bacteria in modulating the fitness of C. medinalis has not been explored explicitly. In the present study, we firstly employed both culture–dependent method and 16S rRNA sequencing to identify culturable bacterial isolates from the guts of field–collected C. medinalis larvae. Secondly, we tested the effects of each bacterial isolate on the fitness of C. medinalis larvae and adults. Thirdly, we evaluated the function of a bacteria community on the development and reproduction of C. medinalis. We aimed to understand the intricate interplay between C. medinalis and its gut bacteria by investigating the importance of gut bacteria on host fitness, providing insights into potential pest management strategies, such as identifying potential microbial control agents or eliminating essential bacteria from the gut using antibiotics.

2. Materials and Methods

2.1. Insects

Laboratory colony of C. medinalis used for bacteria inoculation. Larvae and pupae of wild C. medinalis were initially collected from a paddy field in Yangzhou University, China, in September 2017. Larvae were reared on wheat (Triticum aestivum cv. Zhenmai 168) seedlings for more than 30 generations under the laboratory condition of 27 ± 1 °C, 75% RH, and a photoperiod of 14:10 h (light:dark). To obtain eggs, groups of fifteen mating pairs of newly emerged moths (1:1) were placed in plastic cups (10.8 cm in diameter, 14.2 cm in height), which were covered with a transparent plastic film. Adults were provided with 10% honey solution as supplementary nutrition. C. medinalis larvae underwent five larval instars under laboratory conditions.
Field–collected C. medinalis larvae used for culturing gut bacterial isolates. Wild fourth instar C. medinalis larvae (n = 45) were collected from a paddy field in Jiangyan (120.10° E, 32.57° N), Taizhou, China, in July 2020. They were stored in 50 mL centrifuge tubes with ventilation holes, punctured using a stainless–steel insect pin (size 3).

2.2. Gut Dissection and Bacteria Sampling

Field–collected larvae were starved for 4 h, sterilized externally with 75% ethanol, and rinsed with sterilized water three times. The entire gut tissue from each larva was dissected using two forceps by gently holding both ends of the larva and pulling in opposite directions, then transferred into a sterile 1.5 mL centrifuge tube containing 0.5 mL of sterile PBS buffer (pH 7.4). Gut tissue was ground manually with a sterile pestle and maintained at 37 °C for 1 h to release bacteria. The homogenization buffer was centrifuged at 5000× g for 30 min to remove debris (i.e., frass and gut tissue). The supernatants from the homogenization buffers of each larval gut tissue were pooled together (~22.5 mL) and transferred into a sterile 50 mL centrifuge tube. We used 20 mL of the bacterial suspension in the following experiments: 5 mL was used to identify culturable bacterial isolations, while the remaining 15 mL served as a source of bacterial community to test their effects on C. medinalis fitness.

2.3. Bacteria Isolation and Identification

The bacterial isolates were cultured and identified according to Pan et al. [26] with minor modifications. Briefly, tenfold serial dilutions of the supernatant containing gut bacteria were prepared and 5–6 dilutions were separately cultured on the surface of 2 × YT agar plates (containing 1.6% tryptone, 1.0% yeast extract, 0.5% NaCl, and 1.4% agar). All cultures were incubated at 27 °C for roughly 12 h. Different bacterial isolates were chosen depending on the morphological characteristics (color, shape, and size). Selected isolates were purified by sub–culturing twice. The purified isolates were individually grown in liquid 2 × YT media (containing 1.6% tryptone, 1.0% yeast extract, and 0.5% NaCl) in a rotary shaker at 200 rpm at 27 °C overnight. Twenty microliters of each liquid bacterial isolate were transferred into a sterile PCR tube, heated at 95 °C for 10 min to release the DNA from bacterial cells. The bacterial DNA was amplified with a PCR reaction using universal 16S rRNA primers (27F 5′–AGAGTTTGATCCTGGCTCAG–3′, 1492R 5′–GGTTACCTTGTTACGACTT–3′). The PCR products were sequenced at Beijing Tsingke Biotech Co., Ltd. (Nanjing, China). The obtained 16S rRNA sequences were analyzed with NCBI (National Center for Biotechnology Information) and RDP (Ribosomal Database Project). All sequences of the bacterial isolates were submitted to the GenBank database under the accession numbers PP955231–PP955245, as shown in Table 1. Each bacterial isolate (500 μL) was stored in 500 μL 25% sterile glycerol at −80 °C for future use.

2.4. Effects of Each Bacterial Isolate on C. medinalis Fitness

A total of 15 bacterial isolates were identified. C. medinalis larvae were inoculated with individual bacterial isolates to determine the effects of a single isolate on subsequent developmental stages. The 15 isolates were separated into 3 groups, such that 5 isolates and a control were tested at each time.
The bacterial suspensions for larval inoculation were prepared by growing stock bacteria in liquid 2 × YT media overnight to obtain an optical density (OD) of 1 at a wavelength of 600 nm, which produces approximately 1 × 109 colony forming units per milliliter [26]. Fresh wheat leaves (~10 cm in length) were surface sterilized by submerging in 75% ethanol and then rinsing with sterile distilled water three times. The sterile leaves were dipped into 50 mL of one bacterial isolate suspension (treated leaves) or distilled water (untreated leaves) for 5 min, allowed to air–dry for 30 min at room temperature, and transferred into sterile Petri dishes (10 cm in diameter). The petioles of these treated or untreated leaves were inserted into a moist, sterile, cotton ball to keep fresh.
Eggs from the C. medinalis lab colony were surface sterilized by 2% bleach. One neonate that newly hatched from surface sterilized eggs was introduced into a sterile Petri dish with treated or untreated leaves. A total of 30 newly hatched larvae were used in each treated and untreated group. The treated or untreated leaves were replaced with corresponding leaves of the same treatment every two days until pupation or death. All larvae either pupated or died within 20 days. The resulting pupae were paired to allow one male and one female from a treatment to mate and lay eggs in a 320 mL plastic cup. Each cup was covered with plastic film containing a cotton ball that was pre–soaked with 10% honey solution. Each insect was monitored daily until all individuals had died. Detailed fitness parameters were investigated as follows: the development time of each larval and pupal stage, pupal weight and sex, and adult longevity; pre–oviposition and oviposition period; and fecundity of each female (total number of eggs laid until death). To avoid bias from individuals that died before reaching the pupal stage, data from those that did not survive pupation in the treated and untreated groups were excluded from analyses of developmental measures. The numbers of eggs deposited in each cup were counted daily until the female died. Females that did not lay eggs were excluded from fecundity analyses. Pupae were weighed using a micro–balance (resolution 0.1 mg; AL204–IC, Mettler Toledo Technology Co., LTD (Shanghai, China). The sex of each pupa was identified according to Chen et al. [27] and the proportion of adult females was determined for each treatment.

2.5. Effects of Gut Bacterial Community on C. medinalis Fitness

To examine the effects of bacterial community on the fitness of C. medinalis larvae, we applied an antibiotic (AB) cocktail to reduce the gut bacterial community. Three antibiotics, neomycin trisulfate salt hydrate (A610366), chlortetracycline hydrochloride (A600297), and streptomycin sulfate (A610494), were all produced by Sangon Biotech. Each milliliter of AB cocktail contained 0.2 mg neomycin trisulfate salt hydrate, 1 mg chlortetracycline hydrochloride, and 0.06 mg streptomycin sulfate dissolved in sterile distilled water. Fresh wheat leaves (~10 cm in length) were surface sterilized in 75% ethanol as described above and dipped into 50 mL of the AB cocktail for 5 min. After ensuring the even spread of the AB cocktail on the leaf surface, the leaves were air–dried at room temperature for 1 h. In order to investigate the effects of antibiotic treatment on the fitness of 4th and 5th instar larvae, a newly molted 4th or 5th instar larva from the laboratory colony was placed in a Petri dish (10 cm in diameter) and received an AB–treated (AB+) or untreated (AB−) ethanol–sterilized leaf. The AB+ and AB− leaves were replaced every two days until the 4th instar larvae initiated their molt into the 5th instar or until the 5th instar larvae initiated pupation. Larvae (n = 30) treated with AB in the 4th instar (AB+) were fed leaves surface–sterilized with 75% ethanol during their 5th instar until pupation. Larvae (n = 30) treated with AB in the 5th instar (AB+) were fed AB+ leaves during their 5th instar until pupation. Therefore, the AB treatment was only performed during one larval instar, either in the 4th instar or 5th instar. AB− larvae (n = 30) were fed ethanol–sterilized leaves until pupation. Parameters of development time, adult longevity, and female fecundity were measured as described above.
To determine how inoculation with a community of gut bacteria affects the growth and reproduction of C. medinalis, we transferred the bacterial community obtained from field–collected larvae into lab–reared 5th instar larvae that had been treated with AB in the 4th instar. The bacterial community suspension (see Materials and Methods Section 2.2) was equally divided into thirty 0.5 mL aliquots. Each 0.5 mL aliquot of the bacterial suspension was evenly applied on the upper surface of two ethanol–sterilized leaves (each ~10 cm in length) and air–dried at room temperature for 1 h.
Thirty newly molted 4th instar larvae were placed in individual Petri dishes and fed AB+ leaves for the duration of the 4th instar. Once the larvae molted to the 5th instar, they were transferred to new individual Petri dishes and provided 2 leaves treated with the bacterial community suspension. The bacteria–treated leaves were replaced every two days until the larvae pupated. AB− (n = 30) larvae and AB+ (n = 30) larvae that were fed ethanol–sterilized leaves (not treated with bacteria) in the 5th instar served as controls. The fitness parameters were measured as described above.

2.6. Statistical Analyses

The effects of single bacterial isolates and antibiotic treatments on the duration of different life stages, pupal weight, and fecundity were analyzed with Student’s t test to compare each treatment against the control at α = 0.05. Survival curves for C. medinalis inoculated with individual bacterial isolates were analyzed by Kaplan–Meier survivorship analyses followed by log–rank pairwise comparisons tests. The effects of inoculation with a community of bacteria on the development time of different life stages, pupal weight, and fecundity were analyzed using a one–way analysis of variance (ANOVA). Duncan multiple range tests were used for multiple comparisons at α = 0.05. Statistical analyses were performed using IBM SPSS statistical software (version 26).

3. Results

3.1. Isolation and Identification of Cultured Bacteria from C. medinalis Gut

Fifteen bacterial isolates were identified and listed in Table 1. They were categorized into 3 bacterial phyla, 4 classes, 5 orders, 10 families, and 12 genera (Table 2). The three bacterial phyla were predominant in the gut bacterial community of C. medinalis. These isolates belonged to 12 genera consisting of Acinetobacter (one isolate), Klebsiella (two isolates), Enterobacter (two isolate), Herbaspirillum (one isolate), Pseudomonas (one isolate), Pantoea (two isolates), Stenotrophomonas (one isolate), Bacillus (one isolate), Chryseobacterium (one isolate), Enterococcus (one isolate), Providencia (one isolate), and Myroides (1 isolate).

3.2. Effects of Single Bacterial Isolate on Development and Reproduction of C. medinalis

3.2.1. Survival of C. medinalis During Immature Stage

The survival of C. medinalis over a 20 d period was strongly influenced by the ingestion of specific bacterial isolates. C. medinalis larvae fed control leaves exhibited a high survival rate, ranging from 96.7% to 93.3%. Feeding larvae with leaves treated with some bacterial isolates did not negatively affect survival. These included Acinetobacter soli (16.7% mortality; Figure 1A: χ2 = 1.357; p = 0.244), E. ludwigii (6.7% mortality; Figure 1A: χ2 = 0.001; p = 0.9930), Herbaspirillum huttiense (16.7% mortality; Figure 1A: χ2 = 1.366; p = 0.242), and K. pneumoniae (13.3% mortality; Figure 1B: χ2 = 0.679; p = 0.410). Although there was no statistically significant difference, larval feeding on K. aerogenes–treated leaves slightly reduced survival compared to the controls (23.3% mortality; Figure 1A: χ2 = 3.320; p = 0.0680). Ten bacterial isolates significantly decreased survival relative to the control during the 20 d period. These included larvae that fed on leaves treated with P. mosselii (56.7% mortality; Figure 1A: χ2 = 17.404; p = 0.0001), P. dispersa (40.0% mortality; Figure 1B: χ2 = 9.483; p = 0.0020), Stenotrophomonas maltophilia (26.7% mortality; Figure 1B: χ2 = 4.520; p = 0.0340), Bacillus atrophaeus (33.3% mortality; Figure 1B: χ2 = 6.242; p = 0.0120), C. culicis (40.0% mortality; Figure 1B: χ2 = 9.956; p = 0.0020), Enterococcus hirae (23.3% mortality; Figure 1C: χ2 = 5.169; p = 0.0230), E. asburiae (20.0% mortality; Figure 1C: χ2 = 4.434; p = 0.0350), P. ananatis (46.7% mortality; Figure 1C: χ2 = 14.801; p = 0.0001), Providencia vermicola (26.7% mortality; Figure 1C: χ2 = 6.179; p = 0.0130), and M. odoratus (40.0% mortality; Figure 1C: χ2 = 11.512; p = 0.0010). C. medinalis survival was affected the most by P. mosselii, which induced 56.70% mortality.

3.2.2. Development Time of C. medinalis Larvae

The duration of the larval stage varied among C. medinalis larvae fed leaves treated with different bacterial isolates (Table 3). In group 1, larvae fed leaves treated with K. aerogenes spent significantly longer in the fourth instar than the controls (t1, 49 = −2.855, p = 0.0060). Larvae fed leaves treated with P. mosselii took significantly longer than the controls in the 3rd (t1, 39 = −6.086, p = 0.0001) and 5th (t1, 39 = −2.167, p = 0.0360) instars. Overall, the total development time of larvae was prolonged when fed leaves treated with E. ludwigii (t1, 54 = −2.295, p = 0.0260), H. huttiense (t1, 51 = −2.566, p = 0.0130), and P. mosselii (t1, 39 = −4.311, p = 0.0001).
In group 2, the duration of the 5th instar was significantly longer in larvae fed leaves treated with P. dispersa than control leaves (t1, 44 = −4.418, p = 0.0001). Larvae fed leaves treated with S. maltophilia spent longer in the 4th (t1, 48 = −3.264, p = 0.0020) and 5th (t1, 48 = −2.756, p = 0.0080) instars than those fed control leaves. Overall, the total development time of larvae was prolonged if fed leaves treated with S. maltophilia (t1, 47 = −4.671, p = 0.0001) and B. atrophaeus (t1, 47 = −2.771, p = 0.0080).
In group 3, larvae fed leaves treated with E. hirae took significantly longer to complete the 1st (t1, 50 = −6.026, p = 0.0001), 2nd (t1, 50 = −2.278, p = 0.0270), and 5th (t1, 50 = −2.230, p = 0.0300) instars than those fed control leaves. Larvae fed E. asburiae–treated leaves took longer to complete the 1st instar than the controls (t1, 46 = −2.193, p = 0.0330), and those fed P. ananatis–treated leaves took longer to complete the 1st (t1, 43 = −2.472, P = 0.0420) and 4th (t1, 43 = −2.586, p = 0.0160) instars than the controls. Larvae fed leaves treated with P. vermicola had delayed development in the 3rd (t1, 49 = −3.603, p = 0.0010) and 4th (t1, 49 = −3.035, p = 0.0040) instars than the controls, and feeding on M. odoratus–treated leaves delayed the development duration in the 5th (t1, 45 = −2.254, p = 0.029) instar relative to the controls. Overall, the complete larval period was significantly prolonged in larvae fed leaves treated with E. hirae (t1, 50 = −5.982, p = 0.0001), P. ananatis (t1, 43 = −3.939, p = 0.0010), P. vermicola (t1, 49 = −4.694, p = 0.0001), and M. odoratus (t1, 45 = −3.254, p = 0.0020).

3.2.3. Pupal Time, Pupal Weight, Sex Ratio, Adult Longevity, and Fecundity of C. medinalis

Ingestion of bacterial isolates did not significantly affect the duration of the prepupal period (Table 4), but the duration of the pupal stage was significantly prolonged relative to the control in C. medinalis fed leaves treated with E. hirae (t1, 50 = −2.670, p = 0.0100), E. asburiae (t1, 46 = −2.255, p = 0.0290), P. ananatis (t1, 43 = −3.245, p = 0.0040), and P. vermicola (t1, 49 = −3.387, p = 0.0020). The pupal weight was significantly reduced in C. medinalis fed P. dispersa (t1, 44 = −4.480, p = 0.0001), S. maltophilia (t1, 48 = 2.359, p = 0.0220), K. pneumoniae (t1, 52 = 3.352, p = 0.0020), B. atrophaeus (t1, 47 = 3.445, p = 0.0010), C. culicis (t1, 43 = 2.652, p = 0.0110), and E. hirae (t1, 50 = −2.428, p = 0.0190), relative to the control pupae. The proportion of females (i.e., sex ratio) was approximately 0.5 in all treatments except C. medinalis fed leaves treated with B. atrophaeus, which resulted in a 0.62 female ratio. Some bacterial isolates prolonged the lifespan of the adults. Compared to the controls, adult longevity was longer if, during the larval stage, they were fed leaves treated with Acinetobacter soli (t1, 51 = 3.381, p = 0.0010), K. aerogenes (t1, 49 = 2.191, p = 0.0330), H. huttiense (t1, 51 = 3.381, p = 0.0010), P. dispersa (t1, 44 = 2.964, p = 0.0050), and S. maltophilia (t1, 48 = 3.017, p = 0.0040). The total numbers of eggs laid (i.e., fecundity) was significantly reduced relative to the controls in females fed A. soli (t1, 17 = 3.156, p = 0.0060), S. maltophilia (t1, 20 = 2.706, p = 0.0140), B. atrophaeus (t1, 23 = 3.123, p = 0.0050), and P. vermicola (t1, 21 = 2.175, p = 0.0410). Collectively, some of the bacterial isolates had neutral effects on host fitness, while others adversely affected the development and reproduction of C. medinalis.

3.3. Effects of Gut Bacterial Community on Development and Reproduction of C. medinalis

3.3.1. Immature Stage

The number of colony–forming units of bacteria in larval guts visibly decreased when C. medinalis larvae were fed leaves treated with an antibiotic cocktail (no data; Figure 2). Compared to the controls, when 4th instar larvae were treated with antibiotics, their development time in the 5th instar was significantly prolonged (Figure 3A, t1, 54 = −6.531, p = 0.0001). When larvae were fed antibiotics during the 5th instar, their 5th instar durations were significantly prolonged relative to the controls (Figure 3A: t1, 58 = 2.576, p = 0.0130). When 5th instar larvae that had been treated with antibiotics in the 4th instar were fed leaves treated with the bacterial community, their development was still significantly prolonged relative to the controls (Figure 3B, F2, 83 = 4.907, p = 0.0100).
When larvae were fed antibiotics during either the 4th (Figure 3E, t1, 54 = −3.375, p = 0.0010) or 5th instar (Figure 3E, t1, 58 = 3.167, p = 0.0030), the duration of their pupal stages was significantly extended relative to the controls. Compared to the controls, the pupal weight was significantly reduced when fed antibiotics during the 4th larval instar (Figure 3G t1, 54 = 2.836, p = 0.0060), but was not significantly different from the controls when larvae were fed antibiotics during the 5th instar (Figure 3G, t1, 58 = −1.251, p = 0.2160). Though larvae fed antibiotics during the 4th instar had significantly longer pupal durations (Figure 3F, F2, 83 = 6.943, p = 0.0020) and lighter pupae (Figure 3H, F2, 83 = 3.176, p = 0.0470) compared to the controls, reintroducing the gut bacterial community in the 5th instar recovered these negative effects to some extent, such that the duration of their pupal stage and pupal weight were not significantly different from the controls that were not fed antibiotics (Figure 3F).

3.3.2. Adult Stage

When 4th instar larvae were treated with antibiotics, their adult longevity was significantly shortened relative to the controls (Figure 4A, t1, 54 = 3.535, p = 0.0010). When 5th instar larvae were treated with antibiotics, their adult longevities were not significantly different from the controls (Figure 4A, t1, 58 = −0.935, p = 0.3540). Antibiotic–treated larvae that had their gut bacterial community reintroduced during the 5th instar still exhibited shorter adult longevity relative to the controls (Figure 4B, F2, 83 = 5.739, p = 0.0050).
Fecundity was significantly lower when they were fed antibiotics during the 4th instar (Figure 4C, t1, 44 = 5.476, p = 0.0001), but antibiotic treatment in the 5th instar did not affect fecundity (Figure 4C, t1, 26 = −0.849, p = 0.4030). Interestingly, reintroducing the gut bacterial community to antibiotic–treated larvae during the 5th instar recovered the reproductive capacity of females (Figure 4D, F2, 83 = 10.874, p = 0.0001). The bacterial community–inoculated C. medinalis laid 37.6% more eggs than females that were treated with antibiotics in the 4th instar and not given bacteria in the 5th instar. The results indicate that gut bacteria may have a significant influence on the fitness of the insect host during earlier developmental instars. Importantly, the bacterial community may play an important role in the growth of C. medinalis populations, suggesting that targeting the gut bacterial community could be an effective strategy to control C. medinalis infestation by reducing or eliminating their gut bacteria.

4. Discussion

Studies from the last two decades have demonstrated that gut bacteria in insects play important roles in mediating the fitness of their hosts, though their roles in lepidopteran hosts is less clear. In this study, we identified 15 culturable bacterial isolates from the guts of field–collected C. medinalis larvae using a culture–dependent method. According to previous publications on the diversity of gut bacteria in C. medinalis using NGS technology, six of the bacterial isolates in our study, K. aerogenes, K. pneumoniae, E. ludwigii, E. asburiae, P. dispersa, and P. ananatis, were newly identified [23,24]. K. aerogenes has been identified in the guts of Tuta absoluta [28]; K. pneumoniae and E. ludwigii have been identified in the foregut of Helicoverpa zea [29,30]; E. asburiae has been found in the digestive tract of Helicoverpa zea, Plutella xylostella, and Tuta absoluta [6,28,29]; and P. dispersa, and P. ananatis have been isolated from larval guts of S. frugiperda [31]. The variations in bacterial species among these isolates are significantly influenced by insect species and their living conditions, along with the methods used for identification, whether culture–dependent or –independent.
Our bacterial inoculation experiments revealed that the 15 identified bacterial isolates demonstrated varying degrees of effects on C. medinalis fitness. We found that C. medinalis females laid significantly fewer eggs if they had been reared on leaves treated with Acinetobacter soli, S. maltophilia, B. atrophaeus, and P. vermicola relative to the controls. Though development on leaves treated with K. aerogenes, E. ludwigii, H. huttiense, and K. pneumoniae resulted in prolonged larval instars, fecundity was not affected compared to the controls. Importantly, high mortality, ranging from 20.0% to 56.7%, was induced by 10 bacterial isolates: P. mosselii, P. dispersa, S. maltophilia, B. atrophaeus, C. culicis, E. hirae, E. asburiae, P. ananatis, P. vermicola, and M. odoratus. Pathogenic or opportunistically pathogenic isolates are common in the guts of lepidopteran larvae [14,16,17]. Some of the bacterial species we isolated are known entomopathogens. S. maltophilia is known to induce mortality in insects including cowpea weevil, Callosobruchus maculatus, and termites, Coptotermes heimi and Heterotermes indicola [32,33]. B. atrophaeus possesses the capability to generate chitinolytic enzymes, which has been shown to exhibit insecticidal potential [34]. P. vermicola has been proven to be pathogenic to many insects, including the greater wax moth, Galleria mellonella; beet armyworm, Spodoptera exigua; and Mexican fruit fly, Anastrepha ludens [35,36]. Hence, the bacterial isolates identified in our study may potentially be developed as biological control agents for managing C. medinalis, and possibly other agriculture pests.
Diverse microbial communities in the guts of insect hosts can profoundly influence numerous aspects of host biology [26,37]. In the present study, our colony larvae, cleared of gut bacteria using a cocktail of antibiotics, performed worse than control larvae with intact gut microbiota, despite individual isolates having neutral or negative effects on C. medinalis fitness. Additionally, antibiotic treatment in the 4th larval instar had a greater negative effect on adult longevity and fecundity than treatment in the 5th instar. Elimination of gut bacteria is known to negatively affect the fitness of some insect hosts, such as S. frugiperda [38]. If antibiotics affected larval development through toxicity or antifeedant effects, a greater or equal negative impact would be expected when administered in the 5th instar rather than in the 4th instar. Reintroducing a community of gut bacteria dissected from field–collected C. medinalis to 5th instar larvae that had been treated with antibiotics recovered some of the fitness traits, including adult fecundity. Currently, the degree to which gut microbes contribute to host development and fitness in Lepidoptera is debated [39,40,41,42]. Only limited studies showed significant effects of gut bacterial communities on caterpillar–plant interactions [15,26,31,41,43,44]. Mason et al. [15] reported interactions between plant defenses and gut bacteria, such that plant defenses that compromised the integrity of gut barriers in S. frugiperda larvae allowed some commensal bacteria to become opportunistic pathogens. Thus, the effects of gut bacterial community may be context–dependent, such as when the host is under dietary stress [45]. The role of bacterial communities in shaping insects’ fitness will, to some extent, vary depending on insect species and collection sites and sources.
Lastly, the composition of lepidopteran gut bacterial communities varies with geographic location and host plants [46,47,48]. In our study, we collected our field samples from rice paddies but applied the bacterial isolates and communities onto wheat leaves. Some individual isolates had detrimental effects on C. medinalis survival, which might differ if applied to rice leaves. Since the inoculation of the bacterial community from rice paddy larvae into wheat–reared antibiotic–treated larvae still exhibited beneficial effects, there may be mutualistic bacteria in C. medinalis that are present across a variety of host plants. Some individual isolates had detrimental effects on C. medinalis survival, which might vary if applied to rice leaves. Further research is needed to untangle the interactions between gut bacteria and host plants, as well as complex interactions among gut bacteria, which may vary on different host plants.

5. Conclusions

Our investigation into the effects of gut bacteria on C. medinalis fitness offers promising insights for developing novel and sustainable pest management strategies. We isolated 15 gut bacterial isolates using a culture–dependent method and identified with 16S rRNA sequencing. Alternative methods, such as multiple–locus variable number of tandem repeat analysis (MLVA), multilocus sequence analysis (MLSA), multilocus sequence typing (MLST), whole genome sequencing (WGS), and phenotypic–based techniques, could be applied to achieve more accurate bacterial species identification. Importantly, four of these isolates exerted strong adverse effects on female fecundity and 10 isolates caused high mortality. We also identified the importance of the bacterial community on improving development and fitness of the host. The knowledge gained from this study will be used in future studies of multitrophic interactions among microbes, plants, and C. medinalis to understand how the physical and chemical characteristics of crop varieties influence the interactions between the hosts and their microbes. This could lead to the selection of crop characteristics that leverage the deleterious effects of some naturally occurring gut bacteria on C. medinalis fitness.

Author Contributions

Conceptualization, Q.P., F.L. and Z.Y.; methodology, Q.P. and Q.W.; software, Q.P.; validation, Q.P., F.L. and Z.Y.; formal analysis, Q.P., Q.W. and I.S.; investigation, Q.P. and Q.W.; resources, F.L. and Z.Y.; data curation, Q.P. and Z.Y.; writing—original draft preparation, Q.P.; writing—review and editing, I.S., F.L. and Z.Y.; visualization, F.L. and Z.Y.; supervision, Z.Y.; project administration, Q.P., F.L. and Z.Y.; funding acquisition, Q.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Natural Science Foundation of Jiangsu Province, China (BK20220571) and the National Natural Science Foundation of China (No. 32302436).

Data Availability Statement

Please request any particular data through the corresponding author. Sequence data of the 15 bacterial isolates were submitted to the NCBI database (accession number PP955231–PP955245).

Acknowledgments

We thank Shichang Cheng (Yangzhou University) for insect rearing and assisting with some of the bioassays. In addition, we would like to acknowledge Zexiang Nie (Yangzhou University) for the artwork.

Conflicts of Interest

All authors declare no conflicts of interest.

References

  1. Engel, P.; Moran, N.A. The gut microbiota of insects-diversity in structure and function. FEMS Microbiol. Rev. 2013, 37, 699–735. [Google Scholar] [CrossRef] [PubMed]
  2. Douglas, A.E. Multiorganismal insects: Diversity and function of resident microorganisms. Annu. Rev. Entomol. 2015, 60, 17–34. [Google Scholar] [CrossRef] [PubMed]
  3. Shao, Y.; Mason, C.J.; Felton, G.W. Toward an integrated understanding of the lepidoptera microbiome. Annu. Rev. Phytopathol. 2024, 69, 117–137. [Google Scholar] [CrossRef] [PubMed]
  4. Indiragandhi, P.; Anandham, R.; Madhaiyan, M.; Sa, T.M. Characterization of plant growth-promoting traits of bacteria isolated from larval guts of diamondback moth Plutella xylostella (Lepidoptera: Plutellidae). Curr. Microbiol. 2008, 56, 327–333. [Google Scholar] [CrossRef] [PubMed]
  5. Pilon, F.M.; da Rocha Silva, C.; Visôtto, L.E.; de Almeida Barros, R.; Rodrigues da Silva Júnior, N.; Campos, W.G.; de Almeida Oliveira, M.G. Purification and characterization of trypsin produced by gut bacteria from Anticarsia gemmatalis. Arch. Insect Biochem. Physiol. 2017, 96, e21407. [Google Scholar] [CrossRef] [PubMed]
  6. Xia, X.F.; Gurr, G.M.; Vasseur, L.; Zheng, D.D.; Zhong, H.Z.; Qin, B.C.; Lin, J.H.; Wang, Y.; Song, F.Q.; Li, Y.; et al. Metagenomic sequencing of diamondback moth gut microbiome unveils key holobiont adaptations for herbivory. Front. Microbiol. 2017, 8, 663. [Google Scholar] [CrossRef]
  7. Bing, X.L.; Gerlach, J.; Loeb, G.; Buchon, N. Nutrient-dependent impact of microbes on Drosophila suzukii development. mBio 2018, 9, e02199-17. [Google Scholar] [CrossRef]
  8. Mason, C.J.; Lowe-Power, T.M.; Rubert-Nason, K.F.; Lindroth, R.L.; Raffa, K.F. Interactions between bacteria and aspen defense chemicals at the phyllosphere-herbivore interface. J. Chem. Ecol. 2016, 42, 193–201. [Google Scholar] [CrossRef]
  9. Mogren, C.L.; Shikano, I. Microbiota, pathogens, and parasites as mediators of tritrophic interactions between insect herbivores, plants, and pollinators. J. Invertebr. Pathol. 2021, 186, 107589. [Google Scholar] [CrossRef] [PubMed]
  10. Hu, L.; Sun, Z.; Xu, C.C.; Wang, J.; Mallik, A.U.; Gu, C.Z.; Chen, D.Q.; Lu, L.; Zeng, R.S.; Song, Y.Y. High nitrogen in maize enriches gut microbiota conferring insecticide tolerance in lepidopteran pest Spodoptera litura. iScience 2022, 25, 103726. [Google Scholar] [CrossRef]
  11. Maynard, C.L.; Elson, C.O.; Hatton, R.D.; Weaver, C.T. Reciprocal interactions of the intestinal microbiota and immune system. Nature 2012, 489, 231–241. [Google Scholar] [CrossRef] [PubMed]
  12. Weiss, B.L.; Maltz, M.; Aksoy, S. Obligate symbionts activate immune system development in the tsetse fly. J. Immunol. 2012, 188, 3395–3403. [Google Scholar] [CrossRef] [PubMed]
  13. Ridley, E.V.; Wong, A.C.; Westmiller, S.; Douglas, A.E. Impact of the resident microbiota on the nutritional phenotype of Drosophila melanogaster. PLoS ONE 2012, 7, e36765. [Google Scholar] [CrossRef] [PubMed]
  14. Pitlik, S.D.; Koren, O. How holobionts get sick-toward a unifying scheme of disease. Microbiome 2017, 5, 64. [Google Scholar] [CrossRef]
  15. Mason, C.J.; Ray, S.; Shikano, I.; Peiffer, M.; Jones, A.G.; Luthe, D.S.; Hoover, K.; Felton, G.W. Plant defenses interact with insect enteric bacteria by initiating a leaky gut syndrome. Proc. Natl. Acad. Sci. USA 2019, 116, 15991–15996. [Google Scholar] [CrossRef]
  16. Mason, K.L.; Stepien, T.A.; Blum, J.E.; Holt, J.F.; Labbe, N.H.; Rush, J.S.; Raffa, K.F.; Handelsman, J. From commensal to pathogen: Translocation of Enterococcus faecalis from the midgut to the hemocoel of Manduca sexta. mBio 2011, 2, 1–7. [Google Scholar] [CrossRef]
  17. Mason, C.J.; Peiffer, M.; St Clair, A.; Hoover, K.; Felton, G.W. Concerted impacts of antiherbivore defenses and opportunistic Serratia pathogens on the fall armyworm (Spodoptera frugiperda). Oecologia 2022, 198, 167–178. [Google Scholar] [CrossRef]
  18. Deutscher, A.T.; Burke, C.M.; Darling, A.E.; Riegler, M.; Reynolds, O.L.; Chapman, T.A. Near full-length 16S rRNA gene next-generation sequencing revealed Asaia as a common midgut bacterium of wild and domesticated Queensland fruit fly larvae. Microbiome 2018, 6, 85. [Google Scholar] [CrossRef]
  19. Chintalapati, P.; Balakrishnan, D.; Nammi, T.V.V.G.; Javvaji, S.; Muthusamy, S.K.; Venkata, S.R.L.; Neelamraju, S.; Katti, G. Phenotyping and genotype × environment interaction of resistance to leaffolder, Cnaphalocrocis medinalis Guenee (Lepidoptera: Pyralidae) in Rice. Front. Plant Sci. 2019, 10, 49. [Google Scholar] [CrossRef] [PubMed]
  20. Cheng, J.; Wang, H.; Xue, L.; Wang, J. Assessment of yield loss caused by rice leaf folder (Cnaphalocrocis medinalis) in China. J. Integr. Agr. 2017, 16, 1745–1754. [Google Scholar]
  21. Padmavathi, C.; Katti, G.; Padmakumari, A.P.; Voleti, S.R.; Rao, L.V.S. The effect of leaffolder Cnaphalocrocis medinalis (Guenee) [Lepidoptera: Pyralidae] injury on the plant physiology and yield loss in rice. J. Appl. Entomol. 2012, 137, 249–256. [Google Scholar] [CrossRef]
  22. Wang, F.Y.; Yang, F.; Lu, M.H.; Luo, S.Y.; Zhai, B.P.; Lim, K.S.; McInerney, C.E.; Hu, G. Determining the migration duration of rice leaf folder (Cnaphalocrocis medinalis (Guenée)) moths using a trajectory analytical approach. Sci. Rep. 2017, 7, 39853. [Google Scholar] [CrossRef] [PubMed]
  23. Yang, Y.J.; Liu, X.G.; Xu, H.X.; Liu, Y.H.; Ali, P.; Bodlah, M.A.; Lu, Z.X. The abundance and diversity of gut bacteria of rice leaffolder Cnaphalocrocis medinalis (Guenée) across life stages. J. Asia-Pac. Entomol. 2020, 23, 430–438. [Google Scholar] [CrossRef]
  24. Li, C.M.; Han, G.J.; Sun, J.; Huang, L.X.; Lu, Y.R.; Xia, Y.; Liu, Q.; Xu, J. The gut microbiota composition of Cnaphalocrocis medinalis and their predicted contribution to larval nutrition. Front. Microbiol. 2022, 13, 909863. [Google Scholar] [CrossRef]
  25. Lin, S.; Zhang, B.; Li, Q.; Li, X.W.; Guo, Q.T.; Chen, W.L.; Jiao, H.Y.; Akutse, K.S.; Zhu, X.Z. Gut bacterial community of Cnaphalocrocis medinalis (Guenée) (Lepidoptera: Crambidae) is driven by rice varieties. J. Appl. Entomol. 2024, 148, 434–446. [Google Scholar] [CrossRef]
  26. Pan, Q.J.; Shikano, I.; Liu, T.X.; Felton, G.W. Helicoverpa zea-associated gut bacteria as drivers in shaping plant anti-herbivore defense in tomato. Microb. Ecol. 2023, 86, 2173–2182. [Google Scholar] [CrossRef]
  27. Chen, L.; Pan, Q.J.; Waqas, M.S.; Liu, T.X. Morphological traits for sex identification of the oriental armyworm, Mythimna separata (Lepidoptera: Noctuidae). J. Integr. Agr. 2020, 19, 1458–1463. [Google Scholar] [CrossRef]
  28. Bi, S.Y.; Wang, X.D.; Tang, Y.H.; Lei, K.X.; Guo, J.Y.; Yang, N.W.; Wan, F.H.; Lü, Z.C.; Liu, W.X. Bacterial communities of the internal reproductive and digestive tracts of virgin and mated Tuta absoluta. Insects 2023, 14, 779. [Google Scholar] [CrossRef]
  29. Wang, J.; Peiffer, M.; Hoover, K.; Rosa, C.; Zeng, R.S.; Felton, G.W. Helicoverpa zea gut-associated bacteria indirectly induce defenses in tomato by triggering a salivary elicitor(s). New Phytol. 2017, 214, 1294–1306. [Google Scholar] [CrossRef]
  30. Pan, Q.J.; Shikano, I.; Hoover, K.; Liu, T.X.; Felton, G.W. Enterobacter ludwigii, isolated from the gut microbiota of Helicoverpa zea, promotes tomato plant growth and yield without compromising anti-herbivore defenses. Arthropod-Plant Interact. 2019, 13, 271–278. [Google Scholar] [CrossRef]
  31. Acevedo, F.E.; Peiffer, M.; Tan, C.W.; Stanley, B.A.; Stanley, A.; Wang, J.; Jones, A.G.; Hoover, K.; Rosa, C.; Luthe, D.; et al. Fall armyworm-associated gut bacteria modulate plant defense responses. Mol. Plant-Microbe Interact. 2017, 30, 127–137. [Google Scholar] [CrossRef] [PubMed]
  32. Jabeen, F.; Hussain, A.; Manzoor, M.; Younis, T.; Rasul, A.; Qazi, J.I. Potential of bacterial chitinolytic, Stenotrophomonas maltophilia, in biological control of termites. Egypt. J. Biol. Pest Control. 2018, 28, 86. [Google Scholar] [CrossRef]
  33. Soleimani, H.; Jamshidi, M.; Khakvar, R.; Hasheminia, S.M. Stenotrophomonas maltophilia a new biocontrol agent against the cowpea weevil Callosobruchus maculatus F. (Coleoptera: Bruchidae). Idesia 2022, 40, 17–23. [Google Scholar] [CrossRef]
  34. Al-qwabah, A.A.; Al-limoun, M.O.; Al-Mustafa, A.H.; Al-Zereini, W.A. Bacillus atrophaeus A7 crude chitinase: Characterization and potential role against Drosophila melanogaster larvae. Jordan J. Biol. Sci. 2018, 11, 451–459. [Google Scholar]
  35. Yi, Y.K.; Park, H.W.; Shrestha, S.; Seo, J.; Kim, Y.O.; Shin, C.S.; Kim, Y.G. Identification of two entomopathogenic bacteria from a nematode pathogenic to the Oriental beetle, Blitopertha orientalis. J. Microbiol. Biotechnol. 2007, 17, 968–978. [Google Scholar]
  36. Salas, B.; Conway, H.E.; Vacek, D.C.; Vitek, C.; Schuenzel, E.L. Pathogenicity of multiple Providencia species (Enterobacteriales: Morganellaceae) to the mass-reared Mexican fruit fly (Diptera: Tephritidae). J. Insect Sci. 2023, 23, 4. [Google Scholar] [CrossRef]
  37. Voirol, L.R.P.; Frago, E.; Kaltenpoth, M.; Hilker, M.; Fatouros, N.E. Bacterial symbionts in lepidoptera: Their diversity, transmission, and impact on the host. Front. Microbiol. 2018, 9, 556. [Google Scholar] [CrossRef]
  38. Fu, Y.; Zhang, L.Y.; Zhao, Q.Y.; Fu, D.Y.; Yu, H.; Xu, J.; Yang, S. Antibiotics ingestion altered the composition of gut microbes and affected the development and reproduction of the fall armyworm. J. Pest Sci. 2024, 97, 2187–2201. [Google Scholar] [CrossRef]
  39. Hammer, T.J.; Janzen, D.H.; Hallwachs, W.; Fierer, N. Caterpillars lack a resident gut microbiome. Proc. Natl. Acad. Sci. USA 2017, 114, 9641–9646. [Google Scholar] [CrossRef]
  40. Hammer, T.J.; Sanders, J.G.; Fierer, N. Not all animals need a microbiome. FEMS Microbiol. Lett. 2019, 369, fnz117. [Google Scholar] [CrossRef]
  41. Mason, C.J.; Jones, A.G.; Felton, G.W. Co-option of microbial associates by insects and their impact on plant-folivore interactions. Plant Cell Environ. 2018, 42, 1078–1086. [Google Scholar] [CrossRef] [PubMed]
  42. Mason, C.J. Complex relationships at the intersection of insect gut microbiomes and plant defenses. J. Chem. Ecol. 2020, 46, 793–807. [Google Scholar] [CrossRef] [PubMed]
  43. Hammer, T.J.; Bowers, M.D. Gut microbes may facilitate insect herbivory of chemically defended plants. Oecologia 2015, 179, 1–14. [Google Scholar] [CrossRef] [PubMed]
  44. Mason, C.J.; Couture, J.J.; Raffa, K.F. Plant-associated bacteria degrade defense chemicals and reduce their adverse effects on an insect defoliator. Oecologia 2014, 175, 901–910. [Google Scholar] [CrossRef] [PubMed]
  45. Mason, C.J.; Clair, A.S.; Peiffer, M.; Gomez, E.; Jones, A.G.; Felton, G.W.; Hoover, K. Diet influences proliferation and stability of gut bacterial populations in herbivorous lepidopteran larvae. PLoS ONE 2020, 15, e0229848. [Google Scholar] [CrossRef] [PubMed]
  46. Jones, A.G.; Mason, C.J.; Felton, G.W.; Hoover, K. Host plant and population source drive diversity of microbial gut communities in two polyphagous insects. Sci. Rep. 2019, 9, 2792. [Google Scholar] [CrossRef]
  47. Priya, N.G.; Ojha, A.; Kajla, M.K.; Raj, A.; Rajagopal, R. Host plant induced variation in gut bacteria of Helicoverpa armigera. PLoS ONE 2012, 7, e30768. [Google Scholar] [CrossRef]
  48. Staudacher, H.; Kaltenpoth, M.; Breeuwer, J.A.J.; Menken, S.B.J.; Heckel, D.G.; Groot, A.T. Variability of bacterial communities in the moth Heliothis virescens indicates transient association with the host. PLoS ONE 2016, 11, e0154514. [Google Scholar] [CrossRef]
Insects 15 00947 g001
Figure 1. Kaplan–Meier survivorship estimates of Cnaphalocrocis medinalis larvae fed from the neonate to pupation stage with leaves treated with single bacterial isolates, which were obtained from field–collected larvae. Asterisk indicates a statistically significant difference compared with the controls at α < 0.05.
Figure 1. Kaplan–Meier survivorship estimates of Cnaphalocrocis medinalis larvae fed from the neonate to pupation stage with leaves treated with single bacterial isolates, which were obtained from field–collected larvae. Asterisk indicates a statistically significant difference compared with the controls at α < 0.05.
Insects 15 00947 g001
Insects 15 00947 g002
Figure 2. Growth of bacteria from homogenized guts of Cnaphalocrocis medinalis larvae that had been fed leaves treated with an antibiotic cocktail (AB+) or not treated with antibiotics (AB–).
Figure 2. Growth of bacteria from homogenized guts of Cnaphalocrocis medinalis larvae that had been fed leaves treated with an antibiotic cocktail (AB+) or not treated with antibiotics (AB–).
Insects 15 00947 g002
Insects 15 00947 g003
Figure 3. Effects of larval gut bacteria on fitness measures of Cnaphalocrocis medinalis during the immature stage, including (A,B) the larval development time of the 5th instar, (C,D) pre–pupal time, (E,F) pupal time, and (G,H) pupal weight. Red bar represents C. medinalis larvae that were fed leaves treated with an antibiotic cocktail for the duration of the 4th instar (AB+) and the blue bar represents larvae that were not given any antibiotics (AB−). Orange bar represents C. medinalis larvae that were fed leaves treated with an antibiotic cocktail for the duration of the 5th instar (AB+) and the green bar represents larvae that were not given any antibiotics (AB−). Gray bar represents C. medinalis larvae that were inoculated with a bacterial community in the 5th instar after being fed antibiotics in the 4th instar. Values are means ± SE. Asterisk indicates a statistically significant difference compared with the controls at p < 0.05. Different letters represent significant differences between treatments at p < 0.05.
Figure 3. Effects of larval gut bacteria on fitness measures of Cnaphalocrocis medinalis during the immature stage, including (A,B) the larval development time of the 5th instar, (C,D) pre–pupal time, (E,F) pupal time, and (G,H) pupal weight. Red bar represents C. medinalis larvae that were fed leaves treated with an antibiotic cocktail for the duration of the 4th instar (AB+) and the blue bar represents larvae that were not given any antibiotics (AB−). Orange bar represents C. medinalis larvae that were fed leaves treated with an antibiotic cocktail for the duration of the 5th instar (AB+) and the green bar represents larvae that were not given any antibiotics (AB−). Gray bar represents C. medinalis larvae that were inoculated with a bacterial community in the 5th instar after being fed antibiotics in the 4th instar. Values are means ± SE. Asterisk indicates a statistically significant difference compared with the controls at p < 0.05. Different letters represent significant differences between treatments at p < 0.05.
Insects 15 00947 g003
Insects 15 00947 g004
Figure 4. Effects of larval gut bacteria on the fitness measures of Cnaphalocrocis medinalis during the adult stage, including (A,B) adult longevity and (C,D) fecundity (i.e., total eggs laid per female). Red bar represents C. medinalis larvae that were fed leaves treated with an antibiotic cocktail for the duration of the 4th instar (AB+) and the blue bar represents larvae that were not given any antibiotics (AB−). Orange bar represents C. medinalis larvae that were fed leaves treated with an antibiotic cocktail for the duration of the 5th instar (AB+) and the green bar represents larvae that were not given any antibiotics (AB−). Gray bar represents C. medinalis larvae that were inoculated with a bacterial community in the 5th instar after being fed antibiotics in the 4th instar. Values are means ± SE. Asterisk indicates a statistically significant difference compared with the controls at p < 0.05. Different letters represent significant differences between treatments at p < 0.05.
Figure 4. Effects of larval gut bacteria on the fitness measures of Cnaphalocrocis medinalis during the adult stage, including (A,B) adult longevity and (C,D) fecundity (i.e., total eggs laid per female). Red bar represents C. medinalis larvae that were fed leaves treated with an antibiotic cocktail for the duration of the 4th instar (AB+) and the blue bar represents larvae that were not given any antibiotics (AB−). Orange bar represents C. medinalis larvae that were fed leaves treated with an antibiotic cocktail for the duration of the 5th instar (AB+) and the green bar represents larvae that were not given any antibiotics (AB−). Gray bar represents C. medinalis larvae that were inoculated with a bacterial community in the 5th instar after being fed antibiotics in the 4th instar. Values are means ± SE. Asterisk indicates a statistically significant difference compared with the controls at p < 0.05. Different letters represent significant differences between treatments at p < 0.05.
Insects 15 00947 g004
Table 1. Bacterial isolates identified from the guts of field–collected Cnaphalocrocis medinalis larvae and classified with the NCBI (National Center for Biotechnology Information) database.
Table 1. Bacterial isolates identified from the guts of field–collected Cnaphalocrocis medinalis larvae and classified with the NCBI (National Center for Biotechnology Information) database.
SampleNCBI Closest MatchIdentityIdentificationGenBank No.
1MT081629.199.88%Acinetobacter soliPP955231
2MN173944.199.52%Klebsiella aerogenesPP955232
3KF938661.199.76%Enterobacter ludwigiiPP955233
4MK064226.199.64%Herbaspirillum huttiensePP955234
5MT598025.199.88%Pseudomonas mosseliiPP955235
6KF542916.199.79%Pantoea dispersaPP955236
7MG905289.199.93%Stenotrophomonas maltophiliaPP955237
8MT081681.199.76%Klebsiella pneumoniaePP955238
9KX225450.199.76%Bacillus atrophaeusPP955239
10MN889357.199.76%Chryseobacterium culicisPP955240
11KF040095.199.52%Enterococcus hiraePP955241
12MK641844.199.88%Enterobacter asburiaePP955242
13KX161909.199.76%Pantoea ananatisPP955243
14KU870748.199.58%Providencia vermicolaPP955244
15MN833504.199.57%Myroides odoratusPP955245
Table 2. Annotations at each classification level of bacterial isolates identified from the gut of field–collected Cnaphalocrocis medinalis larvae using the RDP (Ribosomal Database Project) database.
Table 2. Annotations at each classification level of bacterial isolates identified from the gut of field–collected Cnaphalocrocis medinalis larvae using the RDP (Ribosomal Database Project) database.
IsolatesPhylumClassOrderFamilyGenus
Acinetobacter soliProteobacteriaGammproteobacteriaPseudomonadalesMoraxellaceaAcinetobacter
Klebsiella aerogenesProteobacteriaGammproteobacteriaEnterobacterialesEnterobacteriaceaeUnclassified
Enterobacter ludwigiiProteobacteriaGammproteobacteriaEnterobacterialesEnterobacteriaceaeEnterobacter
Herbaspirillum huttienseProteobacteriaBetaproteobacteriaBurkholderialesOxalobacteraceaeHerbaspirillum
Pseudomonas mosseliiProteobacteriaGammproteobacteriaPseudomonadalesPseudomonadaceaePseudomonas
Pantoea dispersaProteobacteriaGammproteobacteriaEnterobacterialesErwiniaceaePantoea
Stenotrophomonas maltophiliaProteobacteriaGammproteobacteriaEnterobacterialesErwiniaceaePantoea
Klebsiella pneumoniaeProteobacteriaGammproteobacteriaEnterobacterialesEnterobacteriaceaeKlebsiella
Bacillus atrophaeusFirmicutesBacilliBacillalesBacillaceaeBacillus
Chryseobacterium culicisBacteroidetesFlavobacteriaceaeFlavobacterialesFlavobacteriaceaeChryseobacterium
Enterococcus hiraeFirmicutesBacilliLactobacillaleEnterococcaceaeEnterococcus
Enterobacter asburiaeFirmicutesBacilliLactobacillalesEnterococcaceaeEnterococcus
Pantoea ananatisProteobacteriaGammproteobacteriaEnterobacterialesEnterobacteriaceaePantoea
Providencia vermicolaProteobacteriaGammproteobacteriaEnterobacterialesMorganellaceaeProvidencia
Myroides odoratusBacteroidetesFlavobacteriaceaeFlavobacterialesFlavobacteriaceaeMyroides
Table 3. Development time of Cnaphalocrocis medinalis larvae treated with different isolates of gut bacteria. Values are means ± SE. Asterisk indicates a statistically significant difference compared with the controls at p < 0.05.
Table 3. Development time of Cnaphalocrocis medinalis larvae treated with different isolates of gut bacteria. Values are means ± SE. Asterisk indicates a statistically significant difference compared with the controls at p < 0.05.
GroupsTreatments1st Instar
Days ± SE		2nd Instar
Days ± SE		3rd Instar
Days ± SE		4th Instar
Days ± SE		5th Instar
Days ± SE		Total Larva
Days ± SE
1Control 3.68 ± 0.102.14 ± 0.102.07 ± 0.072.21 ± 0.123.86 ± 0.1514.00 ± 0.19
Acinetobacter soli3.56 ± 0.122.16 ± 0.082.12 ± 0.072.24 ± 0.123.64 ± 0.1413.72 ± 0.20
Klebsiella aerogenes3.48 ± 0.152.35 ± 0.102.22 ± 0.142.70 ± 0.12 *3.70 ± 0.1514.39 ± 0.29
Enterobacter ludwigii3.82 ± 0.092.25 ± 0.082.32 ± 0.092.36 ± 0.123.82 ± 0.1314.57 ± 0.17 *
Herbaspirillum huttiense3.96 ± 0.112.20 ± 0.082.16 ± 0.112.44 ± 0.133.96 ± 0.1714.72 ± 0.21 *
Pseudomonas mosselii4.00 ± 0.162.46 ± 0.182.92 ± 0.14 *2.23 ± 0.204.38 ± 0.14 *15.77 ± 0.46 *
2Control 3.82 ± 0.152.50 ± 0.132.29 ± 0.102.39 ± 0.143.46 ± 0.1614.46 ± 0.23
Pantoea dispersa3.50 ± 0.202.28 ± 0.112.56 ± 0.172.72 ± 0.184.56 ± 0.19 *15.61 ± 0.38
Stenotrophomonas maltophilia3.95 ± 0.142.64 ± 0.162.36 ± 0.143.05 ± 0.14 *4.05 ± 0.14 *16.10 ± 0.27 *
Klebsiella pneumoniae3.77 ± 0.142.42 ± 0.102.38 ± 0.102.65 ± 0.163.73 ± 0.1415.00 ± 0.30
Bacillus atrophaeus4.14 ± 0.222.52 ± 0.112.48 ± 0.152.62 ± 0.133.86 ± 0.1415.62 ± 0.38 *
Chryseobacterium culicis3.76 ± 0.162.71 ± 0.172.18 ± 0.102.65 ± 0.173.71 ± 0.1415.00 ± 0.35
3Control3.34 ± 0.112.24 ± 0.102.17 ± 0.092.48 ± 0.153.90 ± 0.1014.14 ± 0.17
Enterococcus hirae4.35 ± 0.12 *2.57 ± 0.11 *2.61 ± 0.182.74 ± 0.174.26 ± 0.13 *16.52 ± 0.36 *
Enterobacter asburiae3.79 ± 0.18 *2.47 ± 0.122.26 ± 0.172.58 ± 0.163.89 ± 0.1515.00 ± 0.43
Pantoea ananatis3.94 ± 0.25 *2.63 ± 0.182.44 ± 0.162.44 ± 0.13 *4.44 ± 0.1815.88 ± 0.41 *
Providencia vermicola3.27 ± 0.122.59 ± 0.182.91 ± 0.19 *3.18 ± 0.17 *4.09 ± 0.1616.05 ± 0.37 *
Myroides odoratus3.72 ± 0.162.28 ± 0.142.44 ± 0.122.44 ± 0.154.28 ± 0.14 *15.17 ± 0.29 *
Table 4. Development time of pre–pupa and pupa, and pupal weight, female ratio, adult longevity, and fecundity of Cnaphalocrocis medinalis larvae treated with different gut bacteria. Values are means ± SE. Asterisk indicates a statistically significant difference compared with the controls at p < 0.05.
Table 4. Development time of pre–pupa and pupa, and pupal weight, female ratio, adult longevity, and fecundity of Cnaphalocrocis medinalis larvae treated with different gut bacteria. Values are means ± SE. Asterisk indicates a statistically significant difference compared with the controls at p < 0.05.
GroupsTreatmentsPre–Pupa
Days ± SE		Pupa
Days ± SE		Pupal Weight
mg ± SE		Female RatioAdult Longevity
Days ± SE		Fecundity
Eggs/Female
1Control2.11 ± 0.087.07 ± 0.1321.21 ± 0.460.4313.18 ± 0.51305.33 ± 22.90
Acinetobacter soli2.08 ± 0.066.88 ± 0.1220.84 ± 0.470.4810.76 ± 0.50 *194.57 ± 23.58 *
Klebsiella aerogenes2.04 ± 0.047.04 ± 0.1222.27 ± 0.450.4811.39 ± 0.66 *354.25 ± 32.42
Enterobacter ludwigii2.21 ± 0.157.07 ± 0.1721.65 ± 0.480.4612.21 ± 0.35348.18 ± 16.80
Herbaspirillum huttiense2.12 ± 0.076.96 ± 0.1121.91 ± 0.420.4010.84 ± 0.57 *300.67 ± 12.48
Pseudomonas mosselii2.00 ± 0.167.15 ± 0.2721.88 ± 0.880.5412.31 ± 0.38318.50 ± 45.21
2Control2.00 ± 0.057.14 ± 0.1521.85 ± 0.690.5012.64 ± 0.46316.79 ± 21.00
Pantoea dispersa2.11 ± 0.087.11 ± 0.0817.42 ± 0.60 *0.5010.39 ± 0.63 *281.50 ± 16.43
Stenotrophomonas maltophilia2.05 ± 0.087.41 ± 0.1319.79 ± 0.44 *0.5010.64 ± 0.47 *208.38 ± 38.54 *
Klebsiella pneumoniae2.04 ± 0.047.50 ± 0.2818.71 ± 0.63 *0.5011.50 ± 0.63321.73 ± 17.34
Bacillus atrophaeus2.00 ± 0.007.33 ± 0.1318.73 ± 0.49 *0.6211.76 ± 0.64203.91 ± 30.87 *
Chryseobacterium culicis2.06 ± 0.107.29 ± 0.1719.05 ± 0.73 *0.4712.76 ± 0.60277.43 ± 35.85
3Control2.03 ± 0.066.86 ± 0.0819.74 ± 0.420.4811.97 ± 0.46281.00 ± 19.49
Enterococcus hirae2.09 ± 0.117.22 ± 0.11 *21.48 ± 0.60 *0.4810.61 ± 0.63279.64 ± 8.49
Enterobacter asburiae1.89 ± 0.077.21 ± 0.15 *19.62 ± 0.490.4710.68 ± 0.57286.67 ± 24.00
Pantoea ananatis2.06 ± 0.067.44 ± 0.16 *19.14 ± 0.370.4410.81 ± 0.48292.00 ± 18.23
Providencia vermicola2.14 ± 0.087.95 ± 0.31 *19.05 ± 0.430.4511.36 ± 0.54210.89 ± 26.47 *
Myroides odoratus2.11 ± 0.086.89 ± 0.1818.84 ± 0.5200.5012.17 ± 0.40294.50 ± 19.64
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pan, Q.; Wang, Q.; Shikano, I.; Liu, F.; Yao, Z. Effects of Gut Bacteria on the Fitness of Rice Leaf Folder Cnaphalocrocis medinalis. Insects 2024, 15, 947. https://doi.org/10.3390/insects15120947

AMA Style

Pan Q, Wang Q, Shikano I, Liu F, Yao Z. Effects of Gut Bacteria on the Fitness of Rice Leaf Folder Cnaphalocrocis medinalis. Insects. 2024; 15(12):947. https://doi.org/10.3390/insects15120947

Chicago/Turabian Style

Pan, Qinjian, Qingpeng Wang, Ikkei Shikano, Fang Liu, and Zhichao Yao. 2024. "Effects of Gut Bacteria on the Fitness of Rice Leaf Folder Cnaphalocrocis medinalis" Insects 15, no. 12: 947. https://doi.org/10.3390/insects15120947

APA Style

Pan, Q., Wang, Q., Shikano, I., Liu, F., & Yao, Z. (2024). Effects of Gut Bacteria on the Fitness of Rice Leaf Folder Cnaphalocrocis medinalis. Insects, 15(12), 947. https://doi.org/10.3390/insects15120947

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop