The Effects of Diet on the Immune Responses of the Oriental Armyworm Mythimna separata
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insects
2.2. Artificial Diet Preparation
2.3. Insect Growth Measurement
2.4. Dead Bacteria Preparation and Injection
2.5. Phenoloxidase Activity Assay
2.6. Melanization Assay of Sepharose Beads in the Hemolymph
2.7. Hemolymph Antimicrobial Activity Assay
2.8. Analysis of Lysozyme and Antimicrobial Peptide Gene Expression
2.9. Hemocytes Counting
2.10. Phagocytosis Assay
2.11. Statistical Analysis
3. Results
3.1. Effect of Artificial Diets on the Growth of Oriental Armyworms
3.2. Hemolymph PO Activity of Oriental Armyworms
3.3. Bead Melanization in Oriental Armyworms
3.4. Antimicrobial Activity in the Hemolymph of Oriental Armyworms
3.5. Lysozyme and AMP Gene Expression in Oriental Armyworms
3.6. Hemocyte Number of Oriental Armyworms
3.7. Phagocytosis of Oriental Armyworms
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Appendix B
Ingredients | 7:35 | 14:28 | 21:21 | 28:14 | 35:7 |
---|---|---|---|---|---|
Step 1 | |||||
Casein (g) | 0.3831 | 1.876 | 3.369 | 4.862 | 6.355 |
Albumin (g) | 0.1277 | 0.625 | 1.123 | 1.621 | 2.118 |
Peptone (g) | 0.1277 | 0.625 | 1.123 | 1.621 | 2.118 |
WDCYH salt (g) | 2 | 2 | 2 | 2 | 2 |
Cellulose (g) | 9.71 | 9.71 | 9.71 | 9.71 | 9.71 |
Cysteine HCl (g) | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 |
Choline chloride (g) | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 |
Myo-inositol (g) | 0.08 | 0.08 | 0.08 | 0.08 | 0.08 |
vitamin mix (g) | 0.325 | 0.325 | 0.325 | 0.325 | 0.325 |
Cholesterol (g) (dissolved in 14 mL Chloroform) | 0.03737 | 0.03737 | 0.03737 | 0.03737 | 0.03737 |
Ingredients are placed in a fume hood until the chloroform completely evaporated. | |||||
Step 2 | |||||
Methyl4-hydroxybenzoate (g) | 0.39 | 0.39 | 0.39 | 0.39 | 0.39 |
L-ascorbic acid (g) | 0.8 | 0.8 | 0.8 | 0.8 | 0.8 |
Chlortetracycline HCl (g) | 0.00694 | 0.00694 | 0.00694 | 0.00694 | 0.00694 |
Streptomycin (g) | 0.00694 | 0.00694 | 0.00694 | 0.00694 | 0.00694 |
Sorbic acid | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 |
Sucrose (g) (dissolved in 50 mL water) | 10.652 | 8.164 | 5.675 | 3.187 | 0.698 |
Corn leaf powder (g) | 10 | 10 | 10 | 10 | 10 |
Mix the ingredients from step 1 and step 2. | |||||
Step 3 | |||||
alcohol phase solution | |||||
dl-alpha-tocopherol acetate (mL) | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 |
alpha-linolenic acid (mL) | 0.054 | 0.054 | 0.054 | 0.054 | 0.054 |
Linoleie acid (mL) | 0.11 | 0.11 | 0.11 | 0.11 | 0.11 |
Menadione (g) | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 |
Cholecalciferol (g) | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 |
100% ethanol (mL) | 2 | 2 | 2 | 2 | 2 |
aqueous phase solution | |||||
Biotin (g) | 0.00004 | 0.00004 | 0.00004 | 0.00004 | 0.00004 |
D-Pantothenic acid (g) | 0.002 | 0.002 | 0.002 | 0.002 | 0.002 |
Cobalt chloride (g) | 0.0005 | 0.0005 | 0.0005 | 0.0005 | 0.0005 |
Folic acid (g) | 0.0005 | 0.0005 | 0.0005 | 0.0005 | 0.0005 |
Nicotinic acid amide (g) | 0.002 | 0.002 | 0.002 | 0.002 | 0.002 |
Pyridoxine HCl (g) | 0.0005 | 0.0005 | 0.0005 | 0.0005 | 0.0005 |
Riboflavin (g) | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 |
Sodium molybdate (g) | 0.0005 | 0.0005 | 0.0005 | 0.0005 | 0.0005 |
Thiamine HCl (g) | 0.0005 | 0.0005 | 0.0005 | 0.0005 | 0.0005 |
Vitamin B12 (g) | 0.000004 | 0.000004 | 0.000004 | 0.000004 | 0.000004 |
Zinc acetat (g) | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 |
H2O (mL) | 12 | 12 | 12 | 12 | 12 |
Add 2 mL alcohol phase solution and 12 mL aqueous phase solution into mixture above. | |||||
Step 4 | |||||
Agar (g) | 3 | 3 | 3 | 3 | 3 |
H2O (mL) | 150 | 150 | 150 | 150 | 150 |
Boiled agar solution were mixed with diet ingredients above. | |||||
37% formaldehyde (mL) | 0.416 | 0.416 | 0.416 | 0.416 | 0.416 |
References
- Ponton, F.; Morimoto, J.; Robinson, K.; Kumar, S.S.; Cotter, S.C.; Wilson, K.; Simpson, S.J. Macronutrients modulate survival to infection and immunity in Drosophila. J. Anim. Ecol. 2019, 89, 460–470. [Google Scholar] [CrossRef] [PubMed]
- Freitak, D.; Ots, I.; Vanatoa, A.; Hörak, P. Immune response is energetically costly in white cabbage butterfly pupae. Proc. Biol. Sci. 2003, 270, S220–S222. [Google Scholar] [CrossRef] [PubMed]
- Ojala, K.; Julkunen-Tiitto, R.; Lindatröm, L.; Mappes, J. Diet affects the immune defence and life-history traitsof an Arctiid moth Parasemia plantaginis. Evol. Ecol. Res. 2005, 7, 1153–1170. [Google Scholar]
- Rahnamaeian, M.; Cytryńska, M.; Zdybicka-Barabas, A.; Dobslaff, K.; Wiesner, J.; Twyman, R.M.; Zuchner, T.; Sadd, B.M.; Regoes, R.R.; Schmid-Hempel, P.; et al. Insect antimicrobial peptides show potentiating functional interactions against Gram-negative bacteria. Proc. Biol. Sci. 2015, 282, 20150293. [Google Scholar] [CrossRef] [PubMed]
- Kutzer, M.A.; Armitage, S.A. The effect of diet and time after bacterial infection on fecundity, resistance, and tolerance in Drosophila melanogaster. Ecol. Evol. 2016, 6, 4229–4242. [Google Scholar] [CrossRef]
- Lazzaro, B.P.; Little, T.J. Immunity in a variable world. Philos. Trans. R. Soc. B Biol. Sci. 2008, 364, 15–26. [Google Scholar] [CrossRef]
- Weger-Lucarelli, J.; Auerswald, H.; Vignuzzi, M.; Dussart, P.; Karlsson, E.A. Taking a bite out of nutrition and arbovirus infection. PLoS Negl. Trop. Dis. 2018, 12, e0006247. [Google Scholar] [CrossRef]
- Cunningham-Rundles, S.; McNeeley, D.F.; Moon, A. Mechanisms of nutrient modulation of the immune response. J. Allergy Clin. Immunol. 2005, 115, 1119–1128. [Google Scholar] [CrossRef]
- Amar, S.; Zhou, Q.; Shaik-Dasthagirisaheb, Y.; Leeman, S. Diet-induced obesity in mice causes changes in immune responses and bone loss manifested by bacterial challenge. Proc. Natl. Acad. Sci. USA 2007, 104, 20466–20471. [Google Scholar] [CrossRef]
- Brunner, F.S.; Schmid-Hempel, P.; Barribeau, S.M. Protein-poor diet reduces host-specific immune gene expression in Bombus terrestris. Proc. Biol. Sci. 2014, 281, 20140128. [Google Scholar] [CrossRef]
- Krams, I.; Kecko, S.; Kangassalo, K.; Moore, F.R.; Jankevics, E.; Inashkina, I.; Krama, T.; Lietuvietis, V.; Meija, L.; Rantala, M.J. Effects of food quality on trade-offs among growth, immunity and survival in the greater wax moth Galleria mellonella. Insect Sci. 2015, 22, 431–439. [Google Scholar] [CrossRef]
- Lee, K.P.; Cory, J.S.; Wilson, K.; Raubenheimer, D.; Simpson, S.J. Flexible diet choice offsets protein costs of pathogen resistance in a caterpillar. Proc. Biol. Sci. 2006, 273, 823–829. [Google Scholar] [CrossRef]
- Ponton, F.; Wilson, K.; Holmes, A.J.; Cotter, S.C.; Raubenheimer, D.; Simpson, S.J. Integrating nutrition and immunology: A new frontier. J. Insect Physiol. 2013, 59, 130–137. [Google Scholar] [CrossRef]
- Candian, V.; Tedeschi, R. Impact of the diet on the mortality and on gene expression of the antimicrobial peptide Tenecin 3 in Tenebrio molitor larvae infected by Beauveria bassiana. Insects 2023, 14, 359. [Google Scholar] [CrossRef]
- Felicioli, A.; Forzan, M.; Sagona, S.; D’Agostino, P.; Mazzei, M. Effect of oral administration of 1,3-1,6β-glucans in dwv naturally infected newly emerged bees (Apis mellifera L.). Vet. Sci. 2020, 7, 52. [Google Scholar] [CrossRef]
- Sagona, S.; Fronte, B.; Coppola, F.; Tafi, E.; Giusti, M.; Palego, L.; Betti, L.; Giannaccini, G.; Guglielminetti, L.; Felicioli, A. Effect of honey and syrup diets enriched with 1,3-1,6β-Glucans on honeybee survival rate and phenoloxidase activity (Apis mellifera L. 1758). Vet. Sci. 2021, 8, 130. [Google Scholar] [CrossRef]
- Krautz, R.; Arefin, B.; Theopold, U. Damage signals in the insect immune response. Front. Plant Sci. 2014, 5, 342. [Google Scholar] [CrossRef]
- Lemaitre, B.; Hoffmann, J. The host defense of Drosophila melanogaster. Annu. Rev. Immunol. 2007, 25, 697–743. [Google Scholar] [CrossRef]
- Buchon, N.; Silverman, N.; Cherry, S. Immunity in Drosophila melanogaster-from microbial recognition to whole-organism physiology. Nat. Rev. Immunol. 2014, 14, 796–810. [Google Scholar] [CrossRef]
- Jiang, H.; Vilcinskas, A.; Kanost, M.R. Immunity in lepidopteran insects. Adv. Exp. Med. Biol. 2010, 708, 181–204. [Google Scholar]
- Clark, K.D.; Strand, M.R. Hemolymph melanization in the silkmoth Bombyx mori involves formation of a high molecular mass complex that metabolizes tyrosine. J. Biol. Chem. 2013, 288, 14476–14487. [Google Scholar] [CrossRef] [PubMed]
- Lu, A.; Zhang, Q.; Zhang, J.; Yang, B.; Wu, K.; Xie, W.; Luan, Y.X.; Ling, E. Insect prophenoloxidase: The view beyond immunity. Front. Physiol. 2014, 5, 252. [Google Scholar] [CrossRef] [PubMed]
- Whitten, M.M.A.; Coates, C.J. Re-evaluation of insect melanogenesis research: Views from the dark side. Pigment Cell Melanoma Res. 2017, 30, 386–401. [Google Scholar] [CrossRef] [PubMed]
- Imler, J.-L. Overview of Drosophila immunity: A historical perspective. Dev. Comp. Immunol. 2014, 42, 3–15. [Google Scholar] [CrossRef]
- Hanson, M.A.; Lemaitre, B. New insights on Drosophila antimicrobial peptide function in host defense and beyond. Curr. Opin. Immunol. 2020, 62, 22–30. [Google Scholar] [CrossRef] [PubMed]
- Strand, M.R. The insect cellular immune response. Insect Sci. 2008, 15, 1–14. [Google Scholar] [CrossRef]
- Rosales, C. Phagocytosis, a cellular immune response in insects. Invert. Surviv. J. 2011, 8, 109–131. [Google Scholar]
- Hillyer, J.F. Insect immunology and hematopoiesis. Dev. Comp. Immunol. 2016, 58, 102–118. [Google Scholar] [CrossRef]
- Popham, H.J.R.; Shelby, K.S.; Popham, T.W. Effect of dietary selenium supplementation on resistance to baculovirus infection. Biol. Control 2005, 32, 419–426. [Google Scholar] [CrossRef]
- Popham, H.J.R.; Shelby, K.S. Effect of inorganic and organic forms of selenium supplementation on development of larval Heliothis virescens. Entomol. Exp. Appl. 2007, 125, 171–178. [Google Scholar] [CrossRef]
- Popham, H.J.R.; Shelby, K.S. Ascorbic acid influences the development and immunocompetence of larval Heliothis virescens. Entomol. Exp. Appl. 2009, 133, 57–64. [Google Scholar] [CrossRef]
- Kangassalo, K.; Valtonen, T.M.; Sorvari, J.; Kecko, S.; Pölkki, M.; Krams, I.; Krama, T.; Rantala, M.J. Independent and interactive effects of immune activation and larval diet on adult immune function, growth and development in the greater wax moth (Galleria mellonella). J. Evol. Biol. 2018, 31, 1485–1497. [Google Scholar] [CrossRef] [PubMed]
- Ponton, F.; Wilson, K.; Cotter, S.C.; Raubenheimer, D.; Simpson, S.J. Nutritional immunology: A multi-dimensional approach. PLoS Pathog. 2011, 7, e1002223. [Google Scholar] [CrossRef] [PubMed]
- Cotter, S.C.; Simpson, S.J.; Raubenheimer, D.; Wilson, K. Macronutrient balance mediates trade-offs between immune function and life history traits. Funct. Ecol. 2010, 25, 186–198. [Google Scholar] [CrossRef]
- Povey, S.; Cotter, S.C.; Simpson, S.J.; Lee, K.P.; Wilson, K. Can the protein costs of bacterial resistance be offset by altered feeding behaviour? J. Anim. Ecol. 2009, 78, 437–446. [Google Scholar] [CrossRef] [PubMed]
- Wilson, J.K.; Ruiz, L.; Davidowitz, G. Dietary protein and carbohydrates affect immune function and performance in a specialist herbivore insect (Manduca sexta). Physiol. Biochem. Zool. 2019, 92, 58–70. [Google Scholar] [CrossRef]
- Cotter, S.C.; Reavey, C.E.; Tummala, Y.; Randall, J.L.; Holdbrook, R.; Ponton, F.; Simpson, S.J.; Smith, J.A.; Wilson, K. Diet modulates the relationship between immune gene expression and functional immune responses. Insect Biochem. Mol. Biol. 2019, 109, 128–141. [Google Scholar] [CrossRef]
- Dinh, H.; Mendez, V.; Tabrizi, S.T.; Ponton, F. Macronutrients and infection in fruit flies. Insect Biochem. Mol. Biol. 2019, 110, 98–104. [Google Scholar] [CrossRef]
- Jiang, X.; Luo, L.; Zhang, L.; Sappington, T.W.; Hu, Y. Regulation of migration in Mythimna separata (Walker) in China: A review integrating environmental, physiological, hormonal, genetic, and molecular factors. Environ. Entomol. 2011, 40, 516–533. [Google Scholar] [CrossRef]
- Jia, J.; Sun, S.L.; Kuang, W.; Tang, R.; Zhang, Z.F.; Song, C.; Liu, T.X.; Jing, X. A semi-synthetic diet and the potential important chemicals for Mythimna separata (Lepidoptera: Noctuidae). J. Insect Sci. 2019, 19, 4. [Google Scholar] [CrossRef]
- Joo, H.-S.; Fu, C.-I.; Otto, M. Bacterial strategies of resistance to antimicrobial peptides. Philos. Trans. R. Soc. B Biol. Sci. 2016, 371, 20150292. [Google Scholar] [CrossRef]
- Cassat, J.E.; Skaar, E.P. Iron in infection and immunity. Cell Host Microbe 2013, 13, 509–519. [Google Scholar] [CrossRef]
- Li, J.; Ma, L.; Lin, Z.; Zou, Z.; Lu, Z. Serpin-5 regulates prophenoloxidase activation and antimicrobial peptide pathways in the silkworm, Bombyx mori. Insect Biochem. Mol. Biol. 2016, 73, 27–37. [Google Scholar] [CrossRef]
- Jiang, H.; Wang, Y.; Yu, X.-Q.; Kanost, M.R. Prophenoloxidase-activating proteinase-2 from hemolymph of Manduca sexta. J. Biol. Chem. 2003, 278, 3552–3561. [Google Scholar] [CrossRef]
- Hoffmann, D.; Hultmark, D.; Boman, H.G. Insect immunity-Galleria mellonella and other lepidoptera have cecropia-P9-like factors active against gram-negative bacteria. Insect Biochem. 1981, 11, 537–548. [Google Scholar] [CrossRef]
- Ganbaatar, O.; Cao, B.; Zhang, Y.; Bao, D.; Bao, W.; Wuriyanghan, H. Knockdown of Mythimna separata chitinase genes via bacterial expression and oral delivery of RNAi effectors. BMC Biotechnol. 2017, 17, 9. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Ma, L.; Liu, L.; Zhao, Y.; Yang, L.; Chen, C.; Li, Z.; Lu, Z. JNK pathway plays a key role in the immune system of the pea aphid and is regulated by microRNA-184. PLoS Pathog. 2020, 16, e1008627. [Google Scholar] [CrossRef]
- Melcarne, C.; Ramond, E.; Dudzic, J.; Bretscher, A.J.; Kurucz, É.; Andó, I.; Lemaitre, B. Two Nimrod receptors, NimC1 and Eater, synergistically contribute to bacterial phagocytosis in Drosophila melanoaster. FEBS J. 2019, 286, 2670–2691. [Google Scholar] [CrossRef]
- Cerenius, L.; Lee, B.L.; Soderhall, K. The proPO-system: Pros and cons for its role in invertebrate immunity. Trends Immunol. 2008, 29, 263–271. [Google Scholar] [CrossRef]
- Bruno, D.; Montali, A.; Mastore, M.; Brivio, M.F.; Mohamed, A.; Tian, L.; Grimaldi, A.; Casartelli, M.; Tettamanti, G. Insights into the immune response of the black soldier fly larvae to bacteria. Front. Immunol. 2021, 12, 745160. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.P.; Behmer, S.T.; Simpson, S.J.; Raubenheimer, D. A geometric analysis of nutrient regulation in the generalist caterpillar Spodoptera littoralis (Boisduval). J. Insect Physiol. 2002, 48, 655–665. [Google Scholar] [CrossRef] [PubMed]
- Yi, H.Y.; Chowdhury, M.; Huang, Y.D.; Yu, X.Q. Insect antimicrobial peptides and their applications. Appl. Microbiol. Biotechnol. 2014, 98, 5807–5822. [Google Scholar] [CrossRef] [PubMed]
- Moret, Y.; Schmid-Hempel, P. Immune defence in bumble-bee offspring. Nature 2001, 414, 506. [Google Scholar] [CrossRef] [PubMed]
- Nappi, A.J.; Vass, E. Melanogenesis and the genertion of cytotoxic molecules during insect cellular immune reactions. Pigmet Cell Res. 1993, 6, 117–126. [Google Scholar] [CrossRef]
- Srygley, R.B.; Jaronski, S.T. Protein deficiency lowers resistance of Mormon crickets to the pathogenic fungus Beauveria bassiana. J. Insect Physiol. 2018, 105, 40–45. [Google Scholar] [CrossRef]
- Srygley, R.B.; Lorch, P.D.; Simpson, S.J.; Sword, G.A. Immediate protein dietary effects on movement and the generalised immunocompetence of migrating Mormon crickets Anabrus simplex (Orthoptera: Tettigoniidae). Ecol. Entomol. 2009, 34, 663–668. [Google Scholar] [CrossRef]
- Yang, W.; Cheng, T.; Ye, M.; Deng, X.; Yi, H.; Huang, Y.; Tan, X.; Han, D.; Wang, B.; Xiang, Z.; et al. Functional divergence among silkworm antimicrobial peptide paralogs by the activities of recombinant proteins and the induced expression profiles. PLoS ONE 2011, 6, e18109. [Google Scholar] [CrossRef]
- Blois, M.S. The melanins: Their synthesis and structure. In Photochemical and Photobiological Reviews; Smith, K.C., Ed.; Springer: Boston, MA, USA, 1978; pp. 115–134. [Google Scholar]
- Cotter, S.C.; Kruuk, L.E.B.; Wilson, K. Costs of resistance: Genetic correlations and potential trade-offs in an insect immune System. J. Evol. Biol. 2003, 17, 421–429. [Google Scholar] [CrossRef]
- Ulvila, J.; Vanha-Aho, L.-M.; RÄMet, M. Drosophila phagocytosis-still many unknowns under the surface. APMIS 2011, 119, 651–662. [Google Scholar] [CrossRef]
- Mylonakis, E.; Podsiadlowski, L.; Muhammed, M.; Vilcinskas, A. Diversity, evolution and medical applications of insect antimicrobial peptides. Philos. Trans. R. Soc. B Biol. Sci. 2016, 371, 20150290. [Google Scholar] [CrossRef] [PubMed]
- Shah, A.A.; Totakul, P.; Matra, M.; Cherdthong, A.; Hanboonsong, Y.; Wanapat, M. Nutritional composition of various insects and potential uses as alternative protein sources in animal diets. Anim. Biosci. 2022, 35, 317–331. [Google Scholar] [CrossRef] [PubMed]
- Shah, A.; Wanapat, M. Gryllus testaceus walker (crickets) farming management, chemical composition, nutritive profile, and their effect on animal digestibility. Entomol. Res. 2021, 51, 639–649. [Google Scholar] [CrossRef]
Gene | Primer Sequence (5′→3′) |
---|---|
Msβ-actin | F: TTCAACACACCCGCCATGTA R: CGTAACCCTCGTAGATGGGC |
MsCecropin | F: GTGCGTTTGCTTCGTCATCA R: GGCTTTGGTGAGCACGTCTA |
MsLysozyme | F: GTTCTCCACCAGGCATACCC R: TGCGACGATTTGCTTGGTTG |
MsGloverin | F: TGGGGCTTGTCATGTCCAAA R: TGACTCTCTCAGGTGATGGAGT |
Source of Variation | d.f. | SS | MS | F | p |
---|---|---|---|---|---|
NaCl injection | |||||
Time × Diet | 4 | 0.0002872 | 7.181 × 10−5 | 3.497 | 0.0134 |
Time | 2 | 8.056 × 10−5 | 4.028 × 10−5 | 1.962 | 0.1511 |
Diet | 2 | 0.0001753 | 8.765 × 10−5 | 4.268 | 0.0193 |
Residual | 51 | 0.001047 | 2.053 × 10−5 | ||
E. coli challenge | |||||
Time × Diet | 4 | 0.0007592 | 0.0001898 | 4.702 | 0.0026 |
Time | 2 | 0.01956 | 0.009780 | 242.3 | <0.0001 |
Diet | 2 | 0.002073 | 0.001036 | 25.67 | <0.0001 |
Residual | 51 | 0.002059 | 4.037 × 10−5 | ||
M. luteus challenge | |||||
Time × Diet | 4 | 0.002452 | 0.0006131 | 7.833 | <0.0001 |
Time | 2 | 0.002953 | 0.001477 | 18.87 | <0.0001 |
Diet | 2 | 0.004398 | 0.002199 | 28.10 | <0.0001 |
Residual | 54 | 0.004227 | 7.827 × 10−5 |
Treatment | NaCl Injection | E. coli Challenge | M. luteus Challenge | |
---|---|---|---|---|
Gene | ||||
Gloverin | F2,24 = 6.775 | F2,24 = 7.249 | F2,24 = 10.00 | |
p = 0.0046 | p = 0.0034 | p = 0.0007 | ||
Cecropin | F2,24 = 11.71 | F2,24 = 10.23 | F2,24 = 10.80 | |
p = 0.0003 | p = 0.0006 | p = 0.0005 | ||
Lysozyme | F2,33 = 25.64 | F2,24 = 2.360 | F2,24 = 3.290 | |
p < 0.0001 | p = 0.1159 | p = 0.0546 |
Source of Variation | d.f. | SS | MS | F | P |
---|---|---|---|---|---|
NaCl injection | |||||
Time × Diet | 2 | 3.459 | 1.730 | 1.308 | 0.2798 |
Time | 1 | 18.34 | 18.34 | 13.87 | 0.0005 |
Diet | 2 | 11.87 | 5.934 | 4.488 | 0.0163 |
Residual | 48 | 63.47 | 1.322 | ||
E. coli challenge | |||||
Time × Diet | 2 | 0.2546 | 0.1273 | 0.07581 | 0.9271 |
Time | 1 | 0.3612 | 0.3612 | 0.2151 | 0.6449 |
Diet | 2 | 4.250 | 2.125 | 1.265 | 0.2914 |
Residual | 48 | 80.61 | 1.679 | ||
M. luteus challenge | |||||
Time × Diet | 2 | 0.2566 | 0.1283 | 0.1665 | 0.8471 |
Time | 1 | 4.100 | 4.100 | 5.320 | 0.0255 |
Diet | 2 | 0.8762 | 0.4381 | 0.5685 | 0.5702 |
Residual | 47 | 36.22 | 0.7706 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, L.; Ma, L.; Liu, L.; Sun, S.; Jing, X.; Lu, Z. The Effects of Diet on the Immune Responses of the Oriental Armyworm Mythimna separata. Insects 2023, 14, 685. https://doi.org/10.3390/insects14080685
Zhou L, Ma L, Liu L, Sun S, Jing X, Lu Z. The Effects of Diet on the Immune Responses of the Oriental Armyworm Mythimna separata. Insects. 2023; 14(8):685. https://doi.org/10.3390/insects14080685
Chicago/Turabian StyleZhou, Lizhen, Li Ma, Lu Liu, Shaolei Sun, Xiangfeng Jing, and Zhiqiang Lu. 2023. "The Effects of Diet on the Immune Responses of the Oriental Armyworm Mythimna separata" Insects 14, no. 8: 685. https://doi.org/10.3390/insects14080685
APA StyleZhou, L., Ma, L., Liu, L., Sun, S., Jing, X., & Lu, Z. (2023). The Effects of Diet on the Immune Responses of the Oriental Armyworm Mythimna separata. Insects, 14(8), 685. https://doi.org/10.3390/insects14080685