Uncovering the Male Presence in Parthenogenetic Marchalina hellenica (Hemiptera: Marchalinidae): Insights into Its mtDNA Divergence and Reproduction Strategy
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Genetic Structure of Marchalina hellenica in Greece
2.2. Biological Traits of Marchalina hellenica Males
Statistical Analysis
3. Results
3.1. Genetic Structure of Marchalina hellenica in Greece
3.2. Biological Traits of Marchalina hellenica Males
4. Discussion
4.1. Genetic Structure of Marchalina hellenica in Greece
4.2. Biological Traits of Marchalina hellenica Males
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Gounari, S. Studies on the phenology of Marchalina hellenica (Gen.) (Hemiptera: Coccoidea: Margarodidae) in relation to honeydew flow. J. Apic. Res. 2006, 45, 8–12. [Google Scholar] [CrossRef]
- Gounari, S.; Zotos, C.E.; Dafnis, S.D.; Moschidis, G.; Papadopoulos, G.K. On the impact of critical factors to honeydew honey production: The case of Marchalina hellenica and pine honey. J. Apic. Res. 2021, 62, 383–393. [Google Scholar] [CrossRef]
- Ülgentürk, S.; Szentkirályi, F.; Uygun, N.; Fent, M.; Gaimari, S.D.; Civelek, H.; Ayhan, B. Predators of Marchalina hellenica (Hemiptera: Marchalinidae) on pine forests in Turkey. Phytoparasitica 2013, 41, 529–537. [Google Scholar] [CrossRef]
- Dafnis, S.D.; Gounari, S.; Zotos, C.E.; Papadopoulos, G.K. The effect of cold periods on the biological cycle of Marchalina hellenica. Insects 2022, 13, 375. [Google Scholar] [CrossRef] [PubMed]
- Gounari, S. Seasonal development and ovipositing behavior of Marchalina hellenica (Hemiptera: Margarodidae). Entomol. Hell. 2004, 15, 27–38. [Google Scholar] [CrossRef][Green Version]
- Bacandritsos, N.; Saitanis, C.; Papanastasiou, I. Morphology and life cycle of Marchalina hellenica (Gennadius) (Hemiptera: Margarodidae) on pine (Parnis Mt.) and fir (Helmos Mt.) forests of Greece. Ann. Soc. Entomol. Fr. 2004, 40, 169–176. [Google Scholar] [CrossRef]
- Avtzis, N. Marchalina hellenica (Monophlebus hellenicus) Gen. An important honey producing insect of Greece. Das. Erevna 1985, 6, 51–63. [Google Scholar]
- Kailidis, S.D. Monophlebus hellenicus (Marchalina hellenica) Genn. The honeydew producing insect of pine trees. Das. Chron. 1965, 81, 1–16. [Google Scholar]
- Fimiani, P.; Solino, G. An exotic insect dangerous to the native plants of the island of Ischia. Inf. Agrar. 1994, 50, 65–68. [Google Scholar]
- Masten Milek, T.; Simala, M.; Pintar, M. First record of Marchalina hellenica (Gennadius) (Hemiptera: Marchalinidae) in Croatia. In Proceedings of the XVth International Symposium on Scale Insect Studies, Zagreb, Croatia, 17–20 June 2019. [Google Scholar]
- Avtzis, D.N.; Lubanga, U.K.; Lefoe, G.K.; Kwong, R.M.; Eleftheriadou, N.; Andreadi, A.; Elms, S.; Shaw, R.; Kenis, M. Prospects for classical biological control of Marchalina hellenica in Australia. BioControl 2020, 65, 413–423. [Google Scholar] [CrossRef]
- Jashenko, R.V. Fauna, natural enemies, agricultural harm and possibility of industrial use of margarodids (Coccinea, Margarodidae) in East Europe and North Asia. Selevinia 1999, 10, 43–50. [Google Scholar]
- Hodgson, C.; Gounari, S. Morphology of Marchalina hellenica (Gennadius) (Hemiptera: Coccoidea: Marchalinidae) from Greece, with a discussion on the identity of M. caucasica Hadzibeyli from the Caucasus. Zootaxa 2006, 1196, 1–32. [Google Scholar] [CrossRef]
- Fotelli, M.N.; Lyrou, F.G.; Avtzis, D.N.; Maurer, D.; Rennenberg, H.; Spyroglou, G.; Polle, A.; Radoglou, K. Effective defense of aleppo pine against the giant scale Marchalina hellenica through ecophysiological and metabolic changes. Front. Plant Sci. 2020, 11, 581693. [Google Scholar] [CrossRef] [PubMed]
- Gallis, A.T. Evaluation of the damage by insect Marchalina hellenica (Genn.) in eastern Attica, Greece. Conclusions for sustainable management of forest ecosystems. In Proceedings of the 10th International Conference on Environmental Science and Technology, G-NEST and University of Aegean, Athens, Greece, 5–7 September 2007. [Google Scholar]
- Mendel, Z.; Branco, M.; Battisti, A. Invasive sap–sucker insects in the Mediterranean basin. In Insects and Diseases of Mediterranean Forest Systems; Paine, T.D., Lieutier, F., Eds.; Springer International Publishing: Cham, Switzerland, 2016; pp. 261–291. [Google Scholar]
- Garonna, A.P.; Viggiani, G. The establishment in Italy of Neoleucopis kartliana (Tanasjtshuk) (Diptera: Chamaemyiidae), predator of Marchalina hellenica (Gennadius) (Hemiptera: Margarodidae). In Proceedings of the XXIII Italian National Congress of Entomology, Genoa, Italy, 13–16 June 2011. [Google Scholar]
- Eleftheriadou, N.; Lubanga, U.; Lefoe, G.; Seehausen, M.L.; Kenis, M.; Kavallieratos, N.G.; Avtzis, D.N. Phenology and potential fecundity of Neoleucopis kartliana in Greece. Insects 2022, 13, 143. [Google Scholar] [CrossRef] [PubMed]
- Normark, B.B. The evolution of alternative genetic systems in insects. Annu. Rev. Entomol. 2003, 48, 397–423. [Google Scholar] [CrossRef]
- Rodriguero, M.S. Parthenogenesis. In Reproductive Strategies in Insects, 1st ed; Omkar, Mishra, G., Eds.; CRC Press: Boca Raton, FL, USA, 2022; pp. 35–71. [Google Scholar]
- Cook, L.G.; Gullan, P.J.; Trueman, H.E. A preliminary phylogeny of the scale insects (Hemiptera: Sternorrhyncha: Coccoidea) based on nuclear small-subunit ribosomal DNA. Mol. Phylogenet. Evol. 2002, 25, 43–52. [Google Scholar] [CrossRef]
- Danzig, E.M. Coccids of the Far Eastern USSR (Homoptera: Coccinea) with Phylogenetic Analysis of Coccids in the World Fauna; Nauka Publisher: Leningrad, Russia, 1980. [Google Scholar]
- Vershinina, A.O.; Kuznetsova, V.G. Parthenogenesis in Hexapoda: Entognatha and non-holometabolous insects. J. Zoolog. Syst. Evol. 2016, 54, 257–268. [Google Scholar] [CrossRef]
- Gavrilov-Zimin, I.A.; Stekolshchikov, A.V.; Gautam, D.C. General trends of chromosomal evolution in Aphidococca (Insecta: Homoptera: Aphidinea + Coccinea). Comp. Cytogenet. 2015, 9, 335. [Google Scholar] [CrossRef]
- Nur, U. Parthenogenesis in coccids (Homoptera). Am. Zool. 1971, 11, 301–308. [Google Scholar] [CrossRef][Green Version]
- Ross, L.; Pen, I.; Shuker, D.M. Genomic conflict in scale insects: The causes and consequences of bizarre genetic systems. Biol. Rev. 2010, 85, 807–828. [Google Scholar] [CrossRef] [PubMed]
- Gavrilov, I.A.; Trapeznikova, I.V. Cytogenetic studies of European Pulvinariini (Homoptera: Coccidae). Comp. Cytogenet. 2008, 2, 131–138. [Google Scholar]
- Hovasse, R. Quelquel données nouvelles sur la Cochenille Marchalina hellenica (Genn.). Compt. Rend. Séances Acad. Sci. 1930, 190, 1025–1026. [Google Scholar]
- De Marzo, L.; Romano, V.; Tranfaglia, A. Types of the reproductive system in some scale insects (Homoptera: Coccoidea). In Proceedings of the VI International Symposium of Scale Insect Studies; Part II., Krakow, Poland, 6–12 August 1990. [Google Scholar]
- Nikolopoulos, C. On Discovering the Until Now Unknown Male Insect of the Species Marchalina hellenica (Gennadius); Agricultural University of Athens: Athens, Greece, 1964; p. 16. [Google Scholar]
- Minachilis, K. Study of the Morphology and Bioecology of the Male Individual of the Insect Marchalina hellenica Genn. PhD. Thesis, Agricultural University, Athens, Greece, 2002. [Google Scholar]
- Hodgson, C.; Foldi, I. A review of the Margarodidae sensu Morrison (Hemiptera: Coccoidea) and some related taxa based on the morphology of adult males. Zootaxa 2006, 1263, 1–250. [Google Scholar] [CrossRef]
- Ülgentürk, S.; Civelek, H.; Dostbil, Ö. Researches on bioecology of the giant pine scale, Marchalina hellenica Gennadius (Hemiptera: Marchalinidae) and relation with its predator Neoleucopis kartliana (Tanasijtshuk) (Diptera: Chamaemyiidae). Mun. Ent. Zool. 2021, 16, 1056–1069. [Google Scholar]
- Peacock, L.; Worner, S.P. Biological and ecological traits that assist establishment of alien invasive insects. N. Z. Plant Prot. 2008, 61, 1–7. [Google Scholar] [CrossRef]
- Vrijenhoek, R.C. Animal clones and diversity. Bioscience 1998, 48, 617–628. [Google Scholar] [CrossRef]
- Crease, T.J.; Stanton, D.J.; Hebert, P.D. Polyphyletic origins of asexuality in Daphnia pulex. II. Mitochondrial-DNA variation. Evolution 1989, 43, 1016–1026. [Google Scholar]
- Bouga, M.; Evangelou, V.; Lykoudis, D.; Cakmak, I.; Hatjina, F. Genetic structure of Marchalina hellenica (Hemiptera: Margarodidae) populations from Turkey: Preliminary mtDNA sequencing data. Biochem. Genet. 2011, 49, 683–694. [Google Scholar] [CrossRef]
- Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Marine Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
- QGIS Development Team. QGIS Geographic Information System. Open Source Geospatial Foundation Project. 2023. Available online: http://qgis.osgeo.org (accessed on 3 February 2023).
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing, R Core Team: Vienna, Austria, 2021. [Google Scholar]
- White, M.J.D. Animal Cytology and Evolution, 3rd ed.; Cambridge University Press: London, UK; New York, NY, USA, 1973. [Google Scholar]
- Bell, G. The Masterpiece of Nature. The Evolution and Genetics of Sexuality, 1st ed.; University of California Press: Berkley, LA, USA, 1982. [Google Scholar]
- Jaron, K.S.; Parker, D.J.; Anselmetti, Y.; Tran Van, P.; Bast, J.; Dumas, Z.; Figuet, E.; François, C.M.; Hayward, K.; Rossier, V.; et al. Convergent consequences of parthenogenesis on stick insect genomes. Sci. Adv. 2022, 8, 3842. [Google Scholar] [CrossRef]
- Avtzis, D.N.; Matošević, D. Taking Europe by storm: A first insight in the introduction and expansion of Dryocosmus kuriphilus in central Europe by mtDNA. Šumar. List 2013, 137, 387–394. [Google Scholar]
- Askew, R.R. The biology of gall wasps. In Biology of Gall Insects; Anantakrishnan, T.N., Ed.; Edward Arnold: London, UK, 1984; pp. 223–271. [Google Scholar]
- Turner, B.D.; Ali, N. Population variability in a domestic stored product pest, the parthenogenetic psocid Liposcelis bostrychophila: Implications for control. In Proceedings of the 1st International Conference Insect Pest in Urban Environment; St. John’s College, University of Cambridge: Cambridge, UK, 1993. [Google Scholar]
- Norton, R.A.; Kethley, J.B.; Johnston, D.E.; O’Connor, B.M. Phylogenetic perspectives on genetic systems and reproductive modes of mites. In Evolution and Diversity of Sex Ratio in Insects and Mites; Wrensch, D.L., Ebbert, M.A., Eds.; Chapman and Hall: New York, NY, USA, 1993; pp. 8–99. [Google Scholar]
- Davis, M.A. Invasion Biology; Oxford University Press: Oxford, UK, 2009. [Google Scholar]
- Liebhold, A.M.; Tobin, P.C. Population ecology of insect invasions and their management. Annu. Rev. Entomol. 2008, 53, 387–408. [Google Scholar] [CrossRef] [PubMed]
- Brockerhoff, E.G.; Liebhold, A.M. Ecology of forest insect invasions. Biol. Invasions 2017, 19, 3141–3159. [Google Scholar] [CrossRef]
- Shreve, S.M.; Mockford, E.L.; Johnson, K.P. Elevated genetic diversity of mitochondrial genes in asexual populations of Bark Lice (‘Psocoptera’: Echmepteryx hageni). Mol. Ecol. 2011, 20, 4433–4451. [Google Scholar] [CrossRef] [PubMed]
- Kearney, M. Hybridization, glaciation and geographical parthenogenesis. Trends Ecol. Evol. 2005, 20, 495–502. [Google Scholar] [CrossRef] [PubMed]
- Lundmark, M.; Saura, A. Asexuality alone does not explain the success of clonal forms in insects with geographical parthenogenesis. Hereditas 2006, 143, 23–32. [Google Scholar] [CrossRef]
- Schön, I.; Martens, K.; van Dijk, P. Lost Sex. The Evolutionary Biology of Parthenogenesis; Springer: Dordrecht, The Netherlands, 2009; pp. 1–615. [Google Scholar]
- Merriwether, D.A.; Clark, A.G.; Ballinger, S.W.; Schurr, T.G.; Soodyall, H.; Jenkins, T.; Sherry, S.T.; Wallace, D.C. The structure of human mitochondrial DNA variation. J. Mol. Evol. 1991, 33, 33543–33555. [Google Scholar] [CrossRef]
- Richter, C.; Park, J.W.; Ames, B.N. Normal oxidative damage to mitochondrial and nuclear DNA is extensive. Proc. Natl. Acad. Sci. USA 1988, 85, 6465–6467. [Google Scholar] [CrossRef]
- Wallace, D.C. Mitochondrial DNA sequence variation in human evolution and disease. Proc. Natl. Acad. Sci. USA. 1994, 91, 8739–8746. [Google Scholar] [CrossRef]
- Dawson, K.J. Evolutionarily stable mutation rates. J. Theor. Biol. 1998, 194, 143–157. [Google Scholar] [CrossRef]
- Kondrashov, A.S. Deleterious mutations and the evolution of sexual reproduction. Nature 1988, 336, 435–441. [Google Scholar] [CrossRef] [PubMed]
- Moritz, C. Evolutionary dynamics of mitochondrial DNA duplications in parthenogenetic geckos, Heteronotia binoei. Genetics 1991, 129, 221–230. [Google Scholar] [CrossRef] [PubMed]
- Zevering, C.E.; Moritz, C.; Heideman, A.; Sturm, R.A. Parallel origins of duplications and the formation of pseudogenes in mitochondrial DNA from parthenogenetic lizards (Heteronotia binoei; Gekkonidae). J. Mol. Evol. 1991, 33, 431–441. [Google Scholar] [CrossRef] [PubMed]
- Kvist, L.; Martens, J.; Nazarenko, A.A.; Orell, M. Paternal leakage of mitochondrial DNA in the great tit (Parus major). Mol. Biol. Evol. 2003, 20, 243–247. [Google Scholar] [CrossRef] [PubMed]
- Nunes, M.D.; Dolezal, M.; Schlötterer, C. Extensive paternal mt DNA leakage in natural populations of Drosophila melanogaster. Mol. Ecol. 2013, 22, 2106–2117. [Google Scholar] [CrossRef]
- Elzinga, J.A.; Jokela, J.; Shama, L.N. Large variation in mitochondrial DNA of sexual and parthenogenetic Dahlica triquetrella (Lepidoptera: Psychidae) shows multiple origins of parthenogenesis. BMC Evol. Biol. 2013, 13, 1–9. [Google Scholar] [CrossRef] [PubMed][Green Version]
- De Mandal, S.; Chhakchhuak, L.; Gurusubramanian, G.; Kumar, N.S. Mitochondrial markers for identification and phylogenetic studies in insects—A Review. DNA Barcodes 2014, 2, 1–9. [Google Scholar] [CrossRef]
- Meng, L.; Wang, Y.; Wei, W.H.; Zhang, H. Population genetic structure of Diaphorina citri Kuwayama (Hemiptera: Liviidae): Host-driven genetic differentiation in China. Sci. Rep. 2018, 8, 1473. [Google Scholar] [CrossRef]
- Rattanawannee, A.; Chongrattanameteekul, W. Genetic variation of cassava mealybug, Phenacoccus manihoti (Hemiptera: Pseudococcidae), based on DNA sequences from mitochondrial and nuclear genes. Walailak J. Sci Technol. 2016, 13, 123–132. [Google Scholar]
- Wosula, E.N.; Chen, W.; Amour, M.; Fei, Z.; Legg, J.P. KASP genotyping as a molecular tool for diagnosis of cassava-colonizing Bemisia tabaci. Insects 2020, 11, 305. [Google Scholar] [CrossRef]
- Petrakis, P.V.; Spanos, K.; Feest, A. Insect biodiversity reduction of pine woods in southern Greece caused by the pine scale (Marchalina hellenica). For. Syst. 2011, 20, 27–41. [Google Scholar]
- Schiller, G.; Mendel, Z. Is the overlap of ranges of aleppo pine and brutia pine in the east Mediterranean natural or due to human activity? In Population Genetics and Genetic Conservation of Forest Trees; Baradat, P., Adams, W.T., Miiller-Starck, G., Eds.; SPB Academic Publishing: Amsterdam, The Netherlands, 1995; pp. 159–163. [Google Scholar]
- Zalewski, A.; Michalska-Parda, A.; Ratkiewicz, M.; Kozakiewicz, M.; Bartoszewicz, M.; Brzeziński, M. High mitochondrial DNA diversity of an introduced alien carnivore: Comparison of feral and ranch American mink Neovison vison in Poland. Divers. Distrib. 2011, 17, 757–768. [Google Scholar] [CrossRef]
- Martinez-Sañudo, I.; Mazzon, L.; Simonato, M.; Avtzis, D.; Pujade-Villar, J.; Faccoli, M. Tracking the origin and dispersal of the Asian chestnut gall wasp Dryocosmus kuriphilus Yasumatsu (Hymenoptera: Cynipidae) in Europe with molecular markers. Bull. Entomol. Res. 2019, 109, 300–308. [Google Scholar] [CrossRef]
- Gullan, P.J.; Kosztarab, M. Adaptations in scale insects. Annu. Rev. Entomol. 1997, 42, 23–50. [Google Scholar] [CrossRef]
- Gavrilov, I.A.; Kuznetsova, V.G. On some terms used in the cytogenetics and reproductive biology of scale insects (Homoptera: Coccinea). Comp. Cytogenet. 2007, 1, 169–174. [Google Scholar]
- Sánchez, L. Sex-determining mechanisms in insects. Int. J. Dev. Biol. 2004, 52, 837–856. [Google Scholar] [CrossRef]
- Morgan-Richards, M.A.R.Y.; Trewick, S.A.; Stringer, I.A. Geographic parthenogenesis and the common tea-tree stick insect of New Zealand. Mol. Ecol. 2010, 19, 1227–1238. [Google Scholar] [CrossRef]
- Suomalainen, E. Parthenogenesis in animals. Adv. Genet. 1950, 3, 193–253. [Google Scholar]
- Kondo, T.; Kondo, T.; Gullan, P.J. Family: Marchalinidae. In Encyclopedia of Scale Insect Pests; Kondo, T., Watson, G.W., Eds.; CABI: Wallingford, UK, 2022; pp. 82–85. [Google Scholar]
- Martín-Peciña, M.; Osuna-Mascaró, C. Digest: The Red Queen hypothesis demonstrated by the Daphnia-Caullerya host-parasite system. Evolution 2018, 72, 715–716. [Google Scholar] [CrossRef]
- Lively, C.M.; Craddock, C.; Vrijenhoek, R.C. Red Queen hypothesis supported by parasitism in sexual and clonal fish. Nature 1990, 344, 864–866. [Google Scholar] [CrossRef]
- Jokela, J.; Dybdahl, M.F.; Lively, C.M. The maintenance of sex, clonal dynamics, and host-parasite coevolution in a mixed population of sexual and asexual snails. Am. Nat. 2009, 174, S43–S53. [Google Scholar] [CrossRef] [PubMed]
- Hamilton, W.D.; Axelrod, R.; Tanese, R. Sexual reproduction as an adaptation to resist parasites (a review). Proc. Natl. Acad. Sci. USA 1990, 87, 3566–3573. [Google Scholar] [CrossRef]
- Howard, R.S.; Lively, C.M. Parasitism, mutation accumulation and the maintenance of sex. Nature 1994, 367, 554–557. [Google Scholar] [CrossRef] [PubMed]
- Jaenike, J. A hypothesis to account for the maintenance of sex within populations. Evol. Theory 1978, 3, 191–194. [Google Scholar]
- Glesener, R.R.; Tilman, D. Sexuality and the components of environmental uncertainty: Clues from geographic parthenogenesis in terrestrial animals. Am. Nat. 1978, 112, 659–673. [Google Scholar] [CrossRef]
- Nur, U. Parthenogenesis. In Armored Scale Insects: Their Biology, Natural Enemies and Control; Rosen, D., Ed.; Elsevier: Amsterdam, The Netherlands, 1990; Volume 2, pp. 191–197. [Google Scholar]
- Vandel, A.P.M. La parthéogenèse géographique: Contribution á l’étude biologique et cytologique de la parthéogenèse naturelle. Lab. D’évolution Des Êtres Organisés 1928, 37, 255–256. [Google Scholar]
- Lynch, M. Destabilizing hybridization, general-purpose genotypes and geographic parthenogenesis. Q. Rev. Biol. 1984, 59, 257–290. [Google Scholar] [CrossRef]
- Hoshino, M.; Hiruta, S.F.; Croce, M.E.; Kamiya, M.; Jomori, T.; Wakimoto, T.; Kogame, K. Geographical parthenogenesis in the brown alga Scytosiphon lomentaria (Scytosiphonaceae): Sexuals in warm waters and parthenogens in cold waters. Mol. Ecol. 2021, 30, 5814–5830. [Google Scholar] [CrossRef]
- Hoy Jensen, L.; Enghoff, H.; Frydenberg, J.; Parker Jr, E.D. Genetic diversity and the phylogeography of parthenogenesis: Comparing bisexual and thelytokous populations of Nemasoma varicorne (Diplopoda: Nemasomatidae) in Denmark. Hereditas 2002, 136, 184–194. [Google Scholar] [CrossRef]
- Liebhold, A.M.; Yamanaka, T.; Roques, A.; Augustin, S.; Chown, S.L.; Brockerhoff, E.G.; Pyšek, P. Global compositional variation among native and non-native regional insect assemblages emphasizes the importance of pathways. Biol. Invasions 2016, 18, 893–905. [Google Scholar] [CrossRef]
- Macfarlane, R.P.; Maddison, P.A.; Andrew, I.G.; Berry, J.A.; Johns, P.M.; Hoare, R.J.B.; Greenslade, P.; Henderson, R.C.; Smithers, C.N. Trewick, S.A.; et al. Phylum Arthropoda subphylum Hexapoda: Protura, springtails, diplura, and insects. N. Zealand Inv. Biodiver. 2010, 2, 233–467. [Google Scholar]
- Aukema, J.E.; McCullough, D.G.; Von Holle, B.; Liebhold, A.M.; Britton, K.; Frankel, S.J. Historical accumulation of nonindigenous forest pests in the continental United States. BioScience 2010, 60, 886–897. [Google Scholar] [CrossRef]
- Mondor, E.B.; Tremblay, M.N.; Messing, R.H. Morphological and ecological traits promoting aphid colonization of the Hawaiian Islands. Biol. Invasions 2007, 9, 87–100. [Google Scholar] [CrossRef]
Source | COI mtDNA Sequence |
---|---|
Turkey (GenBank HQ225738) | ATTAATACATCATTTTTCAATCCAAGAAGAAATGGAAGTCCA |
Greece (GPS-HT1 GenBank OQ506006) | ATTAATACATCATTTTTCAATCCAAGAAGAAATGGAAGTCCA |
Greece (GPS-HT2 GenBank OQ506007) | ATTAATACATCATTTTTTAATCCAAGAAGAAATGGAAGTCCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Eleftheriadou, N.; Lubanga, U.K.; Lefoe, G.K.; Seehausen, M.L.; Kenis, M.; Kavallieratos, N.G.; Avtzis, D.N. Uncovering the Male Presence in Parthenogenetic Marchalina hellenica (Hemiptera: Marchalinidae): Insights into Its mtDNA Divergence and Reproduction Strategy. Insects 2023, 14, 256. https://doi.org/10.3390/insects14030256
Eleftheriadou N, Lubanga UK, Lefoe GK, Seehausen ML, Kenis M, Kavallieratos NG, Avtzis DN. Uncovering the Male Presence in Parthenogenetic Marchalina hellenica (Hemiptera: Marchalinidae): Insights into Its mtDNA Divergence and Reproduction Strategy. Insects. 2023; 14(3):256. https://doi.org/10.3390/insects14030256
Chicago/Turabian StyleEleftheriadou, Nikoleta, Umar K. Lubanga, Greg K. Lefoe, M. Lukas Seehausen, Marc Kenis, Nickolas G. Kavallieratos, and Dimitrios N. Avtzis. 2023. "Uncovering the Male Presence in Parthenogenetic Marchalina hellenica (Hemiptera: Marchalinidae): Insights into Its mtDNA Divergence and Reproduction Strategy" Insects 14, no. 3: 256. https://doi.org/10.3390/insects14030256
APA StyleEleftheriadou, N., Lubanga, U. K., Lefoe, G. K., Seehausen, M. L., Kenis, M., Kavallieratos, N. G., & Avtzis, D. N. (2023). Uncovering the Male Presence in Parthenogenetic Marchalina hellenica (Hemiptera: Marchalinidae): Insights into Its mtDNA Divergence and Reproduction Strategy. Insects, 14(3), 256. https://doi.org/10.3390/insects14030256