Development of RNAi Methods for the Mormon Cricket, Anabrus simplex (Orthoptera: Tettigoniidae)
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Transcriptome Sequencing
2.2. Insect Rearing
2.3. Target Gene Selection
2.4. dsRNA Construction
2.5. qPCR Primer Design
2.6. RNAi Knockdown Efficiency
2.7. Time-Course and Mortality Assays
2.8. dsRNA Degradation Assay
2.9. Statistical Analysis
3. Results
3.1. Transcriptome
3.2. dsRNA Knockdown Efficiency
3.3. Time-Course Assay of RNAi Response
3.4. Mortality Assay
3.5. dsRNA Degradation Assay
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cowan, F.T. Life History, Habits and Control of the Mormon Cricket; United States Department of Agriculture Technical Bulletin: Washington, DC, USA, 1929; Volume 161, pp. 1–28.
- Cowan, F.T.; Wakeland, C.C. Mormon Crickets: How to Control Them; US Department of Agriculture: Washington, DC, USA, 1962.
- Wakeland, C.C. Mormon Crickets in North America; US Department of Agriculture: Washington, DC, USA, 1959.
- Gwynne, D.T. Katydids and Bush-Crickets: Reproductive Behavior and Evolution of the Tettigoniidae; Cornell University Press: Ithaca, NY, USA, 2001. [Google Scholar]
- Simpson, S.J.; Sword, G.A.; Lorch, P.D.; Couzin, I.D. Cannibal crickets on a forced march for protein and salt. Proc. Natl. Acad. Sci. USA 2006, 103, 4152–4156. [Google Scholar] [CrossRef] [PubMed]
- Srygley, R.B.; Lorch, P.D. Weakness in the band: Nutrient-mediated trade-offs between migration and immunity of Mormon crickets, Anabrus simplex. Anim. Behav. 2011, 81, 395–400. [Google Scholar] [CrossRef]
- Sword, G.A.; Lorch, P.D.; Gwynne, D.T. Migratory bands give crickets protection. Nature 2005, 433, 703. [Google Scholar] [CrossRef] [PubMed]
- Bailey, N.W.; Gwynne, D.T.; Ritchie, M.G. Are solitary and gregarious Mormon crickets (Anabrus simplex, Orthoptera, Tettigoniidae) genetically distinct? Heredity 2005, 95, 166–173. [Google Scholar] [CrossRef]
- Bailey, N.W.; Gwynne, D.T.; Ritchie, M.G. Dispersal differences predict population genetic structure in Mormon crickets. Mol. Ecol. 2007, 16, 2079–2089. [Google Scholar] [CrossRef]
- United States Department of Agriculture. Rangeland Grasshopper and Mormon Cricket Suppression Program Final Environmental Impact Statement-2002; Department of Agriculture: Washington, DC, USA, 2002.
- Foster, R.N.; Jaronski, S.; Reuter, K.C.; Black, L.R.; Schlothauer, R. Explaining mycoinsecticide activity: Poor performance of spray and bait formulations of Beauveria bassiana and Metarhizium brunneum against Mormon cricket in field cage studies. J. Orthoptera Res. 2010, 19, 303–313. [Google Scholar] [CrossRef]
- MacVean, C.M. Mormon crickets: A brighter side. Rangelands 1990, 12, 234–235. [Google Scholar]
- Müller-Schärer, H.; Schaffner, U.; Steinger, T. Evolution in invasive plants: Implications for biological control. Trends Ecol. Evol. 2004, 19, 417–422. [Google Scholar] [CrossRef]
- Foster, R.N.; Billingsley, C.H.; Staten, R.T.; Hamilton, D.J. Field cage tests for concentrations of carbaryl in a bait and its application rates for control of Mormon cricket. J. Econ. Entomol. 1979, 72, 295–297. [Google Scholar] [CrossRef]
- Gibbs, K.E.; Mackey, R.L.; Currie, D.J. Human land use, agriculture, pesticides and losses of imperiled species. Divers. Distrib. 2009, 15, 242–253. [Google Scholar] [CrossRef]
- Pimentel, D. Ecological Effects of Pesticides on Non-Target Species; Office of Science and Technology: Washington, DC, USA, 1971.
- Tiryaki, O.; Temur, C. The fate of pesticide in the environment. J. Biol. Environ. Sci. 2010, 4, 29–38. [Google Scholar]
- Henry, J.E.; Onsager, J.A. Experimental control of the Mormon cricket, Anabrus simplex, by Nosema locustae [Microspora: Microsporida], a protozoan parasite of grasshoppers [Ort.: Acrididae]. Entomophaga 1982, 72, 197–201. [Google Scholar] [CrossRef]
- MacVean, C.M.; Capinera, J.L. Pathogenicity and transmission potential of Nosema locustae and Vairimorpha n. sp.(Protozoa: Microsporida) in Mormon crickets (Anabrus simplex; Orthoptera: Tettigoniidae): A laboratory evaluation. J. Invertebr. Pathol. 1991, 57, 23–36. [Google Scholar] [CrossRef]
- Foster, R.N.; Jaronski, S.; Reuter, K.C.; Black, L.R.; Schlothauer, R.; Harper, J.; Jech, L.E. Simulated aerial sprays for field cage evaluation of Beauveria bassiana and Metarhizium brunneum (Ascomycetes: Hypocreales) against Anabrus simplex (Orthoptera: Tettigoniidae) in Montana. Biocontrol Sci. Technol. 2011, 21, 1331–1350. [Google Scholar] [CrossRef]
- Baum, J.A.; Roberts, J.K. Progress towards RNAi-mediated insect pest management. Adv. Insect Physiol. 2014, 47, 249–295. [Google Scholar]
- Gu, L.; Knipple, D.C. Recent advances in RNA interference research in insects: Implications for future insect pest management strategies. Crop Prot. 2013, 45, 36–40. [Google Scholar] [CrossRef]
- Katoch, R.; Sethi, A.; Thakur, N.; Murdock, L.L. RNAi for insect control: Current perspective and future challenges. Appl. Biochem. Biotechnol. 2013, 171, 847–873. [Google Scholar] [CrossRef]
- Xue, X.-Y.; Mao, Y.-B.; Tao, X.-Y.; Huang, Y.-P.; Chen, X.-Y. New approaches to agricultural insect pest control based on RNA interference. Adv. Insect Physiol. 2012, 42, 73–117. [Google Scholar]
- Hannon, G.J. RNA interference. Nature 2002, 418, 244–251. [Google Scholar] [CrossRef]
- Fire, A.; Xu, S.; Montgomery, M.K.; Kostas, S.A.; Driver, S.E.; Mello, C.C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998, 391, 806–811. [Google Scholar] [CrossRef]
- Hammond, S.M.; Bernstein, E.; Beach, D.; Hannon, G.J. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 2000, 404, 293–296. [Google Scholar] [CrossRef] [PubMed]
- Elbashir, S.M.; Lendeckel, W.; Tuschl, T. RNA interference is mediated by 21-and 22-nucleotide RNAs. Genes Dev. 2001, 15, 188–200. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Rand, T.A.; Kalidas, S.; Du, F.; Kim, H.-E.; Smith, D.P.; Wang, X. R2D2, a bridge between the initiation and effector steps of the Drosophila RNAi pathway. Science 2003, 301, 1921–1925. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Carmell, M.A.; Rivas, F.V.; Marsden, C.G.; Thomson, J.M.; Song, J.-J.; Hammond, S.M.; Joshua-Tor, L.; Hannon, G.J. Argonaute2 is the catalytic engine of mammalian RNAi. Science 2004, 305, 1437–1441. [Google Scholar] [CrossRef]
- Matranga, C.; Tomari, Y.; Shin, C.; Bartel, D.P.; Zamore, P.D. Passenger-strand cleavage facilitates assembly of siRNA into Ago2-containing RNAi enzyme complexes. Cell 2005, 123, 607–620. [Google Scholar] [CrossRef]
- Bellés, X. Beyond Drosophila: RNAi in vivo and functional genomics in insects. Annu. Rev. Entomol. 2009, 55, 111–128. [Google Scholar] [CrossRef]
- Cullen, D. RNAi unravels the biology of the hemimetabolous and ametabolous insects. Adv. Insect Physiol. 2012, 42, 37–72. [Google Scholar]
- Huvenne, H.; Smagghe, G. Mechanisms of dsRNA uptake in insects and potential of RNAi for pest control: A review. J. Insect Physiol. 2010, 56, 227–235. [Google Scholar] [CrossRef]
- Joga, M.R.; Zotti, M.J.; Smagghe, G.; Christiaens, O. RNAi efficiency, systemic properties, and novel delivery methods for pest insect control: What we know so far. Front. Physiol. 2016, 7, 553. [Google Scholar] [CrossRef]
- Nandety, R.S.; Kuo, Y.-W.; Nouri, S.; Falk, B.W. Emerging strategies for RNA interference (RNAi) applications in insects. Bioengineered 2015, 6, 8–19. [Google Scholar] [CrossRef]
- De Andrade, E.; Hunter, W.B. RNA interference–natural gene-based technology for highly specific pest control (HiSPeC). In RNA Interference; Abdurakhmonov, I.Y., Ed.; IntechOpen: Rijeka, Croatia, 2016. [Google Scholar]
- Scott, J.G.; Michel, K.; Bartholomay, L.C.; Siegfried, B.D.; Hunter, W.B.; Smagghe, G.; Zhu, K.Y.; Douglas, A.E. Towards the elements of successful insect RNAi. J. Insect Physiol. 2013, 59, 1212–1221. [Google Scholar] [CrossRef] [PubMed]
- National Academies of Sciences, Engineering, and Medicine. Gene Drives on the Horizon: Advancing Science, Navigating Uncertainty and Aligning Research with Public Values; The National Academies Press: Washington, DC, USA, 2016. [Google Scholar] [CrossRef]
- List, F.; Tarone, A.M.; Zhu-Salzman, K.; Vargo, E.L. RNA meets toxicology: Efficacy indicators from the experimental design of RNAi studies for insect pest management. Pest Manag. Sci. 2022, 78, 3215–3225. [Google Scholar] [CrossRef] [PubMed]
- Wynant, N.; Verlinden, H.; Breugelmans, B.; Simonet, G.; Broeck, J.V. Tissue-dependence and sensitivity of the systemic RNA interference response in the desert locust, Schistocerca gregaria. Insect Biochem. Mol. Biol. 2012, 42, 911–917. [Google Scholar] [CrossRef]
- Badisco, L.; Marchal, E.; Van Wielendaele, P.; Verlinden, H.; Vleugels, R.; Vanden Broeck, J. RNA interference of insulin-related peptide and neuroparsins affects vitellogenesis in the desert locust Schistocerca gregaria. Peptides 2011, 32, 573–580. [Google Scholar] [CrossRef] [PubMed]
- Boerjan, B.; Tobback, J.; De Loof, A.; Schoofs, L.; Huybrechts, R. Fruitless RNAi knockdown in males interferes with copulation success in Schistocerca gregaria. Insect Biochem. Mol. Biol. 2011, 41, 340–347. [Google Scholar] [CrossRef] [PubMed]
- Ott, S.R.; Verlinden, H.; Rogers, S.M.; Brighton, C.H.; Quah, P.S.; Vleugels, R.K.; Verdonck, R.; Broeck, J.V. Critical role for protein kinase A in the acquisition of gregarious behavior in the desert locust. Proc. Natl. Acad. Sci. USA 2012, 109, E381–E387. [Google Scholar] [CrossRef]
- Sugahara, R.; Tanaka, S.; Shiotsuki, T. RNAi-mediated knockdown of SPOOK reduces ecdysteroid titers and causes precocious metamorphosis in the desert locust Schistocerca gregaria. Dev. Biol. 2017, 429, 71–80. [Google Scholar] [CrossRef]
- Gao, L.; Wang, Y.; Fan, Y.; Abbas, M.; Ma, E.; Cooper, A.M.W.; Silver, K.; Zhu, K.Y.; Zhang, J. Multiple Argonaute family genes contribute to the siRNA-mediated RNAi pathway in Locusta migratoria. Pestic. Biochem. Physiol. 2020, 170, 104700. [Google Scholar] [CrossRef]
- Guo, W.; Wang, X.; Ma, Z.; Xue, L.; Han, J.; Yu, D.; Kang, L. CSP and Takeout genes modulate the switch between attraction and repulsion during behavioral phase change in the migratory locust. PLoS Genet. 2011, 7, e1001291. [Google Scholar] [CrossRef]
- Luo, Y.; Wang, X.; Wang, X.; Yu, D.; Chen, B.; Kang, L. Differential responses of migratory locusts to systemic RNA interference via double-stranded RNA injection and feeding. Insect Mol. Biol. 2013, 22, 574–583. [Google Scholar] [CrossRef]
- Song, H.; Zhang, J.; Li, D.; Cooper, A.M.W.; Silver, K.; Li, T.; Liu, X.; Ma, E.; Zhu, K.Y.; Zhang, J. A double-stranded RNA degrading enzyme reduces the efficiency of oral RNA interference in migratory locust. Insect Biochem. Mol. Biol. 2017, 86, 68–80. [Google Scholar] [CrossRef] [PubMed]
- Sugahara, R.; Tanaka, S.; Jouraku, A.; Shiotsuki, T. Geographic variation in RNAi sensitivity in the migratory locust. Gene 2017, 605, 5–11. [Google Scholar] [CrossRef]
- Zhang, J.; Liu, X.; Zhang, J.; Li, D.; Sun, Y.; Guo, Y.; Ma, E.; Zhu, K.Y. Silencing of two alternative splicing-derived mRNA variants of chitin synthase 1 gene by RNAi is lethal to the oriental migratory locust, Locusta migratoria manilensis (Meyen). Insect Biochem. Mol. Biol. 2010, 40, 824–833. [Google Scholar] [CrossRef] [PubMed]
- Dabour, N.; Bando, T.; Nakamura, T.; Miyawaki, K.; Mito, T.; Ohuchi, H.; Noji, S. Cricket body size is altered by systemic RNAi against insulin signaling components and epidermal growth factor receptor. Dev. Growth Differ. 2011, 53, 857–869. [Google Scholar] [CrossRef]
- Nakamura, T.; Ylla, G.; Extavour, C.G. Genomics and genome editing techniques of crickets, an emerging model insect for biology and food science. Curr. Opin. Insect Sci. 2022, 50, 100881. [Google Scholar] [CrossRef]
- Takagi, A.; Kurita, K.; Terasawa, T.; Nakamura, T.; Bando, T.; Moriyama, Y.; Mito, T.; Noji, S.; Ohuchi, H. Functional analysis of the role of eyes absent and sine oculis in the developing eye of the cricket Gryllus bimaculatus. Dev. Growth Differ. 2012, 54, 227–240. [Google Scholar] [CrossRef] [PubMed]
- Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef]
- Davidson, N.M.; Oshlack, A. Corset: Enabling differential gene expression analysis for de novo assembled transcriptomes. Genome Biol. 2014, 15, 410. [Google Scholar] [CrossRef]
- Foquet, B.; Song, H. There is no magic bullet: The importance of testing reference gene stability in RT-qPCR experiments across multiple closely related species. PeerJ 2020, 8, e9618. [Google Scholar] [CrossRef]
- Koressaar, T.; Remm, M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [PubMed]
- Foquet, B.; Song, H. The role of the neuropeptide [His7]-corazonin on phase-related characteristics in the Central American locust. J. Insect Physiol. 2021, 131, 104244. [Google Scholar] [CrossRef] [PubMed]
- Singh, I.K.; Singh, S.; Mogilicherla, K.; Shukla, J.N.; Palli, S.R. Comparative analysis of double-stranded RNA degradation and processing in insects. Sci. Rep. 2017, 7, 17059. [Google Scholar] [CrossRef] [PubMed]
- Eisenberg, E.; Levanon, E.Y. Human housekeeping genes, revisited. Trends Genet. 2013, 29, 569–574. [Google Scholar] [CrossRef] [PubMed]
- Dufresne, F.; Jeffery, N. A guided tour of large genome size in animals: What we know and where we are heading. Chromosome Res. 2011, 19, 925–938. [Google Scholar] [CrossRef] [PubMed]
- Santos, D.; Vanden Broeck, J.; Wynant, N. Systemic RNA interference in locusts: Reverse genetics and possibilities for locust pest control. Curr. Opin. Insect Sci. 2014, 6, 9–14. [Google Scholar] [CrossRef]
- Lenaerts, C.; Van Wielendaele, P.; Peeters, P.; Vanden Broeck, J.; Marchal, E. Ecdysteroid signalling components in metamorphosis and development of the desert locust, Schistocerca gregaria. Insect Biochem. Mol. Biol. 2016, 75, 10–23. [Google Scholar] [CrossRef]
- Marchal, E.; Verlinden, H.; Badisco, L.; Van Wielendaele, P.; Vanden Broeck, J. RNAi-mediated knockdown of Shade negatively affects ecdysone-20-hydroxylation in the desert locust, Schistocerca gregaria. J. Insect Physiol. 2012, 58, 890–896. [Google Scholar] [CrossRef]
- Marchal, E.; Zhang, J.; Badisco, L.; Verlinden, H.; Hult, E.F.; Van Wielendaele, P.; Yagi, K.J.; Tobe, S.S.; Vanden Broeck, J. Final steps in juvenile hormone biosynthesis in the desert locust, Schistocerca gregaria. Insect Biochem. Mol. Biol. 2011, 41, 219–227. [Google Scholar] [CrossRef]
- Vogel, E.; Santos, D.; Mingels, L.; Verdonckt, T.-W.; Vanden Broeck, J. RNA interference in insects: Protecting beneficials and controlling pests. Front. Physiol. 2019, 9, 1912. [Google Scholar] [CrossRef]
- Telang, A.; Rechel, J.A.; Brandt, J.R.; Donnell, D.M. Analysis of ovary-specific genes in relation to egg maturation and female nutritional condition in the mosquitoes Georgecraigius atropalpus and Aedes aegypti (Diptera: Culicidae). J. Insect Physiol. 2013, 59, 283–294. [Google Scholar] [CrossRef] [PubMed]
- Terenius, O.; Papanicolaou, A.; Garbutt, J.S.; Eleftherianos, I.; Huvenne, H.; Kanginakudru, S.; Albrechtsen, M.; An, C.; Aymeric, J.-L.; Barthel, A. RNA interference in Lepidoptera: An overview of successful and unsuccessful studies and implications for experimental design. J. Insect Physiol. 2011, 57, 231–245. [Google Scholar] [CrossRef] [PubMed]
- Miller, S.C.; Brown, S.J.; Tomoyasu, Y. Larval RNAi in Drosophila? Dev. Genes Evol. 2008, 218, 505–510. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Zhang, M.; Zhang, H. RNA interference of four genes in adult Bactrocera dorsalis by feeding their dsRNAs. PLoS ONE 2011, 6, e17788. [Google Scholar] [CrossRef] [PubMed]
- Mishra, S.; Dee, J.; Moar, W.; Dufner-Beattie, J.; Baum, J.; Dias, N.P.; Alyokhin, A.; Buzza, A.; Rondon, S.I.; Clough, M.; et al. Selection for high levels of resistance to double-stranded RNA (dsRNA) in Colorado potato beetle (Leptinotarsa decemlineata Say) using non-transgenic foliar delivery. Sci. Rep. 2021, 11, 6523. [Google Scholar] [CrossRef]
- Dalzell, J.J.; Warnock, N.D.; Stevenson, M.A.; Mousley, A.; Fleming, C.C.; Maule, A.G. Short interfering RNA-mediated knockdown of drosha and pasha in undifferentiated Meloidogyne incognita eggs leads to irregular growth and embryonic lethality. Int. J. Parasitol. 2010, 40, 1303–1310. [Google Scholar] [CrossRef]
- Guan, R.B.; Li, H.C.; Miao, X.X. Prediction of effective RNA interference targets and pathway-related genes in lepidopteran insects by RNA sequencing analysis. Insect Sci. 2018, 25, 356–367. [Google Scholar] [CrossRef]
- Hirai, M.; Terenius, O.; Li, W.; Faye, I. Baculovirus and dsRNA induce Hemolin, but no antibacterial activity, in Antheraea pernyi. Insect Mol. Biol. 2004, 13, 399–405. [Google Scholar] [CrossRef]
- Yankovskaya, V.; Horsefield, R.; Tornroth, S.; Luna-Chavez, C.; Miyoshi, H.; Leger, C.; Byrne, B.; Cecchini, G.; Iwata, S. Architecture of succinate dehydrogenase and reactive oxygen species generation. Science 2003, 299, 700–704. [Google Scholar] [CrossRef]
- Santoro, M.G. Heat shock factors and the control of the stress response. Biochem. Pharmacol. 2000, 59, 55–63. [Google Scholar] [CrossRef]
- Voellmy, R.; Boellmann, F. Chaperone regulation of the heat shock protein response. In Molecular Aspects of the Stress Response: Chaperones, Membranes and Networks; Csermely, P., Vígh, L., Eds.; Springer: New York, NY, USA, 2007; pp. 89–99. [Google Scholar]
- Nicholls, C.; Li, H.; Liu, J.P. GAPDH: A common enzyme with uncommon functions. Clin. Exp. Pharmacol. Physiol. 2012, 39, 674–679. [Google Scholar] [CrossRef] [PubMed]
- Dhandapani, R.K.; Gurusamy, D.; Duan, J.J.; Palli, S.R. RNAi for management of Asian long-horned beetle, Anoplophora glabripennis: Identification of target genes. J. Pest Sci. 2020, 93, 823–832. [Google Scholar] [CrossRef]
- Garbutt, J.S.; Bellés, X.; Richards, E.H.; Reynolds, S.E. Persistence of double-stranded RNA in insect hemolymph as a potential determiner of RNA interference success: Evidence from Manduca sexta and Blattella germanica. J. Insect Physiol. 2013, 59, 171–178. [Google Scholar] [CrossRef] [PubMed]
- Shukla, J.N.; Kalsi, M.; Sethi, A.; Narva, K.E.; Fishilevich, E.; Singh, S.; Mogilicherla, K.; Palli, S.R. Reduced stability and intracellular transport of dsRNA contribute to poor RNAi response in lepidopteran insects. RNA Biol. 2016, 13, 656–669. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.; Wang, K.; Fu, W.; Sheng, C.; Han, Z. Biochemical comparison of dsRNA degrading nucleases in four different insects. Front. Physiol. 2018, 9, 624. [Google Scholar] [CrossRef] [PubMed]
- Wynant, N.; Santos, D.; Verdonck, R.; Spit, J.; Van Wielendaele, P.; Vanden Broeck, J. Identification, functional characterization and phylogenetic analysis of double stranded RNA degrading enzymes present in the gut of the desert locust, Schistocerca gregaria. Insect Biochem. Mol. Biol. 2014, 46, 1–8. [Google Scholar] [CrossRef]
Gene Name | Abbreviation | Primer Sequence | Tm (°C) | E (%) | Genbank Accession |
---|---|---|---|---|---|
Actin 5C | Act5C | F: CACCCTCAAGTACCCCATTG | 55.4 | 94.29 | ON402773 |
R: GTCAGCAGGATTGGGTGTTC | |||||
Annexin IX | Ann | F: CAATTTTGGTGACCCGTAGC | 54.3 | 93.00 | ON402772 |
R: CAATAGCCAGCAGTCCCTTC | |||||
Armadillo | Arm | F: TCCTGGCAATTGTGACAGAC | 55.2 | 101.48 | ON402771 |
R: ATTCGTACCAGCTCCACAGG | |||||
Elongation Factor 1Alpha | EF1a | F: CAAGATGGGCTGGTTTAAGG | 53.6 | 94.50 | ON402770 |
R: CTCAGTAGGCCTGGAAGGTG | |||||
Elongation Factor 2 | EF2 | F: GCAAACCGAAACTGTCCTTC | 54.4 | 100.75 | ON402769 |
R: TGACGTTCTCCACAATACGC | |||||
Glyceraldehyde-3P-Dehydrogenase | GAPDH | F: TACTCATGGCCGCTTCAAGG | 57.4 | 99.37 | ON402768 |
R: GGAATGCTTTTGGGGTCACG | |||||
Heat Shock Protein 70 | Hsp70 | F: TTTTGGACAAGTGCAACGAG | 53.8 | 92.63 | ON402767 |
R: AATGATGGGGTTGCAAAGAG | |||||
Ribosomal Protein L5 | RpL5 | F: GGTGCCAGAGTGTTTGGTG | 53.2 | 96.40 | ON402766 |
R: ACTCTTTTGATTCCGCATCG | |||||
Ribosomal Protein L32 | RpL32 | F: GTTGGTGCACAATGTGAAGG | 54.8 | 97.80 | ON402765 |
R: CCACGATAGACTTCCGCTTC | |||||
Succinate Dehydrogenase | SDH | F: CCCTAGAGAAGTAGAGGCTGC | 56.3 | 101.00 | ON402764 |
R: CCCAGCTCCATTGACCAGAC | |||||
Tubulin A1 | Tub | F: AACAGCTTATCACGGGCAAG | 55.5 | 97.50 | ON402763 |
R: GCTTTCTGATGCGATCCAAG |
dsRNA | Primer Sequence | Product Size |
---|---|---|
dsEF1a | F: taatacgactcactatagggagaAATATGCCTGGGTGTTGGAC | 479 |
R: taatacgactcactatagggagaATCCCTTAAACCAGCCCATC | ||
dsGAPDH | F: taatacgactcactatagggagaAATCAAGTGGGGAGCTGATG | 314 |
R: taatacgactcactatagggagaCAGTGCTTGCAGGAATGATG | ||
dsHsp70 | F: taatacgactcactatagggagaTGATGCAGCAAAGAACCAAG | 336 |
R: taatacgactcactatagggagaGGCTCCAGCATCCTTTGTAG | ||
dsRpL5 | F: taatacgactcactatagggagaCCTCCGTCTGATCTCTCAGG | 321 |
R: taatacgactcactatagggagaTCCCCGACCACTTTCTACAG | ||
dsRpL32 | F: taatacgactcactatagggagaGAAGCGCAATAAGCACTTCG | 303 |
R: taatacgactcactatagggagaCCACGATAGACTTCCGCTTC | ||
dsSDH | F: taatacgactcactatagggagaAATTTTCGATCTGGGTGGTG | 388 |
R: taatacgactcactatagggagaTTTTTGCACCTTCGGGATAC | ||
dsTub | F: taatacgactcactatagggagaAACAGCTTATCACGGGCAAG | 469 |
R: taatacgactcactatagggagaCCATCAAACCGAAGAGAAGC | ||
dsGFP | F: taatacgactcactatagggagaACGTAAACGGCCACAAGTTCAGC | N/A |
R: taatacgactcactatagggagaGAGGGTCTTCTGCTGGTAGTGGTCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hoang, T.; Foquet, B.; Rana, S.; Little, D.W.; Woller, D.A.; Sword, G.A.; Song, H. Development of RNAi Methods for the Mormon Cricket, Anabrus simplex (Orthoptera: Tettigoniidae). Insects 2022, 13, 739. https://doi.org/10.3390/insects13080739
Hoang T, Foquet B, Rana S, Little DW, Woller DA, Sword GA, Song H. Development of RNAi Methods for the Mormon Cricket, Anabrus simplex (Orthoptera: Tettigoniidae). Insects. 2022; 13(8):739. https://doi.org/10.3390/insects13080739
Chicago/Turabian StyleHoang, Toan, Bert Foquet, Seema Rana, Drew W. Little, Derek A. Woller, Gregory A. Sword, and Hojun Song. 2022. "Development of RNAi Methods for the Mormon Cricket, Anabrus simplex (Orthoptera: Tettigoniidae)" Insects 13, no. 8: 739. https://doi.org/10.3390/insects13080739
APA StyleHoang, T., Foquet, B., Rana, S., Little, D. W., Woller, D. A., Sword, G. A., & Song, H. (2022). Development of RNAi Methods for the Mormon Cricket, Anabrus simplex (Orthoptera: Tettigoniidae). Insects, 13(8), 739. https://doi.org/10.3390/insects13080739