Silencing the Autophagy-Related Genes ATG3 and ATG9 Promotes SRBSDV Propagation and Transmission in Sogatella furcifera
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insects and Plants
2.2. Bioinformatics Analysis
2.3. Temporal Expression of Virus Gene and Autophagy-Related Genes in SRBSDV-Exposed WBPH Females
2.4. SRBSDV Transmission by WBPH Treated with dsRNAs
2.4.1. Synthesis of dsRNA
2.4.2. SRBSDV Acquisition and Expression of Virus Gene and Autophagy-Related Genes
2.4.3. SRBSDV Inoculation
2.5. Data Analysis
3. Results
3.1. Bioinformatics Analysis of SfATG3 and SfATG9
3.2. Temporal Expression of Virus Gene and Autophagy-Related Genes in SRBSDV-Exposed WBPH Females
3.3. SRBSDV Propagation and Transmission by WBPH Treated with dsRNAs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hogenhout, S.A.; Ammar, E.D.; Whitfield, A.E.; Redinbaugh, M.G. Insect vector interactions with persistently transmitted viruses. Annu. Rev. Phytopathol. 2008, 46, 327–359. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dáder, B.; Then, C.; Berthelot, E.; Ducousso, M.; Ng, J.C.K.; Drucker, M. Insect transmission of plant viruses: Multilayered interactions optimize viral accumulation. Insect Sci. 2017, 24, 929–946. [Google Scholar] [CrossRef] [PubMed]
- Wei, T.; Li, Y. Rice reoviruses in insect vectors. Annu. Rev. Phytopathol. 2016, 54, 99–120. [Google Scholar] [CrossRef]
- Jia, D.; Mao, Q.; Chen, H.; Wang, A.; Liu, Y.; Wang, H.; Xie, L.; Wei, T. Virus-induced tubule: A vehicle for rapid spread of virions through basal lamina from midgut epithelium in the insect vector. J. Virol. 2014, 88, 10488–10500. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jia, D.; Han, Y.; Sun, X.; Wang, Z.; Du, Z.; Chen, Q.; Wei, T. The speed of tubule formation of two fijiviruses corresponds with their dissemination efficiency in their insect vectors. Virol. J. 2016, 13, 174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chiramel, A.I.; Brady, N.R.; Bartenschlager, R. Divergent roles of autophagy in virus infection. Cells 2013, 2, 83–104. [Google Scholar] [CrossRef] [Green Version]
- Whitfield, A.E.; Falk, B.W.; Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology 2015, 479, 278–289. [Google Scholar] [CrossRef] [Green Version]
- Hillyer, J.F. Insect immunology and hematopoiesis. Dev. Comp. Immunol. 2016, 58, 102–118. [Google Scholar] [CrossRef] [Green Version]
- Jia, D.; Chen, Q.; Mao, Q.; Zhang, X.; Wu, W.; Chen, H.; Yu, X.; Wang, Z.; Wei, T. Vector mediated transmission of persistently transmitted plant viruses. Curr. Opin. Virol. 2018, 28, 127–132. [Google Scholar] [CrossRef]
- Veenhuis, M.; Douma, A.; Harder, W.; Osumi, M. Degradation and turnover of peroxisomes in the yeast Hansenula polymorpha induced by selective inactivation of peroxisomal enzymes. Arch. Microbiol. 1983, 134, 193–203. [Google Scholar] [CrossRef] [Green Version]
- Ichimura, Y.; Kirisako, T.; Takao, T.; Satomi, Y.; Shimonishi, Y.; Ishihara, N.; Mizushima, N.; Tanida, I.; Kominami, E.; Ohsumi, M.; et al. A ubiquitin-like system mediates protein lipidation. Nature 2000, 408, 488–492. [Google Scholar] [CrossRef] [PubMed]
- Mizushima, N.; Levine, B.; Cuervo, A.M.; Klionsky, D.J. Autophagy fights disease through cellular self-digestion. Nature 2008, 451, 1069–1075. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rabinowitz, J.D.; White, E. Autophagy and metabolism. Science 2010, 330, 1344–1348. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bird, S.W.; Kirkegaard, K. Nonlytic spread of naked viruses. Autophagy 2015, 11, 430–431. [Google Scholar] [CrossRef] [Green Version]
- Lamiable, O.; Arnold, J.; de Faria, I.; Olmo, R.P.; Bergami, F.; Meignin, C.; Hoffmann, J.A.; Marques, J.T.; Imler, J.L. Analysis of the contribution of hemocytes and autophagy to Drosophila antiviral immunity. J. Virol. 2016, 90, 5415–5426. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, L.L.; Wang, X.R.; Wei, X.M.; Huang, H.; Wu, J.X.; Chen, X.X.; Liu, S.S.; Wang, X.W. The autophagy pathway participates in resistance to tomato yellow leaf curl virus infection in whiteflies. Autophagy 2016, 12, 1560–1574. [Google Scholar] [CrossRef] [Green Version]
- Wang, Q.; Lu, L.; Zeng, M.; Wang, D.; Zhang, T.-Z.; Xie, Y.; Gao, S.-B.; Fu, S.; Zhou, X.-P.; Wu, J.-X. Rice black-streaked dwarf virus P10 promotes phosphorylation of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) to induce autophagy in Laodelphax striatellus. Autophagy 2021, 7, 1–20. [Google Scholar] [CrossRef]
- Chen, Y.; Chen, Q.; Li, M.; Mao, Q.; Chen, H.; Wu, W.; Jia, D.; Wei, T. Autophagy pathway induced by a plant virus facilitates viral spread and transmission by its insect vector. PLoS Pathog. 2017, 13, e1006727. [Google Scholar] [CrossRef] [Green Version]
- Yu, Y.L.; Zhang, M.T.; Huo, Y.; Tang, J.L.; Liu, Q.; Chen, X.Y.; Fang, R.X.; Zhang, L.L. Laodelphax striatellus Atg8 facilitates rice stripe virus infection in an autophagy-independent manner. Insect Sci. 2021, 28, 315–329. [Google Scholar] [CrossRef] [Green Version]
- Wang, W.; Zhao, W.; Li, J.; Luo, L.; Kang, L.; Cui, F. The c-Jun N-terminal kinase pathway of a vector insect is activated by virus capsid protein and promotes viral replication. eLife 2017, 6, e26591. [Google Scholar] [CrossRef] [Green Version]
- Shelly, S.; Lukinova, N.; Bambina, S.; Berman, A.; Cherry, S. Autophagy is an essential component of Drosophila immunity. against vesicular stomatitis virus. Immunity 2009, 30, 588–598. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tang, X.-T.; Tamborindeguy, C. Identification of autophagy-related genes in the potato psyllid, Bactericera cockerelli and their expression profile in response to ‘Candidatus Liberibacter Solanacearum’ in the gut. Insects 2021, 12, 1073. [Google Scholar] [CrossRef] [PubMed]
- Zhou, G.; Xu, D.; Xu, D.; Zhang, M. Southern rice black-streaked dwarf virus: A white-backed planthopper-transmitted fijivirus threatening rice production in Asia. Front. Microbiol. 2013, 4, 270. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pu, L.; Xie, G.; Ji, C.; Ling, B.; Zhang, M.; Xu, D.; Zhou, G. Transmission characteristics of Southern rice black-streaked dwarf virus by rice planthoppers. Crop Prot. 2012, 41, 71–76. [Google Scholar] [CrossRef]
- Mar, T.; Liu, W.; Wang, X. Proteomic analysis of interaction between P7-1 of Southern rice black-streaked dwarf virus and the insect vector reveals diverse insect proteins involved in successful transmission. J. Proteom. 2014, 102, 83–97. [Google Scholar] [CrossRef]
- Tu, Z.; Ling, B.; Xu, D.; Zhang, M.; Zhou, G. Effects of southern rice black-streaked dwarf virus on the development and fecundity of its vector, Sogatella furcifera. Virol. J. 2013, 10, 145. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lei, W.; Liu, D.; Li, P.; Hou, M. Interactive Effects of southern rice black-streaked dwarf virus infection of host plant and vector on performance of the vector, Sogatella furcifera (Homoptera: Delphacidae). J. Econ. Entomol. 2014, 107, 1721–1727. [Google Scholar] [CrossRef]
- Lei, W.; Li, P.; Han, Y.; Gong, S.; Yang, L.; Hou, M. EPG recordings reveal differential feeding behaviors in Sogatella furcifera in response to plant virus infection and transmission success. Sci. Rep. 2016, 6, 30240. [Google Scholar] [CrossRef]
- Xu, Y.; Zhou, W.; Zhou, Y.; Wu, J.; Zhou, X. Transcriptome and comparative gene expression analysis of Sogatella furcifera (Horváth) in response to southern rice black-streaked dwarf virus. PLoS ONE 2012, 7, e36238. [Google Scholar] [CrossRef]
- Wang, L.; Tang, N.; Gao, X.; Guo, D.; Chang, Z.; Fu, Y.; Akinyemi, I.A.; Wu, Q. Understanding the immune system architecture and transcriptome responses to southern rice black-streaked dwarf virus in Sogatella furcifera. Sci. Rep. 2016, 6, 36254. [Google Scholar] [CrossRef] [Green Version]
- Wang, Q.; Zhou, G.; Zhang, S. Detection of Southern rice black-streaked dwarf virus using one-step dual RT-PCR. Acta Phytopathol. Sin 2012, 42, 84–87. (In Chinese) [Google Scholar]
- An, X.K.; Hou, M.L.; Liu, Y.D. Reference gene selection and evaluation for gene expression studies using qPCR in the white-backed planthopper, Sogatella furcifera (Hemiptera: Delphacidae). J. Econ. Entomol. 2016, 109, 879–886. [Google Scholar] [CrossRef] [PubMed]
- Ismayil, A.; Yang, M.; Liu, Y. Role of autophagy during plant-virus interactions. Semin. Cell Dev. Biol. 2020, 101, 36–40. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.; Ismayil, A.; Liu, Y. Autophagy in plant-virus interactions. Annu. Rev. Virol. 2020, 7, 403–419. [Google Scholar] [CrossRef]
- Tanida, I.; Tanida-Miyake, E.; Komatsu, M.; Ueno, T.; Kominami, E. Human Apg3p/Aut1p homologue is an authentic E2 enzyme for multiple substrates, GATE-16, GABARAP, and MAP-LC3, and facilitates the conjugation of hApg12p to hApg5p. J. Biol. Chem. 2002, 277, 13739–13744. [Google Scholar] [CrossRef] [Green Version]
- Yamada, Y.; Suzuki, N.N.; Hanada, T.; Ichimura, Y.; Kumeta, H.; Fujioka, Y.; Ohsumi, Y.; Inagaki, F. The crystal structure of Atg3, an autophagy-related ubiquitin carrier protein (E2) enzyme that mediates Atg8 lipidation. J. Biol. Chem. 2007, 282, 8036–8043. [Google Scholar] [CrossRef] [Green Version]
- Qiu, Y.; Zheng, Y.; Grace, C.R.R.; Liu, X.; Klionsky, D.J.; Schulman, B.A. Allosteric regulation through a switch element in the autophagy E2, Atg3. Autophagy 2020, 16, 183–184. [Google Scholar] [CrossRef]
- Wang, X.R.; Wang, C.; Ban, F.X.; Ghanim, M.; Pan, L.L.; Qian, L.X.; Liu, Y.Q.; Wang, X.W.; Liu, S.S. Apoptosis in a Whitefly Vector Activated by a Begomovirus Enhances Viral Transmission. mSystems 2020, 5, e00433-20. [Google Scholar] [CrossRef]
- Scott, S.V.; Nice, D.C., III; Nau, J.J.; Weisman, L.S.; Kamada, Y.; Keizer-Gunnink, I.; Funakoshi, T.; Veenhuis, M.; Ohsumi, Y.; Klionsky, D.J. Apg13p and Vac8p are part of a complex of phosphoproteins that are required for cytoplasm to vacuole targeting. J. Biol. Chem. 2000, 275, 25840–25849. [Google Scholar] [CrossRef] [Green Version]
- Zhuang, X.; Chung, K.P.; Cui, Y.; Lin, W.; Gao, C.; Kang, B.H.; Jiang, L. ATG9 regulates autophagosome progression from the endoplasmic reticulum in Arabidopsis. Proc. Natl. Acad. Sci. USA 2017, 114, E426–E435. [Google Scholar] [CrossRef] [Green Version]
- Falk, B.W.; Tsai, J.H. Biology and molecular biology of viruses in the genus Tenuivirus. Annu. Rev. Phytopathol. 1998, 36, 139–163. [Google Scholar] [CrossRef] [PubMed]
- Deng, J.; Li, S.; Hong, J.; Ji, Y.; Zhou, Y. Investigation on subcellular localization of Rice stripe virus in its vector small brown planthopper by electron microscopy. Virol. J. 2013, 10, 310. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huo, Y.; Liu, W.; Zhang, F.; Chen, X.; Li, L.; Liu, Q.; Zhou, Y.; Wei, T.; Fang, R.; Wang, X. Transovarial transmission of a plant virus is mediated by vitellogenin of its insect vector. PLoS Pathog 2014, 10, e1003949. [Google Scholar] [CrossRef] [PubMed]
- Liao, Z.; Mao, Q.; Li, J.; Lu, C.; Wu, W.; Chen, H.; Chen, Q.; Jia, D.; Wei, T. Virus-Induced Tubules: A Vehicle for Spread of Virions into Ovary Oocyte Cells of an Insect Vector. Front. Microbiol. 2017, 8, 475. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mao, Q.; Wu, W.; Liao, Z.; Li, J.; Jia, D.; Zhang, X.; Chen, Q.; Chen, H.; Wei, J.; Wei, T. Viral pathogens hitchhike with insect sperm for paternal transmission. Nat. Commun. 2019, 10, 955. [Google Scholar] [CrossRef] [PubMed]
- Shikata, E.; Kitagawa, Y. Rice black-streaked dwarf virus: Its properties, morphology and intracellular localization. Virology 1977, 77, 826–842. [Google Scholar] [CrossRef]
Primers | Sequences (5′-3′) |
---|---|
SfATG3_F | CAGGAGATTCCCACACGAATAC |
SfATG3_R | GTCCTCCTCGTCTAGAAGTCCA |
SfATG9_F | TCAAAAGGGAACCAGGAGTG |
SfATG9_R | CTGGCCTGTAAGCTCGATTC |
S9-1-F | TCAGAGGTATCAACGGTAGTG |
S9-1-R | GTCGGACTTAATAACGCTATCAG |
S10-F | CTATGGCGGTTACGACCAAT |
S10-R | GACTCCGCTCCATGTTTGTT |
SfEF1α-F | ATTGTGCTGTGCTGATTGT |
SfEF1α-R | TGCTCACCTCCTTCTTGAT |
dsATG3_F | taatacgactcactatagggACACAAGATGGCATTGAACAAG |
dsATG3_R | taatacgactcactatagggTCCTCCTCGTCTAGAAGTCCAC |
dsATG9_F | taatacgactcactatagggAGGTTAGGCTGCTTTGTTTTTG |
dsATG9_R | taatacgactcactatagggCAATGAATCCATGTTTTTGGTG |
dsGFP_F | taatacgactcactatagggGGAGAAGAACTTTTCACTGG |
dsGFP_R | taatacgactcactatagggAGTTGAACGGATCCATCTTC |
Gene | ORF | Full-Length | Sequence Producing Significant Alignment | ||||
---|---|---|---|---|---|---|---|
Name | Species | Acc. No. | E-Value | Identity | |||
SfATG3 | 999 bp | Yes | ATG3 | N. lugens | MF040142.1 | 0 | 86.06% |
SfATG9 | 2295 bp | Yes | ATG9 | N. lugens | MF805755.1 | 0 | 84.07% |
Group | Virus Acquisition Rate (%) | Virus Inoculation Rate (%) |
---|---|---|
dsGFP | 26.57 ± 1.64 b | 12.40 ± 2.14 b |
dsATG3 | 58.00 ± 1.91 a | 28.06 ± 2.32 a |
dsATG9 | 62.48 ± 1.57 a | 34.5 ± 4.02 a |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, D.; Li, Z.; Hou, M. Silencing the Autophagy-Related Genes ATG3 and ATG9 Promotes SRBSDV Propagation and Transmission in Sogatella furcifera. Insects 2022, 13, 394. https://doi.org/10.3390/insects13040394
Liu D, Li Z, Hou M. Silencing the Autophagy-Related Genes ATG3 and ATG9 Promotes SRBSDV Propagation and Transmission in Sogatella furcifera. Insects. 2022; 13(4):394. https://doi.org/10.3390/insects13040394
Chicago/Turabian StyleLiu, Dandan, Zhengxi Li, and Maolin Hou. 2022. "Silencing the Autophagy-Related Genes ATG3 and ATG9 Promotes SRBSDV Propagation and Transmission in Sogatella furcifera" Insects 13, no. 4: 394. https://doi.org/10.3390/insects13040394
APA StyleLiu, D., Li, Z., & Hou, M. (2022). Silencing the Autophagy-Related Genes ATG3 and ATG9 Promotes SRBSDV Propagation and Transmission in Sogatella furcifera. Insects, 13(4), 394. https://doi.org/10.3390/insects13040394