Next Article in Journal
Valorisation Potential of Using Organic Side Streams as Feed for Tenebrio molitor, Acheta domesticus and Locusta migratoria
Previous Article in Journal
Laboratory Selection and Assessment of Resistance Risk in Drosophila suzukii (Diptera: Drosophilidae) to Spinosad and Malathion
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparative Mitogenomes of Two Coreamachilis Species (Microcoryphia: Machilidae) along with Phylogenetic Analyses of Microcoryphia

1
College of Chemistry and Life Science, Zhejiang Normal University, Jinhua 321004, China
2
Department of Biology, Carleton University, Ottawa, ON K1S 5B6, Canada
3
Key Lab of Wildlife Biotechnology, Conservation and Utilization of Zhejiang Province, Zhejiang Normal University, Jinhua 321004, China
*
Author to whom correspondence should be addressed.
Insects 2021, 12(9), 795; https://doi.org/10.3390/insects12090795
Submission received: 2 August 2021 / Revised: 27 August 2021 / Accepted: 31 August 2021 / Published: 5 September 2021
(This article belongs to the Section Insect Molecular Biology and Genomics)

Abstract

:

Simple Summary

Bristletails (Insecta: Microcoryphia) are primarily wingless insects, some of which have been found to exhibit parthenogenesis. In the genus Coreamachilis, parthenogenesis occurs in C. coreanus, whereas sexual reproduction is found in C. songi. Therefore, after obtaining mitochondrial genome sequences of these two species, we analyzed their selection pressure, based on phylogenetic trees of Microcoryphia. However, no positive selection was found in the mitochondrial protein coding genes of either C. coreanus or C. songi. In addition, a long hairpin structure was found between ND1 and 16S rRNA genes in Machilinae and Petrobiinae, which was highly consistent with the phylogenetic results.

Abstract

The order Microcoryphia, commonly known as bristletails, is considered as the most primitive one among living insects. Within this order, two species, Coreamachilis coreanus and C. songi (Machilidae: Machilinae), display the following contrasting reproductive strategies: parthenogenesis occurs in C. coreanus, whereas sexual reproduction is found in C. songi. In the present study, the complete mitogenomes of C. coreanus and C. songi were sequenced to compare their mitogenome structure, analyze relationships within the Microcoryphia, and assess adaptive evolution. The length of the mitogenomes of C. coreanus and C. songi were 15,578 bp and 15,570 bp, respectively, and the gene orders were those of typical insects. A long hairpin structure was found between the ND1 and 16S rRNA genes of both species that seem to be characteristic of Machilinae and Petrobiinae species. Phylogenetic assessment of Coreamachilis was conducted using BI and ML analyses with concatenated nucleotide sequences of the 13 protein-coding genes. The results showed that the monophyly of Machilidae, Machilinae, and Petrobiinae was not supported. The genus Coreamachilis (C. coreanus and C. songi) was a sister clade to Allopsontus helanensis, and then the clade of ((C. coreanus + C. songi) + A. helanensis) was a sister clade to A. baii, which suggests that the monophyly of Allopsontus was not supported. Positive selection analysis of the 13 protein-coding genes failed to reveal any positive selection in C. coreanus or C. songi. The long hairpin structures found in Machilinae and Petrobiinae were highly consistent with the phylogenetic results and could potentially be used as an additional molecular characteristic to further discuss relationships within the Microcoryphia.

1. Introduction

Bristletails (Insecta: Microcoryphia) are primarily wingless insects, living in places such as under fallen leaves, the bark of trees, moss on wet logs, etc. They can be found at the seashore or inland all over the world. There are over 500 species in two families (Machilidae and Meinertellidae), and three subfamilies of Machilidae (Petrobiellinae, Petrobiinae, and Machilinae) have been reported [1,2]. The genus Coreamachilis belongs to the subfamily Machilinae. At present, there are two reported species of Coreamachilis; C. coreanus is distributed in Northern Korea and China [3], along with C. songi in China [4]. When Mendes described C. coreanus from North Korea, he did not find any male individuals, suggesting that parthenogenesis occurred in C. coreanus [5]. By contrast, C. songi was reported to show sexual reproduction [4].
Many studies have reported parthenogenetic lineages, particularly among species living at higher altitudes or in extreme habitats [6], indicating an association between parthenogenesis and environmental selection pressures that lead to specialized life cycles [7]. It was suggested that the loss of sexual reproduction was driven by a very general selective force [8], and selective factors promoted by variations in environmental conditions may be advantageous to parthenogenic reproduction [9]. By contrast, sexual reproduction is common among animals, and there have been many studies suggesting that natural selection can affect the characteristics of sexual reproduction [10,11]. In addition, parthenogenesis is rare in Microcoryphia [5]. Hence, we wondered if the mechanism of parthenogenesis in C. coreanus is under selective pressure. Also, we aimed to determine if there is a relationship between sexual reproduction and parthenogenesis within Coremachilis, related to selective pressure.
Insect mitogenomes are usually double-stranded circular molecules with a length of 14–20 kb, encoding 13 protein-coding genes (PCGs), 22 transfer RNAs (tRNAs), two ribosomal RNAs (rRNAs), and a control region (CR; or the AT-rich region) [12,13]. Because of their characteristics of fast evolution rates, small genome sizes, and low sequence recombination, mitogenomes have been used widely as molecular markers for phylogenetic analyses [13,14,15]. Many studies have now shown that specific gene rearrangements can occur in the mitogenomes of different families or genera [16,17,18]. Intergenic regions can also be used as a synapomorphy for a genus [18,19], and these regions can sometimes fold into stem–loop secondary structures or hairpin structures. Hairpin structures have been observed at PCG junctions in the mitochondrial genomes of various metazoans, including insects [20,21,22,23,24,25]. Kim et al. [25] suggested that hairpin structures are important for precise cleavage of the mature protein-coding genes. In addition, potential hairpin structures were also found in the A + T-rich region of insect mitogenomes, which was considered to be the initiation site of secondary strand synthesis [21,24,26]. However, the hairpin structures found in insects were relatively short (about 10 bp), and only a few studies have inferred an association between phylogenetic relationships and hairpin structures. We were interested in whether the hairpin structures were associated with synapomorphy at genus or family levels within Microcoryphia. It is well known that the mitogenome is often assumed to be an important neutral marker [27]. However, recent research has shown that the evaluation of selective pressures acting on mitogenome proteins can provide key insights into the adaptive evolution of the mitogenome [28,29,30,31,32,33]. To date, various studies of mammalian [34,35], avian [36], frog [33], fish [37], and insect mitogenomes have indicated that adaptive evolution has occurred. Among insects, this has included studies of Hymenoptera [38], Orthoptera [39], Ephemeroptera [40], Diptera [41], and Lepidoptera [42]. Thus, the mitogenome can be used as a molecular tool to explore/assess adaptive evolution.
In the present study, we sequenced the mitogenomes of C. coreanus and C. songi, and compared these mitogenomes with those of other bristletails available in the GenBank database. The 13 protein-coding genes were used to construct phylogenetic relationships of Microcoryphia, in order to discuss the relationship of Coreamachilis. A positive selection analysis was also used to assess whether C. coreanus, with parthenogenic reproduction, and C. songi, with sexual reproduction, were under positive selection at the mitogenome level.

2. Material and Methods

2.1. Specimen Collection and DNA Extraction

The specimens of C. songi were collected from Lianyungang city, Jiangsu Province, China, and the specimens of C. coreanus were collected from Gongchangling, Liaoyang city, Liaoning Province, China. All specimens were identified by JY Zhang and stored in 100% ethanol in a −40 °C freezer. Total DNA was extracted from individual female specimens using QIAGEN DNeasy blood and tissue kit (QIAGEN, Hilden, Germany).

2.2. Polymerase Chain Reaction (PCR) Amplification and Sequencing

After modifying the primers designed by Simon et al. [43] and Ma et al. [44] in combination with published sequences of Machilinae, we designed 15 pairs of universal primers for amplification of mitogenomes (Table 1). PCR was performed using a BioRAD MJ mini personal thermal cycler (California, USA). Based on the sequence information obtained from earlier PCR runs using universal primers, several pairs of specific primers were then designed to obtain the whole mitogenome. Both PCR amplifications and reaction volume were carried out using methods described previously [17]. All PCR products were sequenced in both directions by Sangon Biotech Company (Shanghai, China).

2.3. Sequence Analyses and Annotation

Raw sequence files were proofread and assembled using SeqMan in DNASTAR package v.6.0 [45]. The tRNA genes were identified and their cloverleaf secondary structures were determined by MITOS [46]. The locations of the 13 protein-coding genes (PCGs) and two rRNA genes were determined by comparing with homologous sequences of other Microcoryphia mitogenomes [44,47], and the 13 PCGs were translated into amino acids by MEGA 7.0 [48]. The codon skews, relative synonymous codon usage (RSCU), nucleotide composition, and AT and GC skews were calculated using Phylosuite v1.1.16 [49]. Two mitogenome maps were drawn using CGView server V 1.0 [50]. Hairpin structures were identified using RNA secondary structure prediction (http://www.genebee.msu.su/services/rna2_reduced.html, accessed on 26 April 2021) [51].

2.4. Phylogenetic Analyses of Microcoryphia

Since Microcoryphia is located at the base of the class Insecta, we chose Xibalbanus tulumensis (Nectiopoda: Speleonectidae) [52] and Daphnia magna (Anomopoda: Daphniidae) (MT199637) as the outgroups for phylogenetic analyses in this study. To date, only 10 mitogenomes of Microcoryphia were available for download from the NCBI [44,47,53,54,55,56]. Therefore, we combined all mitogenomes of Microcoryphia as the ingroup including C. coreanus and C. songi along with the two outgroups in order to discuss the phylogenetic relationships in Microcoryphia. Accession numbers of all bristletail mitogenomes are listed in Table 2. Sequences of the thirteen PCGs were extracted from the mitogenomes using PhyloSuite v1.1.16 [49], and aligned in batches with MAFFT integrated into PhyloSuite v1.1.16 using codon-alignment mode. Gblocks in PhyloSuite v1.1.16 was used to remove ambiguous sites. Finally, the 13 protein-coding genes were linked into a single line using concatenate sequence in PhyloSuite v1.1.16. We used the program PartionFinder 1.1.1 [57] to estimate the best partitioning scheme and model according to the Bayesian information criterion (BIC). ML analysis was conducted in RAxML 8.2.0 [58] with the best model of GTRGAMMA and 1000 bootstrap replications. BI analysis was conducted using the MrBayes 3.1 [59] with the model of GTR + I + G set for 10 million generations with sampling every 1000 generations. The first 25% of generations were discarded as burn-in and the average standard deviation of split frequencies in MrBayes 3.1 was below 0.01.

2.5. Selection Pressure Analyses of Coreamachilis

The ratio of non-synonymous-to-synonymous (dn/ds) ω can indicate selection pressure at the protein level, with ω = 1, ω > 1 and ω < 1 meaning neutral selection, positive selection and negative selection, respectively [60]. The ω value was calculated by the codon-based maximum likelihood method using the CodeML algorithm [60] implemented in the EasyCodeML [61]. Four different models were used to test the selection pressure, including the site model, clade model, branch model and branch-site model. We chose C. coreanus and C. songi as the foreground branch, respectively, and others as the background branch using three different model selections (the clade model, branch model and branch-site model). The branch models were performed under the one-ratio model (M0) or the two-radio model, the former presuming that ω in specific branches was different from the rest of the tree. Also, the branch-site models were combined with heterogeneous ω across sites and branches (model A) and can be compared against a null model (model A null), which made it possible to find neutral evolution and negative selection. Likelihood ratio tests (LRTs) and Bayes empirical Bayes (BEB) were used to assess these models and evaluate the posterior probability of positive selection sites, respectively. The likelihood ratio test (LRT) was used to compare the statistical model in order to determine whether there were differences between them.

3. Results and Discussion

3.1. Specimen Collection and Mitogenome Structure

We gathered over three hundred C. coreanus female individuals in our collection area, Liaoyang city, Liaoning Province, China, between 2005 and 2015, finding no males among these specimens. Similarly, Mendes [3] collected C. coreanus species in North Korea, but did not find any male individuals. Hence, it can be inferred that parthenogenic reproduction has emerged in C. coreanus. Only two species of Meinertellidae [62], two species of Petrobiinae [63], and several species of Machilinae [1,64] were previously found to exhibit parthenogenesis. In addition, we collected male and female individuals of C. Songi, indicating that it was indeed using the sexual reproduction strategy as reported [4,5].
The complete mitogenomes of C. coreanus and C. songi were circular DNA molecules of 15,578 bp and 15,570 bp in length, respectively (Table 3). By comparison, the other 10 sequenced mitogenomes of Microcoryphia ranged from 15,473 bp [47] to 16,197 bp [56]. Both the C. coreanus and C. songi genomes encoded 13 PCGs, two rRNA genes, and 22 tRNA genes (Figure 1), which is consistent with typical insect mitogenomes [65]. Among these, 23 genes were located on the heavy (H) strand and the other 14 genes were on the light (L) strand (Table 3). The gene order of the C. coreanus and C. songi mitogenomes were the same as those of typical insects. Among the 12 mitogenomes of Microcoryphia, including the two mitogenomes in this study, ten of them had the same gene arrangement, except for Petrobius brevistylis [55] and Trigoniophthalmus alternatus [56]. In the mitogenomes of C. coreanus and C. songi, the tRNAAla–tRNAArg–tRNAAsn–tRNASer1–tRNAGlu–tRNAPhe cluster was found between ND3 and ND5 genes (Figure 1), as also occurred in eight other mitogenomes of bristletails, except for P. brevistylis [55], which showed a cluster of tRNAArg–tRNAAsn–tRNASer1–tRNAGlu–tRNAAla–tRNAPhe and T. alternatus with a tRNAAla–tRNAArg–tRNAAsn–tRNASer1–tRNAGlu–tRNATyr–tRNAPhe cluster.
There were some overlaps (34 bp and 35 bp) and intergenic regions (37 bp and 60 bp) in the mitogenomes of C. coreanus and C. songi, respectively. Among other Microcoryphia mitogenomes, the overlaps ranged from 13 bp to 38 bp, and the intergenic regions ranged from 77 bp to 230 bp. The intergenic region of C. coreanus was the shortest among the sequenced Microcoryphia, largely due to the short intergenic region between ND1 and tRNASer2, which was always longer than 20 bp in most of the Microcoryphia species, but was only 6 bp in C. coreanus.
The nucleotide composition of the C. songi mitogenome was A = 36.38%, T = 35.33%, C = 16.68%, and G = 11.61%, and was very similar to C. coreanus, which was as A = 36.67%, T = 35.37%, C = 16.66%, and G = 11.30%. There were strong A + T biases in both C. songi and C. coreanus, 71.7% and 72.1%, respectively, and these were within the range of other Microcoryphia mitogenomes (67.9–74.4%). The skew statistics showed that there was a positive AT skew and negative GC skew in both C. coreanus and C. songi (Table 4).

3.2. Protein-Codon Genes and Codon Usages

There were 13 PCGs identified in the mitogenomes of C. coreanus and C. songi, and nine of them were located on the heavy strand (H-strand), whereas the others were on the light strand (L-strand) (Figure 1). Most of the PCGs used ATN (N represents A, G, C, or T) as the start codon, except for ND2 in C. coreanus, which used TTG as the start codon (Table 3). Although ATN has been accepted as the canonical mitochondrial start codon for insect mitogenomes [65], TTG is also regarded as a start codon [66]. In fact, before being found in C. coreanus, TTG had only been found for the COX1 gene of the T. alternatus mitogenome in the Microcoryphia order [56]. In the C. coreanus mitogenome, there were seven genes that used ATG as the start codon, which was the same as in C. songi. Four genes used ATT as the start codon in C. coreanus and five genes used ATT in C. songi. The COX3 gene of C. coreanus and C. songi used ATA as the start codon (Table 5).
The stop codon usage was the same in both C. coreanus and C. songi. Eleven genes used ATT as the stop codon, whereas an incomplete stop codon (T) was used in COX1 and ND1 genes (Table 5). It is common, in metazoan mitochondrial genomes, to see an incomplete stop codon, and these truncated stop codons are presumed to be completed by post-transcriptional polyadenylation [67].
The A + T content of the 13 PCGs was 69.1% and 69% in C. coreanus and C. songi, respectively. The AT skew and GC skew were negative in both the species (Table 4). The RSCU of C. coreanus and C. songi is shown in Figure 2. The most frequently encoded amino acids were Leu (UUR), Phe, and Ile (>300), whereas the least frequently used amino acid was Cys (<45).

3.3. Ribosomal RNAs, Transfer RNAs and Hairpin Structures

Of the 22 tRNA genes, 14 tRNAs were encoded on the heavy strand (H-strand), whereas the other eight tRNAs were encoded on the light strand (L-strand). Both rRNAs were on the light strand (Table 3). As in other Microcoryphia mitogenomes, the 16S rRNA gene was located between tRNALeu and tRNAVal, with a length of 1332 bp and 1322 bp in C. coreanus and C. songi, respectively. Located between tRNAVal and the CR, the 12S rRNA gene was 813 bp and 806 bp in C. coreanus and C. songi, respectively.
The total length of the tRNAs was 938 bp and 1001 bp, with an average A + T content of 74% and 73.4% in C. coreanus and C. songi, respectively. In both the mitogenomes, most of the tRNA genes displayed the common cloverleaf secondary structure, except for tRNASer (AGN), which had lost the dihydrouridine (DHU) arm (Figure S1), as often found in other insect mitogenomes [44].
A novel hairpin structure was located in the ND1 and 16S rRNA genes, with a length of about 60 bp in the mitogenomes of both (Figure 3C,D). In fact, we found a similar hairpin structure in 7 out of the 10 known bristletails mitogenomes (Figure 3A,B,E–I). Some hairpin structures have been found in other species, but all of them were short (less than 10 bp) and mostly located between PCGs [20,21,22,23,24,25]. Such sequences were suggested to have a potential role as a secondary strand-replication origin [25]. In this case, the stop codon of one of the PCGs was incomplete (T or TA), and the 3′-end region of this gene has the potential to form a hairpin structure with the beginning region of the neighboring protein-coding gene, which is important for the precise cleavage of the mature protein-coding genes [67,68,69]. In the mitogenomes of C. coreanus and C. songi, the stop codon of ND1 was incomplete, but the stem of the hairpin structure in the 16S gene was not at the beginning. Also, there were similar hairpin structures in other bristletail mitogenomes, but all the stop codons of ND1 in those mitogenomes were complete (Table 4), and the stems of the hairpin structures were not at the 3′-end region or beginning region. As for other genes with incomplete stop codons, we did not find any other long hairpin structures like this in other insect orders. In the A + T-rich region, it was reported that stem–loop structures could be formed. Also, it has been mentioned that conserved regions of single stem–loop structure (the 5′ flanking sequences with “TTATA”, while 3′ flanking sequences with a “G(A)nT” motif) have been observed in a variety of insect orders [24,26]. This stem–loop structure in the A + T-rich region was suggested as the site of the initiation of secondary strand synthesis [21,24,26]. However, the hairpin structures we found were not in the control region, and none of the conserved structure was found. This hairpin structure between the ND1 and 16S RNA genes, first reported in Microcoryphia, appears to be novel and about 60 bp in length, with certain homologous segments (Figure 4), unlike the short hairpin structures previously found. No relevant studies about such a structure were found during an online search of the literature, and if a similar hairpin structure can be found in other species, it would be interesting to explore its function.

3.4. A + T Rich Region

The largest non-coding region of bristletail mitogenomes was the control region, which was located between the 12S rRNA and tRNAIle genes. The length of the A + T-rich region of C. coreanus and C. songi mtDNA was 736 bp and 734 bp, respectively. Ten other Microcoryphia mitogenomes, published online, showed lengths of the A + T-rich region ranging from 538 bp (N. australica) to 1149 bp (T. alternatus).

3.5. Phylogenetic Analyses and Selection Pressure Analyses

We constructed BI and ML trees with the nucleotide sequences of the 13 mitochondrial protein-coding genes, including 12 Microcoryphia species and two outgroup species (X. tulumensis and D. magna), to perform phylogenetic analyses (Figure 4). The topologies of BI and ML analyses were the same. The monophyly of Machilidae failed to be supported because Meinertellidae was clustered into Machilidae and formed a sister clade to Petrobiellinae. The monophyly of Machilinae and Petrobiinae also failed to be supported, because T. alternatus, belonging to Machilinae, was clustered into the subfamily Petrobiinae (Figure 4). Similar results were also presented in the study by Ma et al. [44]. The previous main diagnosis of the Machilinae subfamily was via morphological characters of plesiomorphies [1], but our phylogenetic tree-based result was not congruent with this morphological taxonomy. The classification of Trigoniophthalmus genus should be reconsidered in combination with phylogenetic trees and morphological characteristics. The clade consisting of (Songmachilis xinxiangensis + (Allopsontus baii + (A. helanensis + (C. coreanus + C. songi)))) strongly supported the non-monophyly of Allopsontus and the monophyly of Coreamachilis in BI and ML analyses. The genus Coreamachilis was proposed as a monophyletic group, which is consistent with the morphological taxonomy, as well as sequence analysis of COX1 from the mitogenome [70]. However, the paraphyly of Allopsontus suggested that the subgenera of Allopsontus should be further assessed, because A. baii and A. helanensis belong to the genus Allopsontus s. s. Silvestri, 1911 and Allopsonsus (Anisopsontus) Mendes, 1990 [71]. Our results suggest that the morphological classification at the genus level can be further improved by combining phylogenetic relationships. It was interesting that the hairpin structure between ND1 and 16S RNA genes is a synapomorphy of the clade including Machilinae and Petrobiinae. (Figure 3). In addition, in the clade with the long hairpin structure, the homologous segments of hairpin structures aggregated together are more alike (Figure 4). The five species of Machilinae were grouped into a branch, and their stem sequences in the hairpin structure showed a high similarity (Figure 5A). At the same time, the remaining clades with a hairpin structure were also of relative similarity (Figure 5B). It is well known that gene order and genome organization can provide useful genetic information to understand evolutionary relationships [72]. Hence, intergenic regions can be used as a synapomorphy for a genus [18,19]. The hairpin structure found in this study is located in the gene spacer between ND1 and 16S, and as a special structure, it is highly correlated with the results of the phylogenetic tree. Hence, we indicate that the long hairpin structure may be useful as a molecular characteristic to discuss phylogenetic relationships within Microcoryphia.
The phylogenetic tree developed from the current data was used for selection pressure analyses. Four different models were used in the test, including the site model (M3 vs. M0, M1a vs. M2a, M7 vs. M8, and M8 vs. M8a), clade model (CmC vs. M2a_rel), branch model (two-ratio model vs. M0), and branch-site model (A vs. A null) (Table S1). We chose Coreamachilis as the foreground branch and other species as the background branch in the clade model, branch model, and branch-site model. However, the LRTs did not indicate any sign of positive selection (p > 0.05). Since C. coreanus and C. songi reproduced differently, we calculated the selective pressures on each of them, to see if there was an adaptive evolution at the mitochondrial gene level for the differences in reproductive patterns. However, the results did not indicate any sign of positive selection either (Tables S2 and S3). Neither C. coreanus (with parthenogenesis) nor C. songi (with sexual reproduction) were subject to any positive selection. In a word, it was suggested that differences in Coreamachilis reproductive patterns may not result from adaptive evolution on the mitogenome.

4. Conclusions

We successfully sequenced the complete mitogenomes of C. coreanus and C. songi, which showed similar gene characteristics to the other 10 species of Microcoryphia with published mitogenomes. We found a special long hairpin structure (about 60 bp) located between ND1 and 16S RNA genes of C. coreanus and C. songi, which was also found in seven known bristletail mitogenomes belonging to Petrobiinae and Machilinae. However, the function and formation of this long hairpin structure remain unclear, and still need to be explored. Since the hairpin structure is highly correlated with the phylogenetic tree, the long hairpin structure can be used as the synapomorphy for Machilinae and Petrobiinae. Both BI and ML analyses supported the genus Coreamachilis as a monophyletic group, whereas the monophyly of Allopsontus was not recovered. Neither C. coreanus (with parthenogenesis) nor C. songi (with sexual reproduction) were subject to any positive selection.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/insects12090795/s1: Figure S1. Inferred secondary structures of the tRNA genes in C. coreanus (A) and C. songi (B); Table S1. CodeML analysis of mitochondrial protein-encoding genes (13 genes) (choosing Coreamachilis as the foreground branch); Table S2. CodeML analysis of mitochondrial protein-encoding genes (13 genes) (choosing C. songi as the foreground branch); Table S3. CodeML analysis of mitochondrial protein-encoding genes (13 genes) (choosing C. coreanus as the foreground branch).

Author Contributions

Conceptualization, J.-Y.Z.; D.-N.Y.; S.-Q.S.; J.-Y.G.; methodology, J.-Y.Z.; D.-N.Y.; S.-Q.S.; J.-Y.G.; Z.-Y.Z.; X.-D.X.; statistical analysis, S.-Q.S.; J.-Y.G.; Z.-Y.Z.; X.-D.X.; investigation, D.-N.Y.; S.-Q.S.; J.-Y.G.; Z.-Y.Z.; X.-D.X.; J.-Y.Z.; data curation, S.-Q.S.; J.-Y.G.; Z.-Y.Z.; X.-D.X.; K.B.S.; Writing—original draft preparation, J.-Y.Z.; D.-N.Y.; S.-Q.S.; J.-Y.G.; Z.-Y.Z.; X.-D.X.; K.B.S.; writing—review and editing, J.-Y.Z.; D.-N.Y.; S.-Q.S.; J.-Y.G.; Z.-Y.Z.; X.-D.X.; K.B.S.; maps and graphics, S.-Q.S.; J.-Y.G.; Z.-Y.Z.; X.-D.X.; project administration, J.-Y.Z.; D.-N.Y.; K.B.S.; funding acquisition, J.-Y.Z.; D.-N.Y.; J.-Y.G.; X.-D.X.; All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Natural Science Foundation of Zhejiang Province (LY18C040004), the College Students’ Innovation and Entrepreneurship Project of China (201910345030, 202010345026 and 202110345014) and the College Students’ Innovation and Entrepreneurship Project of Zhejiang Province (202010345R128). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The data supporting the findings of this study are openly available in National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov), accession numbers were MW752137 (Coreamachilis coreanus) and MW752138 (Coreamachilis songi).

Acknowledgments

We are grateful to Yue Ma for his help in the experiment.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Sturm, H.; Machida, R. Handbook of Zoology; Walter de Gruyter: Berlin, Germany, 2001; Volume 4. [Google Scholar]
  2. Mendes, L.F. Biodiversity of the Thysanurans (Microcoryphia and Zygentoma). In Insect Biodiversity: Science and Society; John Wiley & Sons: Hoboken, NJ, USA, 2018. [Google Scholar]
  3. Mendes, L.F. New contribution towards the knowledge of the Northern Korean thysanurans (Microcoryphia and Zygentoma: Insecta). Garcia Orta 1991, 18, 67–78. [Google Scholar]
  4. Zhang, J.Y.; Zhou, K.Y. Descriptions of one new genus and six new species of Machilidae (Insecta: Archaeognatha) from China: Morphological and molecular data. J. Nat. Hist 2011, 45, 1131–1164. [Google Scholar] [CrossRef]
  5. Mendes, L.F. An annotated list of generic and specific names of Machilidae (Microcoryphia, Insecta) with identification keys for the genera and geographical notes. Estud. Ens. Doc. (Port.) 1990, 155, 1–127. [Google Scholar]
  6. Gassner, M.; Dejaco, T.; Schönswetter, P.; Marec, F.; Arthofer, W.; Schlick-Steiner, B.C.; Steiner, F.M. Extensive variation in chromosome number and genome size in sexual and parthenogenetic species of the jumping bristletail genus Machilis (Archaeognatha). Ecol. Evolut. 2014, 4, 4093–4105. [Google Scholar] [CrossRef] [PubMed]
  7. Kearney, M.; Blacket, M.J.; Strasburg, J.L.; Moritz, C. FAST-TRACK: Waves of parthenogenesis in the desert: Evidence for the parallel loss of sex in a grasshopper and a gecko from Australia. Mol. Ecol. 2006, 15, 1743–1748. [Google Scholar] [CrossRef] [PubMed]
  8. Vorburger, C. Geographic parthenogenesis: Recurrent patterns down under. Curr. Biol. 2006, 16, R641–R643. [Google Scholar] [CrossRef] [Green Version]
  9. Rispe, C.; Pierre, J.S. Coexistence between cyclical parthenogens, obligate parthenogens, and intermediates in a fluctuating environment. J. Theor. Biol. 1998, 195, 97–110. [Google Scholar] [CrossRef]
  10. Stuart-Fox, D.M.; Ord, T.J. Sexual selection, natural selection and the evolution of dimorphic coloration and ornamentation in agamid lizards. Proc. Biol. Sci. 2004, 271, 2249–2255. [Google Scholar] [CrossRef] [PubMed]
  11. Krüger, O.; Davies, N.B.; Sorenson, M.D. The evolution of sexual dimorphism in parasitic cuckoos: Sexual selection or coevolution? Proc. Biol. Sci. 2018, 274, 1553–1560. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Boore, J.L. Animal mitochondrial genomes. Nucleic Acids Res. 1999, 27, 1767–1780. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Boore, J.L. The use of genome-level characters for phylogenetic reconstruction. Trends Ecol. Evolut. 2006, 21, 439–446. [Google Scholar] [CrossRef]
  14. Cameron, S.L. Insect Mitochondrial Genomics: Implications for Evolution and Phylogeny. Annu. Rev. Entomol. 2014, 59, 95–117. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Cheng, X.F.; Zhang, L.P.; Yu, D.N.; Storey, K.B.; Zhang, J.Y. The complete mitochondrial genomes of four cockroaches (Insecta: Blattodea) and phylogenetic analyses within cockroaches. Gene 2016, 586, 115–122. [Google Scholar] [CrossRef]
  16. Gao, X.Y.; Cai, Y.Y.; Yu, D.N.; Storey, K.B.; Zhang, J.Y. Characteristics of the complete mitochondrial genome of Suhpalacsa longialata (Neuroptera, Ascalaphidae) and its phylogenetic implications. PeerJ 2018, 6, e5914. [Google Scholar] [CrossRef] [Green Version]
  17. Zhang, L.P.; Yu, D.N.; Storey, K.B.; Cheng, H.Y.; Zhang, J.Y. Higher tRNA gene duplication in mitogenomes of praying mantises (Dictyoptera, Mantodea) and the phylogeny within Mantodea. Int. J. Biol. Macromol. 2018, 111, 787–795. [Google Scholar] [CrossRef] [PubMed]
  18. Xu, X.D.; Jia, Y.Y.; Cao, S.S.; Zhang, Z.Y.; Storey, K.B.; Yu, D.N.; Zhang, J.Y. Six complete mitochondrial genomes of mayflies from three genera of Ephemerellidae (Insecta: Ephemeroptera) with inversion and translocation of trnI rearrangement and their phylogenetic relationships. PeerJ 2020, 8, e9740. [Google Scholar] [CrossRef] [PubMed]
  19. Ye, F.; Lan, X.E.; Zhu, W.B.; You, P. Mitochondrial genomes of praying mantises (Dictyoptera, Mantodea): Rearrangement, duplication, and reassignment of tRNA genes. Sci. Rep. 2016, 6, 25634. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  20. Clary, D.O.; Wolstenholme, D.R. The mitochondrial DNA molecule of Drosophila yakuba: Nucleotide sequence, gene organization, and genetic code. J. Mol. Evolut. 1985, 22, 252–271. [Google Scholar] [CrossRef] [PubMed]
  21. Clary, D.O.; Wolstenholme, D.R. The ribosomal RNA genes of Drosophila mitochondrial DNA. Nucleic Acids Res. 1985, 13, 4029–4045. [Google Scholar] [CrossRef] [Green Version]
  22. Fenn, J.D.; Cameron, S.L.; Whiting, M.F. The complete mitochondrial genome sequence of the Mormon cricket (Anabrus simplex: Tettigoniidae: Orthoptera) and an analysis of control region variability. Insect Mol. Biol. 2007, 16, 239–252. [Google Scholar] [CrossRef]
  23. Hatzoglou, E.; Rodakis, G.C.; Lecanidou, R. Complete sequence and gene organization of the mitochondrial genome of the land snail Albinaria coerulea. Genetics 1995, 140, 1353–1366. [Google Scholar] [CrossRef]
  24. Hong, M.Y.; Lee, E.M.; Jo, Y.H.; Park, H.C.; Kim, S.R.; Hwang, J.S.; Jin, B.R.; Kang, P.D.; Kim, K.G.; Han, Y.S.; et al. Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects. Gene 2008, 413, 49–57. [Google Scholar] [CrossRef] [PubMed]
  25. Kim, I.; Lee, E.M.; Seol, K.Y.; Yun, E.Y.; Lee, Y.B.; Hwang, J.S.; Jin, B.R. The mitochondrial genome of the Korean hairstreak, Coreana raphaelis (Lepidoptera: Lycaenidae). Insect Mol. Biol. 2006, 15, 217–225. [Google Scholar] [CrossRef] [PubMed]
  26. Yu, X.L.; Tan, W.; Zhang, H.Y.; Jiang, W.L.; Gao, H.; Wang, W.X.; Liu, Y.X.; Wang, Y.; Tian, X.X. Characterization of the complete mitochondrial genome of Harpalus sinicus and its implications for phylogenetic analyses. Genes (Basel) 2019, 10, 724. [Google Scholar] [CrossRef] [Green Version]
  27. Ballard, J.W.O.; Kreitman, M. Is mitochondrial DNA a strictly neutral marker? Trends Ecol. Evolut. 1995, 10, 485–488. [Google Scholar] [CrossRef]
  28. Ruiz-Pesini, E.; Mishmar, D.; Brandon, M.; Procaccio, V.; Wallace, D.C. Effects of purifying and adaptive selection on regional variation in human mtDNA. Science 2004, 303, 223–226. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Moyer, G.R.; Winemeller, K.O.; McPhee, M.V.; Turner, T.F. Historical demography, selection, and coalescence of mitochondrial and nuclear genes in Prochilodus species of northern South America. Evolution 2005, 59, 599–610. [Google Scholar] [CrossRef] [PubMed]
  30. Bazin, E.; Glémin, S.; Galtier, N. Population size does not influence mitochondrial genetic diversity in animals. Science 2006, 312, 570–572. [Google Scholar] [CrossRef]
  31. Yang, Y.X.; Xu, S.X.; Xu, J.X.; Guo, Y.; Yang, G. Adaptive evolution of mitochondrial energy metabolism genes associated with increased energy demand in flying insects. PLoS ONE 2014, 9, e99120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Li, X.D.; Jiang, G.F.; Yan, L.Y.; Li, R.; Mu, Y.; Deng, W.A. Positive selection drove the adaptation of mitochondrial genes to the demands of flight and high-altitude environments in grasshoppers. Front. Genet. 2018, 9, 605. [Google Scholar] [CrossRef] [Green Version]
  33. Cai, Y.T.; Li, Q.; Zhang, J.Y.; Storey, K.B.; Yu, D.N. Characterization of the mitochondrial genomes of two toads, Anaxyrus americanus (Anura: Bufonidae) and Bufotes pewzowi (Anura: Bufonidae), with phylogenetic and selection pressure analyses. PeerJ 2020, 8, e8901. [Google Scholar] [CrossRef]
  34. Mishmar, D.; Ruiz Pesini, E.; Golik, P.; Macaulay, V.; Clark, A.G.; Hosseini, S.; Brandon, M.; Easley, K.; Chen, E.; Brown, M.D.; et al. Natural selection shaped regional mtDNA variation in humans. Proc. Natl. Acad. Sci. USA 2003, 100, 171–176. [Google Scholar] [CrossRef] [Green Version]
  35. da Fonseca, R.R.; Johnson, W.E.; O’Brien, S.J.; Ramos, M.J.; Antunes, A. The adaptive evolution of the mammalian mitochondrial genome. BMC Genom. 2008, 9, 119. [Google Scholar] [CrossRef] [Green Version]
  36. Galtier, N.; Blier, P.U.; Nabholz, B. Inverse relationship between longevity and evolutionary rate of mitochondrial proteins in mammals and birds. Mitochondrion 2009, 9, 51–57. [Google Scholar] [CrossRef] [PubMed]
  37. Marshall, H.D.; Coulson, M.W.; Carr, S.M. Near neutrality, rate heterogeneity, and linkage govern mitochondrial genome evolution in Atlantic cod (Gadus morhua) and other gadine fish. Mol. Biol. Evolut. 2008, 26, 579–589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Oliveira, D.C.; Raychoudhury, R.; Lavrov, D.V.; Werren, J.H. Rapidly evolving mitochondrial genome and directional selection in mitochondrial genes in the parasitic wasp Nasonia (Hymenoptera: Pteromalidae). Mol. Biol. Evolut. 2008, 25, 2167–2180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Ma, C.; Yang, P.; Jiang, F.; Chapuis, M.P.; Shali, Y.; Sword, G.A.; Kang, L. Mitochondrial genomes reveal the global phylogeography and dispersal routes of the migratory locust. Mol. Ecol. 2012, 21, 4344–4358. [Google Scholar] [CrossRef] [PubMed]
  40. Xu, X.D.; Guan, J.Y.; Zhang, Z.Y.; Cao, Y.R.; Cai, Y.Y.; Storey, K.B.; Yu, D.N.; Zhang, J.Y. Insight into the phylogenetic relationships among three subfamilies within Heptageniidae (Insecta: Ephemeroptera) along with low-temperature selection pressure analyses using mitogenomes. Insects 2021, 12, 656. [Google Scholar] [CrossRef]
  41. Krzywinski, J.; Li, C.; Morris, M.; Conn, J.E.; Lima, J.B.; Povoa, M.M.; Wilkerson, R.C. Analysis of the evolutionary forces shaping mitochondrial genomes of a Neotropical malaria vector complex. Mol. Phylogenet. Evolut. 2011, 58, 469–477. [Google Scholar] [CrossRef] [Green Version]
  42. Yuan, M.L.; Zhang, Q.L.; Zhang, L.; Jia, C.L.; Li, X.P.; Yang, X.Z.; Feng, R.Q. Mitochondrial phylogeny, divergence history and high-altitude adaptation of grassland caterpillars (Lepidoptera: Lymantriinae: Gynaephora) inhabiting the Tibetan Plateau. Mol. Phylogenet. Evolut. 2018, 122, 116–124. [Google Scholar] [CrossRef]
  43. Simon, C.; Buckley, T.R.; Frati, F.; Stewart, J.B.; Beckenbach, A.T. Incorporating molecular evolution into phylogenetic analysis, and a new compilation of conserved polymerase chain reaction primers for animal mitochondrial DNA. Ann. Rev. Ecol. Evolut. Syst. 2006, 37, 545–579. [Google Scholar] [CrossRef] [Green Version]
  44. Ma, Y.; He, K.; Yu, P.P.; Yu, D.N.; Cheng, X.F.; Zhang, J.Y. The complete mitochondrial genomes of three bristletails (Insecta: Archaeognatha): The paraphyly of Machilidae and insights into Archaeognathan phylogeny. PLoS ONE 2015, 10, e0117669. [Google Scholar] [CrossRef]
  45. Burland, T.G. DNASTAR’s Lasergene sequence analysis software. In Bioinformatics Methods and Protocols; Misener, S., Krawetz, S.A., Eds.; Humana Press: Totowa, NJ, USA, 2000; Volume 132, pp. 71–91. [Google Scholar]
  46. Bernt, M.; Donath, A.; Jühling, F.; Externbrink, F.; Florentz, C.; Fritzsch, G.; Pütz, J.; Middendorf, M.; Stadler, P.F. MITOS: Improved de novo metazoan mitochondrial genome annotation. Mol. Phylogenet. Evolut. 2013, 69, 313–319. [Google Scholar] [CrossRef] [PubMed]
  47. He, K.; Zhang, J.Y.; Deng, K.Z.; Chen, Z. The complete mitochondrial genome of the bristletail Songmachilis xinxiangensis (Archaeognatha: Machilidae). Mitochondrial DNA 2013, 24, 99–101. [Google Scholar] [CrossRef] [PubMed]
  48. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evolut. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
  49. Zhang, D.; Gao, F.; Li, W.X.; Jakovlić, I.; Zou, H.; Zhang, J.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 20, 348–355. [Google Scholar] [CrossRef]
  50. Grant, J.R.; Stothard, P. The CGView Server: A comparative genomics tool for circular genomes. Nucleic Acids Res. 2008, 36, W181–W184. [Google Scholar] [CrossRef]
  51. Brodskiĭ, L.I.; Ivanov, V.V.; Kalaĭdzidis Ia, L.; Leontovich, A.M.; Nikolaev, V.K.; Feranchuk, S.I.; Drachev, V.A. GeneBee-NET: An Internet based server for biopolymer structure analysis. Biokhimiia 1995, 60, 1221–1230. [Google Scholar]
  52. Lavrov, D.V.; Brown, W.M.; Boore, J.L. Phylogenetic position of the Pentastomida and (pan) crustacean relationships. Proc. R. Soc. Lond. Ser. B Biol. Sci. 2004, 271, 537–544. [Google Scholar] [CrossRef] [PubMed]
  53. Cameron, S.L.; Miller, K.B.; D’Haese, C.A.; Whiting, M.F.; Barker, S.C. Mitochondrial genome data alone are not enough to unambiguously resolve the relationships of Entognatha, Insecta and Crustacea sensu lato (Arthropoda). Cladistics 2004, 20, 534–557. [Google Scholar] [CrossRef]
  54. Zhang, J.Y.; Song, D.X.; Zhou, K.Y. The complete mitochondrial genome of the bristletail Pedetontus silvestrii (Archaeognatha: Machilidae) and an examination of mitochondrial gene variability within four bristletails. Ann. Entomol. Soc. Am. 2008, 101, 1131–1136. [Google Scholar] [CrossRef]
  55. Podsiadlowski, L. The mitochondrial genome of the bristletail Petrobius brevistylis (Archaeognatha: Machilidae). Insect Mol. Biol. 2006, 15, 253–258. [Google Scholar] [CrossRef] [PubMed]
  56. Carapelli, A.; Liò, P.; Nardi, F.; Van der Wath, E.; Frati, F. Phylogenetic analysis of mitochondrial protein coding genes confirms the reciprocal paraphyly of Hexapoda and Crustacea. BMC Evolut. Biol. 2007, 7, S8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Lanfear, R.; Calcott, B.; Ho, S.Y.W.; Guindon, S. PartitionFinder: Combined selection of partitioning schemes and substitution models for phylogenetic analyses. Mol. Biol. Evolut. 2012, 29, 1695–1701. [Google Scholar] [CrossRef] [Green Version]
  58. Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
  59. Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 2001, 17, 754–755. [Google Scholar] [CrossRef] [Green Version]
  60. Yang, Z.; Nielsen, R.; Goldman, N.; Pedersen, A.M. Codon-substitution models for heterogeneous selection pressure at amino acid sites. Genetics 2000, 155, 431–449. [Google Scholar] [CrossRef]
  61. Gao, F.L.; Chen, C.J.; Arab, D.A.; Du, Z.G.; He, Y.H.; Ho, S.Y.W. EasyCodeML: A visual tool for analysis of selection using CodeML. Ecol. Evolut. 2019, 9, 3891–3898. [Google Scholar] [CrossRef] [Green Version]
  62. Notario Muñoz, M.J.; Molero Baltanás, R.; de Roca, C.B.; Gaju Ricart, M. New Data on the distribution and biology of Machiloides tenuicornis Stach, 1930 (Microcoryphia: Meinertellidae) in the Iberian Peninsula (western Palaeartic). Soil Org. 2013, 85, 23–29. [Google Scholar]
  63. Wygodzinsky, P.W.; Schmidt, K. Survey of the Microcoryphia (Insecta) of the northeastern United States and adjacent provinces of Canada. Am. Mus. Novit. (USA) 1980, 2701, 17. [Google Scholar]
  64. Wygodzinsky, P.W. Beiträge zur Kenntnis der Dipluren und Thysanuren der Schweiz. Denkschr. Schweiz. Nat. Ges. 1941, 74, 110–227. [Google Scholar]
  65. Wolstenholme, D.R. Animal mitochondrial DNA: Structure and evolution. In International Review of Cytology; Elsevier: Amsterdam, The Netherlands, 1992; Volume 141, pp. 173–216. [Google Scholar]
  66. Li, H.; Liu, H.Y.; Cao, L.M.; Shi, A.M.; Yang, H.L.; Cai, W.Z. The complete mitochondrial genome of the damsel bug Alloeorhynchus bakeri (Hemiptera: Nabidae). Int. J. Biol. Sci. 2012, 8, 93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  67. Ojala, D.; Montoya, J.; Attardi, G. tRNA punctuation model of RNA processing in human mitochondria. Nature 1981, 290, 470–474. [Google Scholar] [CrossRef]
  68. Ojala, D.; Merkel, C.; Gelfand, R.; Attardi, G. The tRNA genes punctuate the reading of genetic information in human mitochondrial DNA. Cell 1980, 22, 393–403. [Google Scholar] [CrossRef]
  69. Bibb, M.J.; Van Etten, R.A.; Wright, C.T.; Walberg, M.W.; Clayton, D.A. Sequence and gene organization of mouse mitochondrial DNA. Cell 1981, 26, 167–180. [Google Scholar] [CrossRef]
  70. Mendes, L.F.; Baltanás, R.M.; Ricart, M.G.; de Roca, C.B. Description of a new species of Machilinus Silvestri, 1904 from the Canary Islands (Microcoryphia: Meinertellidae). Vieraea Folia Sci. Biol. Canar. 2010, 38, 91–98. [Google Scholar]
  71. Bai, X.S.; Cai, W.Z. Nonnaizab: Insects in Helan Mountain of Inner Mongolia; Inner Mongolia People’s Publishing House: Hohhot, China, 2013. [Google Scholar]
  72. Sun, C.H.; Liu, H.Y.; Lu, C.H. Five new mitogenomes of Phylloscopus (Passeriformes, Phylloscopidae): Sequence, structure, and phylogenetic analyses. Int. J. Biol. Macromol. 2020, 146, 638–647. [Google Scholar] [CrossRef]
Figure 1. Mitochondrial genome maps of C. coreanus (A) and C. songi (B). The first circle shows the gene map (PCGs, rRNAs, tRNAs and the AT-rich region) and the genes outside the map are coded on the majority strand (J-strand) whereas the genes inside the map are coded on the minority strand (N-strand). The second circle shows the GC content and the third shows the GC skew. GC content and GC skew are plotted as the deviation from the average value of the entire sequence.
Figure 1. Mitochondrial genome maps of C. coreanus (A) and C. songi (B). The first circle shows the gene map (PCGs, rRNAs, tRNAs and the AT-rich region) and the genes outside the map are coded on the majority strand (J-strand) whereas the genes inside the map are coded on the minority strand (N-strand). The second circle shows the GC content and the third shows the GC skew. GC content and GC skew are plotted as the deviation from the average value of the entire sequence.
Insects 12 00795 g001
Figure 2. The relative synonymous codon usage (RSCU) in two Microcoryphia mitogenomes. Codon families are provided on the x-axis and the different combinations of synonymous codons that code for each amino acid are defined on the y-axis.
Figure 2. The relative synonymous codon usage (RSCU) in two Microcoryphia mitogenomes. Codon families are provided on the x-axis and the different combinations of synonymous codons that code for each amino acid are defined on the y-axis.
Insects 12 00795 g002
Figure 3. Inferred hairpin structures of nine mitogenomes. The circle means the length between the ND1 gene and 16S RNA gene.
Figure 3. Inferred hairpin structures of nine mitogenomes. The circle means the length between the ND1 gene and 16S RNA gene.
Insects 12 00795 g003
Figure 4. Phylogenetic relationships of Coreamachilis inferred from BI analysis (left) and ML analysis (right) based on 13 mitochondrial protein-coding genes including 12 Microcoryphia species. H. americanus and S. leptosquilla were used as the outgroup. The numbers above branches specify posterior probabilities as determined from BI (left) and bootstrap percentages from ML (right).
Figure 4. Phylogenetic relationships of Coreamachilis inferred from BI analysis (left) and ML analysis (right) based on 13 mitochondrial protein-coding genes including 12 Microcoryphia species. H. americanus and S. leptosquilla were used as the outgroup. The numbers above branches specify posterior probabilities as determined from BI (left) and bootstrap percentages from ML (right).
Insects 12 00795 g004
Figure 5. (A) Alignment of the stem among A. baii, A. helanensis, C. coreanus, C. songi and S. xinxiangensis. (B) Alignment of the stem among P. luanchuanensis, P. silvestri, T. alternatus and P. brevistylis.
Figure 5. (A) Alignment of the stem among A. baii, A. helanensis, C. coreanus, C. songi and S. xinxiangensis. (B) Alignment of the stem among P. luanchuanensis, P. silvestri, T. alternatus and P. brevistylis.
Insects 12 00795 g005
Table 1. List of universal primers used for PCR amplification according to Simon et al. [43].
Table 1. List of universal primers used for PCR amplification according to Simon et al. [43].
NumberPrimer NameSequence (5′-3′)LengthTarget Gene Region
1SB-J-165AAGCTANTGGGYTCATAYCC1000 bptRNAMet-ND2
SB-N-1273CAGCTTTGAAGGCTAWTAGTTT
2SB-J-20GGATTACARTGATAAAGTAAA3000 bptRNAIle-COX1
SB-N-3003TCCRATGCACTTWTCTGCCAAAWTA
3SB-J-2195TGATTYTTTGGNCAYCCHGAAGT1000 bpCOX1
SB-N-3014TCCRATGCACTTATCTGCCAARTTA
4SB-J-2161TATTTTGATTYTTTGGNCAYCCHGAAGT1500 bpCOX1-COX2
SB-N-3646CCACARATTTCNGARCAYTG
5SB-J-3360ACWATHGGDCAYCAATGATAYTG1300 bpCOX2-ATP8
SB-N-4061GARAATARGTTDGTTATCATTTTCA
6SB-J-3645GGCCAATGYTCNGAAATYTGYGG3800 bpCOX2-ND5
SB-N-7462CCWGCDGCTATRGCHGCNCC
7SB-J-5747CCATTYGAATGYGGNTTTGAYCC500 bpND3-tRNAAsn
SB-N-6160CTTAATRDTABCATTAACAGTGR
8J-12517CGGTTTCAACTCAGATCATGTA800 bpND1-16S rRNA
N-13321CACCTGCTTATCAAAAACA
9SB-J-7077ATYAAATCYTTWGARTAAAAHCC700 bpND5
SB-N-7793TTDGGDTGRGATGGDTTDGG
10SB-J-7572AAADGGAATTTGDGCTGTYTTAGT1200 bpND5-ND4
SB-N-8727AARGCDTTAATTGCBTAYTCWTC
11SB-J-8641CCWCTHGARCAYAANCCATG500 bpND4
SB-N-9153TGRGGRTATCARCCWGARCG
12SB-J-8882GGHGCTTCNACRTGAGCYTT2000 bpND4-Cyt b
SB-N-10885CCTCARAANGATATYTGHCCTCA
13SB-J-10690TGYCGAGATGTWAATTAYGGWTG1800 bpCyt b-ND1
SB-N-12489TATRTTCARATTCGDAAAGGDCC
14SB-J-12887CCGGTYTGAACTCAGATCATGT500 bp16S rRNA
SB-N-13398CGCCTGTTTAYCAAAAACATGKC
15SB-J-10873TATGTTYTHCCNTGAGGDCAAATRTC3700 bpCyt b-CR
SB-N-14556TAAACTAGGATTAGATACCCTATTAT
Table 2. Species used to construct the phylogenetic relationships along with GenBank accession numbers.
Table 2. Species used to construct the phylogenetic relationships along with GenBank accession numbers.
OrderFamilySpeciesGenBank Accession NumberReferences
NectiopodaSpeleonectidaeXibalbanus tulumensisNC_005938[52]
AnomopodaDaphniidaeDaphnia magnaMT199637Unpublished
Microcoryphia MeinertellidaeNesomachilis australicaAY793551[53]
MachilidaeAllopsontus baiiKJ754500[44]
Allopsontus helanensisKJ754501[44]
Coreamachilis songiMW752138This study
Coreamachilis coreanusMW752137This study
Pedetontus silvestriiEU621793[54]
Pedetontinus luanchuanensisKJ754502[44]
Petrobiellus bannaensisKJ754503[44]
Petrobiellus puerensisKJ754504[44]
Petrobius brevistylisAY956355[55]
Songmachilis xinxiangensisJX308221[47]
Trigoniophthalmus alternatusEU016193[56]
Table 3. Gene arrangement of C. coreanus (C. c) and C. songi (C. s) mitochondrial genome.
Table 3. Gene arrangement of C. coreanus (C. c) and C. songi (C. s) mitochondrial genome.
GeneStrandPositionStart CodonStop Codon
C. cC. sC. c/C. sC. c/C. s
tRNAIleH1–671–67
tRNAGlnL68–13868–137
tRNAMetH145–210143–208
ND2H211–1239208–1236TTG/ATGTAA/TAA
tRNATrpH1239–13041236–1301
tRNACysL1304–13701301–1368
tRNATyrL1371–14381369–1436
COX1H1431–29751429–2973ATT/ATTTAA/TAA
tRNALeu2(UUA)H2971–30352969–3033
COX2H3042–37293040–3727ATG/ATGT/T
tRNALysH3730–38003728–3798
tRNAAspH3804–38713803–3870
ATP8H3872–40333871–4032ATT/ATTTAA/TAA
ATP6H4027–47044026–4703ATT/ATTTAA/TAA
COX3H4704–54864703–5485ATG/ATGTAA/TAA
tRNAGlyH5489–55565488–5554
ND3H5557–59105555–5908ATC/ATCTAA/TAA
tRNAAlaH5914–59765912–5974
tRNAArgH5979–60495977–6045
tRNAAsnH6050–61166046–6112
tRNASer1H6117–61836113–6179
tRNAGluH6184–62526180–6248
tRNAPheL6254–63186250–6314
ND5L6318–80486315–8045ATG/ATGTAA/TAA
tRNAHisL8050–81138047–8110
ND4L8118–94678115–9464ATG/ATGTAA/TAA
ND4LL9461–97609458–9757ATG/ATGTAA/TAA
tRNAThrH9763–98249760–9821
tRNAProL9825–98879822–9885
ND6H9891–10,3979889–10,395ATT/ATTTAA/TAA
Cyt bH10,397–11,53310,395–11,531ATG/ATGTAA/TAA
tRNASer2H11,532–11,59911,530–11,597
ND1L11,606–12,55411,604–12,531ATG/ATTT/T
tRNALeu1(CUA)L12,555–12,62012,553–12,618
16S rRNAL12,621–13,95912,619–13,953
tRNAValL13,960–14,03213,954–14,026
12S rRNAL14,033–14,84114,027–14,836
CR 14,842–15,57814,837–15,570
Table 4. Base composition, the percent of A and T, AT skew and GC skew of C. coreanus and C. songi.
Table 4. Base composition, the percent of A and T, AT skew and GC skew of C. coreanus and C. songi.
RegionC. coreanusC. songi
Length (bp)AT%AT SkewGC SkewLength (bp)AT%AT SkewGC Skew
Whole genome15,57872.1−0.018−0.19115,57071.7−0.015−0.179
Protein-coding genes688269.1−0.121−0.158688269−0.125−0.156
Ribosomal RNA genes214874−0.021−0.282214573.7−0.023−0.285
Transfer RNA93874−0.029−0.016100173.4−0.011−0.011
Table 5. Start and stop codons of the Microcoryphia mitochondrial genomes. Notes: Allopsonsu baii (A. b); Allopsonsus helanensis (A. he); Coreamachilis coreanus (C. c); Coreamachilis songi (C. s); Nesomachilis australica (N. a); Petrobius brevistylis (P. b); Petrobiellus bannaensis (P. ba); Pedetontinus luanchuanensis (P. l); Petrobiellus puerensis (P. p); Pedetontus silvestrii (P. si); Songmachilis xinxiangensis (S. x); Trigoniophthalmus alternatus (T. a).
Table 5. Start and stop codons of the Microcoryphia mitochondrial genomes. Notes: Allopsonsu baii (A. b); Allopsonsus helanensis (A. he); Coreamachilis coreanus (C. c); Coreamachilis songi (C. s); Nesomachilis australica (N. a); Petrobius brevistylis (P. b); Petrobiellus bannaensis (P. ba); Pedetontinus luanchuanensis (P. l); Petrobiellus puerensis (P. p); Pedetontus silvestrii (P. si); Songmachilis xinxiangensis (S. x); Trigoniophthalmus alternatus (T. a).
GeneStart Codon/Stop Codon
A. bA. heC. cC. sN. aP. bP. baP. lP. pP. siS. xT. a
ATP6ATA/TAAATG/TAAATT/TAAATT/TAAATA/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAA
ATP8ATT/TAAATT/TAAATT/TAAATT/TAAATA/TATT/TAAATC/TAAATT/TAAATC/TAAATT/TAAATT/TAAATT/TAA
COX1ATT/TATT/TATT/TAAATT/TAAATT/TAATG/TAAATT/TAAATT/TATT/TAAATT/TTCG/TTTG/TA
COX2ATG/TATG/TATG/TATG/TATG/TATG/TATG/TAAATG/TGTG/TAAATT/TATG/TATG/TAA
COX3ATA/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATA/TAAATG/TAATG/TAAATG/TATG/TAAATG/TAA
Cyt bATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAA
ND1ATT/TAGGTG/TAAATG/TATT/TATA/TAAATA/TATA/TAGATT/TAGATT/TAAATT/TAGATT/TAAATG/TAA
ND2ATT/TAAATC/TAATTG/TAAATG/TAAATC/TAAATT/TAAATA/TAAATG/TAAATA/TAGATT/TAAATA/TAAATG/TAA
ND3ATA/TAAATA/TAAATA/TAAATA/TAAATA/TAAATT/TAAATA/TAGATA/TAAATA/TAGATA/TAAATA/TAAATA/TAA
ND4ATG/TAAATT/TAAATG/TAAATG/TAAATT/TAAATG/TAAATG/TAAATG/TAGATG/TAGATG/TAGATG/TAGATG/TA
ND4LATG/TAAATG/TAAATG/TAAATG/TAAATT/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAAATG/TAA
ND5ATG/TAATG/TAAATG/TAAATG/TAAATA/TAGATG/TAAATT/TAGGTG/TATG/TAATG/TATG/TAAATG/TAA
ND6ATT/TAAATT/TAAATT/TAAATT/TAAATT/TAAATA/TAAATT/TAAATT/TAAATT/TAAATT/TAAATT/TAAATA/TAA
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Guan, J.-Y.; Shen, S.-Q.; Zhang, Z.-Y.; Xu, X.-D.; Storey, K.B.; Yu, D.-N.; Zhang, J.-Y. Comparative Mitogenomes of Two Coreamachilis Species (Microcoryphia: Machilidae) along with Phylogenetic Analyses of Microcoryphia. Insects 2021, 12, 795. https://doi.org/10.3390/insects12090795

AMA Style

Guan J-Y, Shen S-Q, Zhang Z-Y, Xu X-D, Storey KB, Yu D-N, Zhang J-Y. Comparative Mitogenomes of Two Coreamachilis Species (Microcoryphia: Machilidae) along with Phylogenetic Analyses of Microcoryphia. Insects. 2021; 12(9):795. https://doi.org/10.3390/insects12090795

Chicago/Turabian Style

Guan, Jia-Yin, Shi-Qi Shen, Zi-Yi Zhang, Xiao-Dong Xu, Kenneth B. Storey, Dan-Na Yu, and Jia-Yong Zhang. 2021. "Comparative Mitogenomes of Two Coreamachilis Species (Microcoryphia: Machilidae) along with Phylogenetic Analyses of Microcoryphia" Insects 12, no. 9: 795. https://doi.org/10.3390/insects12090795

APA Style

Guan, J.-Y., Shen, S.-Q., Zhang, Z.-Y., Xu, X.-D., Storey, K. B., Yu, D.-N., & Zhang, J.-Y. (2021). Comparative Mitogenomes of Two Coreamachilis Species (Microcoryphia: Machilidae) along with Phylogenetic Analyses of Microcoryphia. Insects, 12(9), 795. https://doi.org/10.3390/insects12090795

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop