Next Article in Journal
Defensive Traits during White Spruce (Picea glauca) Leaf Ontogeny
Previous Article in Journal
Effects of Age, Phase Variation and Pheromones on Male Sperm Storage in the Desert Locust, Schistocerca gregaria
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of a Set of Microsatellite Markers to Investigate Sexually Antagonistic Selection in the Invasive Ant Nylanderia fulva

by
Pierre-Andre Eyer
*,
Megan N. Moran
,
Alexander J. Blumenfeld
and
Edward L. Vargo
Department of Entomology, Texas A & M University, 2143 TAMU, College Station, TX 77843-2143, USA
*
Author to whom correspondence should be addressed.
Insects 2021, 12(7), 643; https://doi.org/10.3390/insects12070643
Submission received: 21 June 2021 / Revised: 12 July 2021 / Accepted: 13 July 2021 / Published: 15 July 2021

Abstract

:

Simple Summary

The two sexes of a species usually exhibit phenotypic differences, such as in behavior, body size or color. They, however, share most of their genomes, preventing fixation of distinct alleles for genes coding for those traits in each sex. The different optima between the sexes on these loci lead to genomic conflicts, called sexually antagonistic selection (SAS). Under SAS, distinct alleles are therefore selected in each sex. In the invasive tawny crazy ant, Nylanderia fulva, a genomic region is under SAS, while the rest of the genome is randomly selected in males and females. Here, we provide a suite of 15 polymorphic microsatellite markers located in the SAS genomic region to study the origin and evolution of SAS in N. fulva. These markers have allelic frequencies that are highly different between males and females. All males carry only a subset of the alleles present in the population, while females are reliably heterozygous, with one allele from the male gene pool and a different allele inherited from their mother. The SAS markers may be used to test for the strength and the extent of the genomic regions under SAS in both the native and introduced ranges of N. fulva. These markers may serve to answer similar questions in other introduced species of the Nylanderia genus, yielding insights into the origin and evolution of SAS within and among species of the genus Nylanderia.

Abstract

Sexually antagonistic selection (SAS) occurs when distinct alleles are differentially selected in each sex. In the invasive tawny crazy ant, Nylanderia fulva, a genomic region is under SAS, while the rest of the genome is randomly selected in males and females. In this study, we designed a suite of 15 microsatellite markers to study the origin and evolution of SAS in N. fulva. These SAS markers were polymorphic, with allelic frequencies that are highly different between males and females. All haploid males carry only a subset of the alleles present in the population, while females are reliably heterozygous, with one allele from the male gene pool and a different allele inherited from their mother. In addition, we identified six polymorphic markers not associated with SAS and six markers yielding consistent, yet monomorphic, amplification in the introduced range of this species. Reaction condition optimizations allowed all retained markers to be co-amplified in four PCR mixes. The SAS markers may be used to test for the strength and the extent of the genomic regions under SAS in both the native and introduced ranges of N. fulva, while the set of non-SAS loci may be used to assess the invasion route of this species. Overall, the application of these microsatellite markers will yield insights into the origin and evolution of SAS within and among species of the genus Nylanderia.

1. Introduction

Within a sexually reproducing species, males and females share a common optimum for most of their traits. However, they may differ in their optima for some specific traits, leading to sexually antagonistic selection (SAS) [1,2]. SAS occurs when specific alleles provide an advantage to one sex while being harmful to the other. Males and females share a common autosomal genome, which usually prevents each sex from independently fixing different alleles [3,4]. SAS was thought to be resolved through the evolution of sex chromosomes, enabling the sexes to overcome the constraint of a shared genome by allowing each sex to separately fix beneficial alleles in distinct sex chromosomes, thus preventing deleterious recombination between them [5,6].
The invasive tawny crazy ant Nylanderia fulva represents a unique case of SAS, as it occurs in a sexually reproducing haplodiploid species lacking sex chromosomes [7]. As with many Hymenopteran species, the sex of this ant species is determined by heterozygosity at the complementary sex-determining locus (CSD) [8]. Fertilized diploid eggs develop into females when heterozygous at this locus. In contrast, unfertilized haploid eggs develop into males, as they are hemizygous at this locus. Nylanderia fulva is native to South America and has been introduced in the Southern USA [9,10,11]. In the invasive population of this species, a set of alleles is differentially selected in each sex, while the rest of the genome is randomly transmitted [7]. This SAS region (i.e., differentially selected) was estimated to represent ∼3% of the genome based on scaffolds displaying significant values of outbreeding in females, indicating that daughters inherit different alleles from each parent. Twelve microsatellite markers were developed for N. fulva before SAS in this species was discovered [9]. Nine of these markers were located in randomly inherited regions, and three were located in SAS regions [7]. Microsatellite analyses at these three SAS loci revealed that daughters (workers and queens) preferentially carry alleles from their mothers, and sons preferentially carry alleles from their grandfathers (males have no fathers). Consequently, females and males exhibit strongly divergent genotypes, with females being nearly 100% heterozygous for markers located in this genomic region [7]. For two of these markers, all males carried a single allele (arbitrarily called allele A), while almost all females were heterozygous, with allele A and another allele (B or C), resulting in either A/B or A/C genotypes. Although these three microsatellite markers allow for the identification of complex DNA inheritance between the sexes, their weak polymorphism (respectively, 2, 3 and 3 alleles for L02, L06 and L07) prevents any further analyses. For example, it hampers the determination of whether a) the male gene pool consistently exhibits a single allele, or b) the allelic diversity in the male gene pool is systematically lower than the females’. Similarly, it prevents a robust assessment of whether microsatellite markers located in SAS genomic regions experience a comparable loss of allelic diversity to those located in non-SAS regions after the bottleneck event following this ant’s introduction to the USA. Overall, developing a robust set of microsatellite markers is required to properly answer these questions. Ultimately, these findings may provide insights into the strength of the selective pressures acting upon the male and female gene pools and illuminate the origin and evolution of SAS in this haplodiploid species.
Microsatellite loci are the primary marker of choice to study mating systems, such as the diversity of modes of reproduction and kinship structures observed in ants [12,13,14,15,16,17,18]. These co-dominant markers are usually highly polymorphic, randomly spread throughout the genome and considered as neutral markers [19]. However, in this study, we aimed to design microsatellite markers specifically informative to study SAS in Nylanderia fulva. For this purpose, these SAS markers are not randomly spread throughout the genome but instead located in the SAS region(s). They therefore cannot be considered neutral markers, as this genomic region is under strong SAS. Finally, although we sought to find markers with high polymorphism, we did not simply discard markers with no/low polymorphism because such markers could be informative in investigating the selective regimes faced in each sex, as well as the consequence of the bottleneck on this genomic region.
In this study, we designed a set of novel microsatellite loci for N. fulva. We tested 29 expected SAS markers located in scaffolds exhibiting significant negative values of FIS in females. As a positive control, we tested eight expected new SAS markers located in the same three scaffolds containing the previous microsatellites showing an SAS pattern (L02, L06 and L07). As a negative control, we also tested six additional expected non-SAS markers located in randomly inherited scaffolds (i.e., scaffolds showing no deviation from the Hardy–Weinberg equilibrium).

2. Materials and Methods

2.1. Microsatellite Primer Design

The software QDD v. 3.1 [20] was used to discover microsatellite repeat motifs within the draft reference genome of N. fulva (RefSeq GCF_005281655.1). We set up a threshold of at least five repetitions, excluded mononucleotide repeats and extracted the 200 bp flanking regions on both sides of the repeats for subsequent primer design. Overall, 218,352 reads containing microsatellite repeat motifs were identified among 2808 scaffolds. Based on Eyer et al. (2019) [7], we examined 16 scaffolds with highly negative values of FIS, suggesting they exhibit an SAS pattern (FIS > −0.7). We also examined six scaffolds with moderate levels of outbreeding (−0.1 < FIS < −0.7), and scaffolds containing previously identified SAS markers (L02: scaffold 156, FIS = −0.875; L06: scaffold 111, FIS = −0.488; and L07: scaffold 120, FIS = −0.9). We selected a set of 37 loci (33, 3 and 1 with di-, tri- and tetranucleotide repeats, respectively) among these scaffolds and designed the corresponding primers using the online Primer3 software (http://primer3.ut.ee, accessed on 14 July 2021) [21]. We also selected and designed primers for a set of six loci (4, 1 and 1 with di-, tri- and tetranucleotide repeats, respectively) among five randomly inherited scaffolds (scaffold 20, FIS = 0.001; scaffold 68, FIS = 0.008; scaffold 67, FIS = 0.008; scaffold 7, FIS = 0.037; and scaffold 53, FIS = 0.024). For each scaffold, we selected loci with the highest number of repeats to maximize polymorphism [22]. Primers were designed to result in a broad size range of PCR products (120 to 400 bp) in order to facilitate multiplex arrangements. Primer sequences, scaffold information, microsatellite repeat information, PCR conditions and multiplexing arrangements are presented in Table 1.

2.2. Genetic Procedures

A total of 40 individuals of N. fulva were collected in 2017 within its introduced range, including four populations in Texas, and one population each in Mississippi and Louisiana. This sampling included 20 males and 20 females, with females further split into 10 workers and 10 queens. As the invasive range of this species is made of a single vast supercolony [9], the six invasive populations sampled exhibit similar allelic frequencies. For each individual, total genomic DNA was extracted following a modified Gentra Puregene extraction method (Gentra Systems, Inc. Minneapolis, MN, USA). All 43 primer pairs were first tested in standard simplex PCR conditions. Fourteen microsatellite markers were discarded due to inconsistent or nonexistent amplification (Table 1). We further used the M13-tailed primer method to label amplicons to facilitate multiplexing [23]. The M13 tails were attached to the forward primer and 5′-fluorescently labeled with 6-FAM, VIC, PET or NED. Amplicons were amplified using a Bio-Rad thermocycler T100 (Bio-Rad, Pleasanton, CA, USA). PCR products were visualized on an ABI 3500 capillary sequencer and sized against an LIZ500 internal standard (Applied Biosystems, Foster City, CA, USA). Allele scoring was performed using Geneious v.9.1(Biomatters, Auckland, New Zealand) [24]. The 29 microsatellite markers successfully amplifying in simplex conditions were organized into four multiplex groups (A, B, C and D, made of, respectively, 8, 8, 7 and 6 markers) by maximizing the number of loci labeled with the same dye while also avoiding overlaps (Table 1, Figure 1). Although the monomorphic markers (n = 6) were conserved in the multiplex arrangement due to their potential polymorphism in the native range of N. fulva, they were discarded from further analyses in the present study.

2.3. Confirming Inheritance Patterns of SAS and Non-SAS Markers

For each marker, the number of alleles and allelic frequencies were calculated in each sex and caste, as well as for the entire dataset using GENEPOP on the web [25]. This software was also used to compare allelic frequencies between the sexes using a genic test of differentiation. The software FSTAT was used to calculate FIS, departures from the HWE and the expected (He) and observed (Ho) heterozygosities for the female sex [19]. SAS markers are expected to deviate from the HWE by showing a high level of heterozygosity in females, which results in highly negative values of FIS. Additionally, SAS markers are expected to exhibit alleles differentially selected in each sex, which should lead to differences in allelic frequencies between males and females, and ultimately distinct alleles in each sex. In contrast, non-SAS markers are not expected to deviate from the HWE (i.e., no evidence of outbreeding or inbreeding), and therefore allelic diversities and allelic frequencies are not expected to differ between the sexes in these markers.

3. Results and Discussion

All 29 selected microsatellite markers amplified well and yielded clear and readable products. Twenty-three of them displayed polymorphism, ranging from 3 to 12 alleles per marker (Table 2). They are therefore informative for genetic studies of the tawny crazy ant Nylanderia fulva. Since all individuals analyzed in this study originate from the US introduced range, these markers are likely to exhibit higher polymorphism in the native range of this species. A similar outcome can be expected for the six markers found to be monomorphic in this study (Table 1).
Fifteen microsatellite markers exhibited a clear deviation from the HWE, with more observed heterozygotes than expected after Bonferroni correction (all p < 0.01) (Table 2). Of these markers, 14 exhibited a level of heterozygosity of at least 0.95 (the last one being 0.85; twelve markers were completely heterozygous). Consequently, the FIS inbreeding coefficient was highly negative in females for these 15 markers (FIS ± = −0.54 ± 0.16, from −0.23 to −0.71). The allelic frequencies for these markers were also highly different between males and females (all p < 0.001). All males consistently carry only a subset of the alleles present in the population (one to three alleles), while females are reliably heterozygous, with one paternal allele and a different allele inherited from their mother (Table 2, Figure 2 and Figure 3). Consequently, allelic frequencies in females never exceed 0.5 (they reach 0.5 when the male gene pool contains a single allele). Of these 15 markers, 7 and 4 markers were located in scaffolds with high and moderate levels of outbreeding, respectively, and 4 markers were located in scaffolds containing identified SAS markers. Overall, these results suggest that these 15 microsatellite markers denote a pattern of SAS in the introduced range of N. fulva, with allele numbers for females ranging from three to six (mean ± SD = 4.2 ± 1.22), while allele numbers for males only range from one to three (mean ± SD = 1.66 ± 0.79).
In comparison, six microsatellite markers did not exhibit a deviation from the HWE. In females, these loci displayed similar values of the observed (0.55–0.80) and expected (0.60–0.85) heterozygosity (Figure 3), resulting in a slightly positive inbreeding coefficient (FIS ± SD = 0.13 ± 0.08; from 0.06 to 0.27). Allele numbers ranged from 3 to 12 at these six loci for the combined male/female dataset (mean ± SD = 8.5 ± 2.75; Table 2), and allelic frequencies were not different between males and females for three out of the six markers (p > 0.05). However, for the other three markers, the allelic frequencies were different (p < 0.05), most likely stemming from non-sampled alleles among the limited number of samples of each sex (n = 20) in regard to the higher number of alleles for these markers (8, 10 and 12). Of these six markers, two were located in one scaffold with moderate levels of outbreeding, and four were located in scaffolds with FIS inbreeding coefficients close to zero. Overall, these results suggest that these six microsatellite markers are representative of a genomic region within N. fulva not under SAS.
Two microsatellite markers showed ambiguous results that prevent us from clearly labeling them as SAS or non-SAS markers. They exhibited low levels of observed heterozygosity in females (0.25 and 0.31) and did not deviate from the HWE. However, allelic frequencies were different between males and females (p < 0.05), but FIS was low to moderate (FIS = 0.07 and 0.277).

4. Conclusions

Overall, we designed a final suite of 29 microsatellite loci yielding consistent amplification for studying SAS in the invasive tawny crazy ant Nylanderia fulva. This includes a set of 15 new SAS markers that may be used to study the origin and evolution of SAS in this species. Notably, these markers can be used to decipher whether native populations of N. fulva also exhibit genomic regions under SAS, or whether SAS is restricted to the source population that invaded the Southeastern US. Interestingly, different SAS markers show different values of FIS, with some SAS markers being completely heterozygous in the female castes, while other SAS markers contained a few homozygous females. This result may suggest that, even in the introduced range, the strength of selection is variable across different SAS genomic regions, potentially allowing local recombination events. Similarly, these SAS markers may be used to test for the strength and the extent of the genomic regions under SAS in the native range of N. fulva (i.e., whether all 15 markers exhibit a pattern of SAS or only some of them, and whether their levels of heterozygosity are always 100% or lower). This may identify specific genomic regions under different levels of SAS [26,27,28,29,30,31] and provide insights into the strength of sexual antagonism in haplodiploids [32,33,34]. Although we are awaiting confirmation with a larger sampling size, the number of alleles observed in this study seems greater in the non-SAS loci than the SAS loci, which may denote a strong selective pressure associated with SAS. The set of non-SAS microsatellite loci may also be used in conjunction with previously developed markers to assess the genetic diversity, population structure and phylogeography at local and global scales throughout the native and introduced ranges of this species. These findings may provide valuable information regarding the introduction route of N. fulva out of South America, inferring the source population(s) and the extent of the bottleneck the invasive US populations have experienced.
The sets of markers developed in this study may also be used for genetic analyses on other species of Nylanderia, including the other invasive members of this genus [35]. The genus Nylanderia is among the most invasive of all ant genera, with 15 globetrotting species encountered beyond their native ranges [36,37]. Therefore, non-SAS loci may be of use for classical genetic analyses, such as population structure and breeding system analyses for these species. As in N. fulva, these markers may also serve to infer the invasion routes of the different introduced species, as well as the series of demographic changes they experienced. Additionally, the SAS loci may be used to investigate if SAS is widespread across this genus, or if it is confined to N. fulva. Overall, the application of these microsatellite markers will provide valuable tools for increasing our understanding about the origin and evolution of SAS within and among species of the genus Nylanderia.

Author Contributions

Conceptualization, P.A.E.; data curation, P.A.E., M.N.M. and A.J.B.; formal analysis, P.A.E., M.N.M. and A.J.B.; funding acquisition, E.L.V.; investigation, P.A.E., M.N.M. and A.J.B.; methodology, P.A.E.; project administration, E.L.V.; supervision, P.A.E. and E.L.V.; validation, P.A.E.; visualization, P.A.E.; writing—original draft, P.A.E., A.J.B. and E.L.V. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Texas A & M University Endowment in Urban Entomology.

Data Availability Statement

The data supporting the reported results have been deposited in the Open Science Framework data repository at doi:10.17605/OSF.IO/GH7KS.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Connallon, T.; Clark, A. Evolutionary inevitability of sexual antagonism. Proc. R. Soc. B Biol. Sci. 2014, 281, 20132123. [Google Scholar] [CrossRef]
  2. Bonduriansky, R.; Chenoweth, S. Intralocus sexual conflict. Trends Ecol. Evol. 2009, 24, 280–288. [Google Scholar] [CrossRef]
  3. Pennell, T.M.; Morrow, E.H. Two sexes, one genome: The evolutionary dynamics of intralocus sexual conflict. Ecol. Evol. 2013, 3, 1819–1834. [Google Scholar] [CrossRef]
  4. Griffin, R.M.; Dean, R.; Grace, J.L.; Rydén, P.; Friberg, U. The Shared Genome Is a Pervasive Constraint on the Evolution of Sex-Biased Gene Expression. Mol. Biol. Evol. 2013, 30, 2168–2176. [Google Scholar] [CrossRef] [Green Version]
  5. Rice, W.R. Sex chromosomes and the evolution of sexual dimorphism. Evolution 1984, 38, 735–742. [Google Scholar] [CrossRef] [PubMed]
  6. Charlesworth, B. The evolution of sex chromosomes. Science 1991, 251, 1030–1033. [Google Scholar] [CrossRef] [PubMed]
  7. Eyer, P.-A.; Blumenfeld, A.J.; Vargo, E.L. Sexually antagonistic selection promotes genetic divergence between males and females in an ant. Proc. Natl. Acad. Sci. USA 2019, 116, 24157–24163. [Google Scholar] [CrossRef] [PubMed]
  8. Cook, J.; Crozier, R.H. Sex determination and population biology in the hymenoptera. Trends Ecol. Evol. 1995, 10, 281–286. [Google Scholar] [CrossRef]
  9. Eyer, P.-A.; McDowell, B.; Johnson, L.N.L.; Calcaterra, L.A.; Fernandez, M.B.; Shoemaker, D.; Puckett, R.T.; Vargo, E.L. Supercolonial structure of invasive populations of the tawny crazy ant Nylanderia fulva in the US. BMC Evol. Biol. 2018, 18, 209. [Google Scholar] [CrossRef]
  10. Gotzek, D.; Brady, S.G.; Kallal, R.J.; Lapolla, J.S. The Importance of Using Multiple Approaches for Identifying Emerging Invasive Species: The Case of the Rasberry Crazy Ant in the United States. PLoS ONE 2012, 7, e45314. [Google Scholar] [CrossRef] [Green Version]
  11. Wang, Z.; Moshman, L.; Kraus, E.; Wilson, B.E.; Acharya, N.; Diaz, R. A Review of the Tawny Crazy Ant, Nylanderia fulva, an Emergent Ant Invader in the Southern United States: Is Biological Control a Feasible Management Option? Insects 2016, 7, 77. [Google Scholar] [CrossRef]
  12. Butler, I.A.; Siletti, K.; Oxley, P.R.; Kronauer, D.J.C. Conserved Microsatellites in Ants Enable Population Genetic and Colony Pedigree Studies across a Wide Range of Species. PLoS ONE 2014, 9, e107334. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Pamilo, P.; Gertsch, P.; Thorén, P.; Seppä, P. Molecular Population Genetics of Social Insects. Annu. Rev. Ecol. Syst. 1997, 28, 1–25. [Google Scholar] [CrossRef]
  14. Eyer, P.A.; Hefetz, A. Cytonuclear incongruences hamper species delimitation in the socially polymorphic desert ants of the Cataglyphis albicans group in Israel. J. Evol. Biol. 2018, 12, 1828–1842. [Google Scholar] [CrossRef]
  15. Eyer, P.A.; Vargo, E.L.; Peeters, C. One tree, many colonies: Colony structure, breeding system and colonization events of host trees in tunnelling Melissotarsus ants. Biol. J. Linn. Soc. 2021, 133, 237–248. [Google Scholar] [CrossRef]
  16. Schultner, E.; Saramäki, J.; Helanterä, H. Genetic structure of native ant supercolonies varies in space and time. Mol. Ecol. 2016, 25, 6196–6213. [Google Scholar] [CrossRef]
  17. Jacobs, S.; Heinze, J. Population and colony structure of an ant with territorial males, Cardiocondyla venustula. BMC Evol. Biol. 2019, 19, 115. [Google Scholar] [CrossRef]
  18. Lemos, A.S.M.; Azevedo-Silva, M.; Gonçalves-Neto, S.; Souza, A.P.; Oliveira, P.S. Microsatellites for the Neotropical Ant, Odontomachus chelifer (Hymenoptera: Formicidae). J. Insect Sci. 2020, 20, 117. [Google Scholar] [CrossRef]
  19. Goudet, J. FSTAT (Version 1.2): A Computer Program to Calculate F-Statistics. J. Hered. 1995, 86, 485–486. [Google Scholar] [CrossRef]
  20. Meglécz, E.; Pech, N.; Gilles, A.; Dubut, V.; Hingamp, P.; Trilles, A.; Grenier, R.; Martin, J.F. QDD version 3.1: A user-friendly computer program for microsatellite selection and primer design revisited: Ex-perimental validation of variables determining genotyping success rate. Mol. Ecol. Resour. 2014, 14, 1302–1313. [Google Scholar] [CrossRef]
  21. Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Brandström, M.; Ellegren, H. Genome-wide analysis of microsatellite polymorphism in chicken circumventing the ascer-tainment bias. BioTechniques 2001, 28, 6–24. [Google Scholar]
  23. Boutin-Ganache, I.; Raposo, M.; Raymond, M.; Deschepper, C. M13-Tailed Primers Improve the Readability and Usability of Microsatellite Analyses Performed with Two Different Allele-Sizing Methods. Biotechniques 2001, 31, 25–28. [Google Scholar] [CrossRef] [Green Version]
  24. Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef] [PubMed]
  25. Rousset, F. genepop’007: A complete re-implementation of the genepop software for Windows and Linux. Mol. Ecol. Resour. 2008, 8, 103–106. [Google Scholar] [CrossRef] [PubMed]
  26. Mank, J.E. Population genetics of sexual conflict in the genomic era. Nat. Rev. Genet. 2017, 18, 721–730. [Google Scholar] [CrossRef] [PubMed]
  27. Rowe, L.; Chenoweth, S.; Agrawal, A.F. The Genomics of Sexual Conflict. Am. Nat. 2018, 192, 274–286. [Google Scholar] [CrossRef] [PubMed]
  28. Connallon, T.; Matthews, G. Cross-sex genetic correlations for fitness and fitness components: Connecting theoretical pre-dictions to empirical patterns. Evol. Lett. 2019, 3, 254–262. [Google Scholar] [CrossRef]
  29. Frank, S.A.; Patten, M.M. Sexual antagonism leads to a mosaic of X-autosome conflict. Evolution 2019, 74, 495–498. [Google Scholar] [CrossRef]
  30. Hitchcock, T.J.; Gardner, A. A gene’s-eye view of sexual antagonism. Proc. R. Soc. B Biol. Sci. 2020, 287, 20201633. [Google Scholar] [CrossRef]
  31. Kasimatis, K.R.; Ralph, P.L.; Phillips, P.C. Limits to Genomic Divergence Under Sexually Antagonistic Selection. G3 Genes Genomes Genet. 2019, 9, 3813–3824. [Google Scholar] [CrossRef] [Green Version]
  32. De la Filia, A.G.; Bain, S.; Ross, L. Haplodiploidy and the reproductive ecology of Arthropods. Curr. Opin. Insect Sci. 2015, 9, 36–43. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Kraaijeveld, K. Male genes with nowhere to hide; sexual conflict in haplodiploids. Anim. Biol. 2009, 59, 403–415. [Google Scholar] [CrossRef]
  34. Patten, M.M. The X chromosome favors males under sexually antagonistic selection. Evolution 2019, 73, 84–91. [Google Scholar] [CrossRef] [Green Version]
  35. LaPolla, J.S.; Brady, S.G.; Shattuck, S.O. Phylogeny and taxonomy of the Prenolepis genus-group of ants (Hyme-noptera: Formicidae). Syst. Entomol. 2010, 35, 118–131. [Google Scholar] [CrossRef]
  36. Williams, J.L.; Zhang, Y.M.; Lloyd, M.W.; LaPolla, J.S.; Schultz, T.R.; Lucky, A. Global domination by crazy ants: Phylogenomics reveals biogeographical history and invasive species relationships in the genus Nylanderia (Hymenoptera: Formicidae). Syst. Èntomol. 2020, 45, 730–744. [Google Scholar] [CrossRef]
  37. Williams, J.L.; Lucky, A. Non-native and Invasive Nylanderia Crazy Ants (Hymenoptera: Formicidae) of the World: Integrating Genomics to Enhance Taxonomic Preparedness. Ann. Èntomol. Soc. Am. 2020, 113, 318–336. [Google Scholar] [CrossRef]
Figure 1. Multiplex arrangement of the four PCR mixes allowing for co-amplification of the 29 microsatellite markers amplifying in this study.
Figure 1. Multiplex arrangement of the four PCR mixes allowing for co-amplification of the 29 microsatellite markers amplifying in this study.
Insects 12 00643 g001
Figure 2. Allelic frequency in the female (dark blue) and male (light blue) gene pools for each polymorphic marker. Dashed lines indicate co-occurring alleles in heterozygous females, while solid lines indicate alleles found in homozygous females. The numbers above the lines indicate the numbers of heterozygous/homozygous individuals. Males are haploid and therefore always hemizygous.
Figure 2. Allelic frequency in the female (dark blue) and male (light blue) gene pools for each polymorphic marker. Dashed lines indicate co-occurring alleles in heterozygous females, while solid lines indicate alleles found in homozygous females. The numbers above the lines indicate the numbers of heterozygous/homozygous individuals. Males are haploid and therefore always hemizygous.
Insects 12 00643 g002
Figure 3. Level of heterozygosity observed in females for each polymorphic marker. Arrows indicate the level of expected heterozygosity.
Figure 3. Level of heterozygosity observed in females for each polymorphic marker. Arrows indicate the level of expected heterozygosity.
Insects 12 00643 g003
Table 1. Primer sequences, scaffold information, microsatellite repeat information, PCR conditions and multiplexing arrangements for each microsatellite marker tested.
Table 1. Primer sequences, scaffold information, microsatellite repeat information, PCR conditions and multiplexing arrangements for each microsatellite marker tested.
Marker NameScaffoldFIS ScaffoldScaffold FIS Value MS Motif# of RepeatsLeftRightTMProduct SizePeak Reading *ColorMultiplex
Nf172aS_172High −0.900CT33TACAGCCGCGTTGTTTTCACGGCAACATATCAAGAACCCTGT57172/213 PETA
Nf172bS_172High −0.900TC27TTAATGAGGGGCCCGTTGATGCATGTATGAAAGAGCAGCGA57210/250 FAMA
Nf137S_137High −0.900TA24ACGTGTGTTGTGTGTGTGTGTGGTGCTTTTAATACAGTGGCT57370monomorphicFAMB
Nf1028S_1028High −0.900TA18GCAATGCCACTCAAGGTCAAGCTCTGTTGGCCGATTTAAAA57249monomorphicFAMC
Nf699S_699High −0.900TA27AGTCAATTAAAACGAGTCCTGGATGTGTGAAAATACGTGTGTCTAC57162monomorphicVICC
Nf652S_652High −0.900TCT17CGGAGATACAAGCGGTCAAAAGGGAGGTGTGAGTGAAAGG /no amplification
Nf1198S_1198High −0.878CATA12GAGACCACATACACCAAAAGGTGCAGAAAATTAGTTGCGCGA57343/371 NEDA
Nf191S_191High −0.742AT24TGCGCGTTAATATCTCAAACTCTTGGATGAAATGAGAGATGTGGG57191/229 VICA
Nf248S_248High −0.764AG28CTATGCACGCTCCTCACTCTACCGAGACCTTGTACACACT 295monomorphicNEDC
Nf401aS_401High −0.667TA21ACGTGTGCATGTTGAGAGAGTGCCCCTTTCGAAACGTAGA57[315]inconsistent
Nf401bS_401High −0.667TA21CATACCTGCAGCATCCCCTATAAGATGCATGCACACACGC57[222]inconsistent
Nf170aS_170High −0.609GAC52CCACAGATCTCGTTCCGTCTTGAAGGTGCTGAGGAGGATG /no amplification
Nf170bS_170High −0.609AT24CGAGTGTCTTTATTTCGCGCGTCCCAGAAATGAACACCGC60172monomorphicNEDD
Nf294S_294High −0.900AT26GTTTGACGACATTTCTCTGTTCACGCAAGTGTAAACGCAATCT57260/284 NEDD
Nf502S_502High −0.900TC30GGTGGATGAGGGAGTTGGAATACCTTCCGCACATAACCCA [336/367]inconsistent
Nf174aS_174High −0.889TC63CCCGCTTCGAACATGACAATTCATGGAATATCGCATTGTCGT /no amplification
Nf174bS_174High −0.889TA30AGCTAACTGACTGACTGCGTCGATATTCTGCTCGTCGTCAC57323/368 VICC
Nf287S_287High −0.900AG30CGAATTTTATGCTCGCCGGAGATTTGATTCCAGAGCGCGA57162/186 PETD
Nf277S_277High −0.900CT34GCGAGAGAGACGGTATCACAGAATTCGATGTACACCGGGT57188monomorphicVICB
Nf167aS_167High −0.629TA39AGCAGAGAGAAAGAAATGAGAGTTTGTTAGGGATAGATCGGAGGA /no amplification
Nf167bS_167High −0.629TC28GGGGCTAACTTCATACAGGCACCTTCTGCGAATGGTAGCT57[281]inconsistent
Nf107S_107Mod. −0.125AG31ACAAGTCACTTCCGCTGAAACCGCAAGGATCAGGTACCGAT60350/374 NEDC
Nf261aS_261Mod. −0.178CT32ATGCTCTTTGTCACGAGGGACGAGAGAAAGGGAAGGGTGA60279/295 FAMD
Nf261bS_261Mod. −0.178TCG21CATACTATCTGGGCGGGTGTCACTGAGAAGATCGCGAGTG57195/220 VICD
Nf66aS_66Mod. −0.439TA32AAACTACGCTCGCAATGCAAATGAGAGGGTGTGGAAGAGC57331/377 FAMC
Nf66bS_66Mod. −0.439TA31GTGCTCCACTCCAATAATGCTTGGTCAGGAGTCACGGTAAA55359/408 PETC
Nf127S_127Mod. −0.335AG31GCGGCTCGTTAGTGATTCTCGAGACTCCATTTTGACGGCG57135/178 PETC
Nf123S_123Mod. −0.279AG28TGAAAATGTACGCGCGACTTCCAGCCTTTCAGTGATTCGA57373/387 FAMD
Nf57S_57Mod. −0.540TA31GTGTGGAGGAGCAATTTGGGAATAACGCACTGTCATCCGC57[208]inconsistent
Nf120aS_120SAS−0.900GA28AGAAGCCGCCATCAAGAAGAGGGAAGATGAGCGCGATCA60223/230 PETB
Nf120bS_120SAS−0.900TC26GCCTCTTTATTCGCGGAAGGAGATTTTACAGCTACGCCGC57392/407 VICB
Nf120cS_120SAS−0.900AC24AGATTGACATTTTCCGCTCTTCACCCCATTTGTTCGCTCGTAG57309/340 PETB
Nf111aS_111SAS−0.488GA32GGACAAGTTGGAACGGGATGAACAGAGGAGAACGCGGTAA57[308]inconsistent
Nf111bS_111SAS−0.488CA25GCGTGGATGCTCTTTTCACAGAAAGTATCTTCTTGCGTgcg57131/156 FAMB
Nf111cS_111SAS−0.488TC24CACGCTAAACTGTCATCCGACGTGTTGAAGGGAGGGAAGA62[162/170]inconsistent
Nf156aS_156SAS−0.875AT43ACACACTGTACTACTGCGGTGCGAAATGAGAACGGTAGGT55280/341 NEDB
Nf156bS_156SAS−0.875TA23CGTAACCTTCGAAATGGCTGTGTTGCAGAGATCCGAACGAT /no amplification
Nf20S_20Low 0.000AG73ACTCCTAACTGCTGCCTAATTTGCACGAATTTACAATTGCGCA /no amplification
Nf68S_68Low 0.007GA32TACCCACGCATAATCCACCCCCTCCTTGTTTGTAACGGAAGA57259/286 PETA
Nf67S_67Low 0.008TC36AAATCCCTGTTTTAAACTGCTGTAGAACGTTCGAGTGTAGATAGGT57244/295 VICA
Nf7aS_7Low 0.038CAT36ACGTGGTTGTTGGTGCATACAGCAAGAGAGAGACCGATGT55164/276 NEDA
Nf7bS_7Low 0.038GGTA21TTAGTGGTGCAAAAGGGAAGAGTTGTGGTGGCAAAGGGTG60169/177 FAMA
Nf53S_53Low 0.024TA33CCTTGCATCATGTGTGGACCTCACACGAGGAGACAAGAGG /no amplification
* Inconsistent peak reading mostly denotes markers with high stutter and similar sizes of alleles, therefore hampering a confident reading of the distinct alleles (especially at heterozygous state).
Table 2. Number of alleles for each sex and caste, level of observed and expected heterozygosity and FIS for each polymorphic microsatellite marker. We also indicate whether or not each marker follows a pattern of SAS.
Table 2. Number of alleles for each sex and caste, level of observed and expected heterozygosity and FIS for each polymorphic microsatellite marker. We also indicate whether or not each marker follows a pattern of SAS.
Marker NameNumber of AllelesHeterozygosityHW Sign.FIS M-F Diff.Genomic Region
OverallWorkersQueensMalesObs.Exp.
Nf172a33311.000.59***−0.712***SAS
Nf172b55531.000.78**−0.293***SAS
Nf119866621.000.82**−0.232***SAS
Nf19154411.000.68***−0.489***SAS
Nf29433311.000.61***−0.670***SAS
Nf174b54330.950.64***−0.493***SAS
Nf28763431.000.62***−0.642***SAS
Nf120a33311.000.59***−0.712***SAS
Nf120b44311.000.63***−0.603***SAS
Nf120c33311.000.61***−0.670***SAS
Nf156a65621.000.80**−0.263***SAS
Nf261a33311.000.61***−0.670***SAS
Nf261b33311.000.61***−0.670***SAS
Nf12733320.950.61**−0.570***SAS
Nf12354320.850.61**−0.407***SAS
Nf66a127960.800.85NS0.063***non-SAS
Nf66b87760.680.86NS0.211*non-SAS
Nf6896890.800.85NS0.060NSnon-SAS
Nf67106560.550.75NS0.273***non-SAS
Nf7a97750.750.83NS0.104NSnon-SAS
Nf7b33330.550.60NS0.085NSnon-SAS
Nf111b33210.250.27NS0.069*unclear
Nf10733320.320.43NS0.278*unclear
* p < 0.05, ** p < 0.01, and *** p < 0.001.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Eyer, P.-A.; Moran, M.N.; Blumenfeld, A.J.; Vargo, E.L. Development of a Set of Microsatellite Markers to Investigate Sexually Antagonistic Selection in the Invasive Ant Nylanderia fulva. Insects 2021, 12, 643. https://doi.org/10.3390/insects12070643

AMA Style

Eyer P-A, Moran MN, Blumenfeld AJ, Vargo EL. Development of a Set of Microsatellite Markers to Investigate Sexually Antagonistic Selection in the Invasive Ant Nylanderia fulva. Insects. 2021; 12(7):643. https://doi.org/10.3390/insects12070643

Chicago/Turabian Style

Eyer, Pierre-Andre, Megan N. Moran, Alexander J. Blumenfeld, and Edward L. Vargo. 2021. "Development of a Set of Microsatellite Markers to Investigate Sexually Antagonistic Selection in the Invasive Ant Nylanderia fulva" Insects 12, no. 7: 643. https://doi.org/10.3390/insects12070643

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop