Molecular Characteristics of Fat Body Protein 1 in the Oriental Fruit Fly, Bactrocera dorsalis
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insects
2.2. cDNA Cloning of fbp1 through Rapid Amplification of cDNA Ends and Sequence Analyses
2.3. Identification of the fbp1 from the Melon Fly, Zeugodacus Cucurbitae
2.4. Phylogenetic Analysis
2.5. Real-Time Quantitative PCR (qPCR)
2.6. RNA Interference
3. Results
3.1. cDNA Cloning and Sequence Analyses
3.2. Expression Profiles of Bdfbp1
3.3. Functional Studies of Bdfbp1
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Wei, D.; He, W.; Lang, N.; Miao, Z.; Xiao, L.; Dou, W.; Wang, J. Recent research status of Bactrocera dorsalis: Insights from resistance mechanisms and population structure. Arch. Insect Biochem. Physiol. 2019, 102, e21601. [Google Scholar] [CrossRef] [PubMed]
- Vargas, R.I.; Walsh, W.A.; Kanehisa, D.; Stark, J.D.; Nishida, T. Comparative demography of three Hawaiian fruit flies (Dip-tera: Tephritidae) at alternating temperatures. Ann. Entomol. Soc. Am. 2000, 93, 75–81. [Google Scholar] [CrossRef]
- Hsu, J.-C.; Feng, H.-T.; Wu, W.-J. Resistance and synergistic effects of insecticides in Bactrocera dorsalis (Diptera: Tephritidae) in Taiwan. J. Econ. Èntomol. 2004, 97, 1682–1688. [Google Scholar] [CrossRef] [PubMed]
- Jin, T.; Zeng, L.; Lin, Y.; Lu, Y.; Liang, G. Insecticide resistance of the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), in mainland China. Pest Manag. Sci. 2011, 67, 370–376. [Google Scholar] [CrossRef]
- Khan, H.A.A.; Akram, W. Trichlorfon and spinosad resistance susrvey and preliminary determination of the resistance mechanism in Pakistani field strains of Bactrocera dorsalis. Sci. Rep. 2018, 8, 11223. [Google Scholar] [CrossRef] [Green Version]
- Zuo, Y.-H.; Lu, K.-H.; Chen, M.-E. Characteristics and gene expression of fat body in adult oriental fruit fly, Bactrocera dorsalis. Formos. Entomol. 2013, 33, 91–106. [Google Scholar]
- Maschat, F.; Dubertret, M.-L.; The’rond, P.; Claverie, J.-M.; Lepesant, J.-A. Structure of the ecdysone-inducible P1 gene of Drosophila melanogaster. J. Mol. Biol. 1990, 214, 350–372. [Google Scholar] [CrossRef]
- Lapie, P.; Nasr, F.; Lepesant, J.-A.; Deutsch, J. Deletion scanning of the regulatory sequences of the Fbp1 gene of Drosophila melanogaster using P transposase-induced deficiencies. Genetics 1993, 155, 801–816. [Google Scholar] [CrossRef]
- Burmester, T.; Antoniewski, C.; Lepesant, J.-A. Ecdysone-regulation of synthesis and processing of fat body protein 1, the larval serum protein receptor of Drosophila melanogaster. Eur. J. Biol. Inorg. Chem. 1999, 262, 49–55. [Google Scholar] [CrossRef] [Green Version]
- Roberts, D.B.; Wolfe, J.; Akam, M.E. The developmental profile of two major haemolymph proteins from Drosophila melano-gaster. J. Insect Physiol. 1977, 23, 871–878. [Google Scholar] [CrossRef]
- Telfer, W.H.; Kunkel, J.G. The function and evolution of insect storage hexamers. Annu. Rev. Entomol. 1991, 36, 205–228. [Google Scholar] [CrossRef] [PubMed]
- Tsai, M.-C.; Tsai, C.-L.; Chen, M.-E. cDNA cloning and transcriptional expression profiles of a hexamerin in the oriental fruit fly, Bactrocera dorsalis. Arch. Insect Biochem. Physiol. 2014, 86, 180–191. [Google Scholar] [CrossRef] [PubMed]
- Chiu, H.T. Studies on the improvement of mass rearing for oriental fruit flies. Plant Prot. Bull. 1978, 20, 87–92. (In Chinese) [Google Scholar]
- Nielsen, H. Predicting secretory proteins with SignalP. In Protein Function Prediction (Methods in Molecular Biology); Kihara, D., Ed.; Springer: Berlin/Heidelberg, Germany, 2017; Volume 1611, pp. 59–73. [Google Scholar]
- Lu, S.; Wang, J.; Chitsaz, F.; Derbyshire, M.K.; Geer, R.C.; Gonzales, N.R.; Gwadz, M.; Hurwitz, D.I.; Marchler, G.H.; Song, J.S.; et al. CDD/SPARCLE: The conserved domain database in 2020. Nucleic Acids Res. 2020, 48D1, 265–268. [Google Scholar] [CrossRef] [Green Version]
- Huang, X.; Miller, W. A time-efficient, linear-space local similarity algorithm. Adv. Appl. Math. 1991, 12, 337–357. [Google Scholar] [CrossRef] [Green Version]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis Version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
- Shen, G.-M.; Jiang, H.-B.; Wang, X.-N.; Wang, J.-J. Evaluation of endogenous references for gene expression profiling in different tissues of the oriental fruit fly Bactrocera dorsalis (Diptera: Tephritidae). BMC Mol. Biol. 2010, 11, 76. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shewry, P.; Halford, N.; Tatham, A. High molecular weight subunits of wheat glutenin. J. Cereal Chem. 1992, 15, 105–120. [Google Scholar] [CrossRef]
- Burmester, T.; Scheller, K. Complete cDNA-sequence of the receptor responsible for arylphorin uptake by the larval fat body of the blowfly, Calliphora vicina. Insect Biochem. Mol. Biol. 1995, 25, 981–989. [Google Scholar] [CrossRef]
- Chung, S.O.; Kubo, T.; Natori, S. Molecular cloning and sequencing of arylphorin-binding protein in protein granules of the sarcophaga fat body. J. Biol. Chem. 1995, 270, 4624–4631. [Google Scholar] [CrossRef] [Green Version]
- Kunte, N.; McGraw, E.; Bell, S.; Held, D.; Avila, L. Prospects, challenges and current status of RNAi through insect feeding. Pest Manag. Sci. 2019, 76, 26–41. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.-J.; Xu, K.-K.; Cong, L.; Wang, J.-J. Identification, mRNA expression, and functional analysis of chitin synthase 1 gene and its two alternative splicing variants in oriental fruit fly, Bactrocera dorsalis. Int. J. Biol. Sci. 2013, 9, 331–342. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Burmester, T.; Scheller, K. Ligands and receptors: Common theme in insect storage protein transport. Naturwissenschaften 1999, 86, 468–474. [Google Scholar] [CrossRef]
- Martins, J.R.; Nunes, F.M.F.; Simões, Z.L.P.; Bitondi, M.M.G. A honeybee storage protein gene, hex 70a, expressed in developing gonads and nutritionally regulated in adult fat body. J. Insect Physiol. 2008, 54, 867–877. [Google Scholar] [CrossRef] [PubMed]
- Xie, W.; Luan, Y.-X. Evolutionary implications of dipluran hexamerins. Insect Biochem. Mol. Biol. 2014, 46, 17–24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, J.B.; Park, K.-E.; Lee, S.A.; Jang, S.H.; Eo, H.J.; Jang, H.A.; Kim, C.-H.; Ohbayashi, T.; Matsuura, Y.; Kikuchi, Y.; et al. Gut symbiotic bacteria stimulate insect growth and egg production by modulating hexamerin and vitellogenin gene expression. Dev. Comp. Immunol. 2017, 69, 12–22. [Google Scholar] [CrossRef] [PubMed]
- Bai, P.-P.; Xie, Y.-F.; Shen, G.-M.; Wei, D.-D.; Wang, J.-J. Phenoloxidase and its zymogen are required for the larval–pupal transition in Bactrocera dorsalis (Diptera: Tephritidae). J. Insect Physiol. 2014, 71, 137–146. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.-J.; Wu, Y.-B.; Chen, L.; Xu, K.-K.; Xie, Y.-F.; Wang, J.-J. Two chitin biosynthesis pathway genes in Bactrocera dorsalis (Diptera: Tephritidae): Molecular characteristics, expression patterns, and roles in larval–pupal transition. J. Econ. Èntomol. 2015, 108, 2433–2442. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.-B.; Yang, W.-J.; Xie, Y.-F.; Xu, K.-K.; Tian, Y.; Yuan, G.-R.; Wang, J.-J. Molecular characterization and functional analysis of BdFoxO gene in the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae). Gene 2016, 578, 219–224. [Google Scholar] [CrossRef]
- Li, Y.-L.; Hou, M.-Z.; Shen, G.-M.; Lu, X.-P.; Wang, Z.; Jia, F.-X.; Wang, J.-J.; Dou, W. Functional analysis of five trypsin-like protease genes in the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae). Pestic. Biochem. Physiol. 2017, 136, 52–57. [Google Scholar] [CrossRef] [PubMed]
3′ RACE Primer | Sequence of Primer | Tm |
---|---|---|
BdAr 640-01 | GGTCACCTATACTGAGGTTGTGGACGTG | 60 °C |
BdAr 640-03 | GAACGCCAACAATCTGCAACAACTTGGC | 60 °C |
5′ RACE Primer | Sequence of Primer | Tm |
BdAr 640-02 | GACTTCCCTGTTGTATCCATTGAATTGGCG | 58 °C |
BdAr 640-06 | GCTCAGTTGACTGCTGGTGTATGGTTGC | 60 °C |
BdArR5’-08 | GCCAGCTCACGATATTGTTCGGCATTG | 58 °C |
BdArR5’-10 | GCGGTCCATAGGGGAGTACACGATAG | 60 °C |
BdArR5’-12 | GAGATCCCTGATTCTGTTGACGCCCATAG | 58 °C |
BdArR5’-14 | GTCCCTGTTTCTGTTGACGCCCGTAG | 60 °C |
Gene. | Forward Primer | Reverse Primer | Tm |
---|---|---|---|
fbp1 | CGTGGCTCTGCTAATGGAGGTTTGC | GTCTACACCGACAGCAGCGATTCC | 65 °C |
gapdh | GATGACCACTGTACATGCAACCACTG | GGTCAGCTTGCCGTTCAATTCAGG | 62 °C |
18s | CTTAGTTCGTGGAGTGATTTGTCTG | CCAACAGGTACGACTCCACTTATATAAAC | 60 °C |
Primer Name | Sequence of Primer |
---|---|
BdArR-dsRNA-05 | TAATACGACTCACTATAGGGAGATGACGTAGTGGTGATTGGTCGTG |
BdArR-dsRNA-06 | TAATACGACTCACTATAGGGAGATCCACGTCCACAACCTCAGTATAGG |
BdArR-dsRNA-07 | TAATACGACTCACTATAGGGATTGTTGTGCCGGTAGAAGG |
BdArR-dsRNA-08 | TAATACGACTCACTATAGGGGTTGACGCCCGTAGGAATAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, Y.-C.; Lu, H.; Chiang, Y.-C.; Tsai, C.-L.; Zuo, Y.-H.; Chen, M.-E. Molecular Characteristics of Fat Body Protein 1 in the Oriental Fruit Fly, Bactrocera dorsalis. Insects 2021, 12, 319. https://doi.org/10.3390/insects12040319
Yu Y-C, Lu H, Chiang Y-C, Tsai C-L, Zuo Y-H, Chen M-E. Molecular Characteristics of Fat Body Protein 1 in the Oriental Fruit Fly, Bactrocera dorsalis. Insects. 2021; 12(4):319. https://doi.org/10.3390/insects12040319
Chicago/Turabian StyleYu, Yao-Chih, Hsuan Lu, Yi-Cheng Chiang, Cheng-Lung Tsai, Yu-Han Zuo, and Mei-Er Chen. 2021. "Molecular Characteristics of Fat Body Protein 1 in the Oriental Fruit Fly, Bactrocera dorsalis" Insects 12, no. 4: 319. https://doi.org/10.3390/insects12040319