Next Article in Journal
A Fine-Scale Hotspot at the Edge: Epigean Arthropods from the Atacama Coast (Paposo-Taltal, Antofagasta Region, Chile)
Next Article in Special Issue
Bumble Bee Foraged Pollen Analyses in Spring Time in Southern Estonia Shows Abundant Food Sources
Previous Article in Journal
Molecular and Functional Characterization of Pyrokinin-Like Peptides in the Western Tarnished Plant Bug Lygus hesperus (Hemiptera: Miridae)
Previous Article in Special Issue
A Multi-Scale Model of Disease Transfer in Honey Bee Colonies
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 12
Issue 10
10.3390/insects12100915
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Agaricus bisporus Mushroom Extract on Honey Bees Infected with Nosema ceranae

by
Uros Glavinic
1,*,
Milan Rajkovic
1,
Jovana Vunduk
2,3,
Branislav Vejnovic
1,
Jevrosima Stevanovic
1,
Ivanka Milenkovic
3 and
Zoran Stanimirovic
1
1
Faculty of Veterinary Medicine, University of Belgrade, Bulevar Oslobodjenja 18, 11000 Belgrade, Serbia
2
Faculty of Agriculture, Institute for Food Technology and Biochemistry, University of Belgrade, Nemanjina 6, 11080 Belgrade, Serbia
3
Ekofungi Ltd., Padinska Skela bb, 11000 Belgrade, Serbia
*
Author to whom correspondence should be addressed.
Insects 2021, 12(10), 915; https://doi.org/10.3390/insects12100915
Submission received: 30 August 2021 / Revised: 17 September 2021 / Accepted: 20 September 2021 / Published: 7 October 2021
(This article belongs to the Collection Impact of Environmental Factors and Management Practices on Bee Health)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Nosema ceranae affects honey bee (Apis mellifera L.) causing nosemosis disease that often induces serious problems in apiculture. Antibiotic fumagillin is the only licenced treatment against nosemosis, but its effectiveness is questioned and its usage associated with risk of bee mortality and appearance of residues in bee products. In search for alternative treatment for the control of nosemosis, water crude extract of Agaricus bisporus was tested on bees in laboratory (cage) experiments. Bee survival and food consumption were monitored together with Nosema infection level and expression of five genes (abaecin, hymenoptaecin, defensin, apidaecin, and vitellogenin) were evaluated in bees sampled on days 7 and 15. Apart from the gene for defensin, the expression of all tested genes was up-regulated in bees supplemented with A. bisporus extract. Both anti-Nosema and immune protective effects of A. bisporus extract were observed when supplementation started at the moment of N. ceranae infection or preventively (before or simultaneously with the Nosema infection).

Abstract

Agaricus bisporus water crude extract was tested on honey bees for the first time. The first part of the cage experiment was set for selecting one concentration of the A. bisporus extract. Concentration of 200 µg/g was further tested in the second part of the experiment where bee survival and food consumption were monitored together with Nosema infection level and expression of five genes (abaecin, hymenoptaecin, defensin, apidaecin, and vitellogenin) that were evaluated in bees sampled on days 7 and 15. Survival rate of Nosema-infected bees was significantly greater in groups fed with A. bisporus-enriched syrup compared to those fed with a pure sucrose syrup. Besides, the anti-Nosema effect of A. bisporus extract was greatest when applied from the third day which coincides with the time of infection with N. ceranae. Daily food consumption did not differ between the groups indicating good acceptability and palatability of the extract. A. bisporus extract showed a stimulative effect on four out of five monitored genes. Both anti-Nosema and nutrigenomic effects of A. bisporus extract were observed when supplementation started at the moment of N. ceranae infection or preventively (before or simultaneously with the infection).

1. Introduction

The honey bee (Apis mellifera L. (Hymenoptera: Apidae)) is a pollinator important for agricultural production [1] and providing essential macro- and micronutrients [2]. Considerable colony losses in the United States and Europe have significant negative economic and environmental consequences, and can be caused by many factors, most often pathogens and parasites, environmental pollution, nutritional stress, and inadequate beekeeping management [3,4,5].
One of the most common diseases of honey bees is nosemosis caused by microsporidia of the genus Nosema [3] with three species that may affect A. mellifera: N. ceranae, N. apis, and N. neummani. Currently, N. ceranae is one of the most widespread microsporidium causing infections in honey bees [6] with the different symptoms compared with those induced with N. apis [7]. N. ceranae is primarily a pathogen of honey bee midgut. However, this endoparasite or its DNA was also found in other tissues [8,9,10] and hemolymph [11]. Pathological changes in the epithelial cells of the midgut lead to digestive and metabolic disorders causing malnutrition in adult bees [12], diarrhea, decreased honey production, and increased mortality in winter bees [13]. There are reports that N. ceranae induces changes in the carbohydrate metabolism [14,15,16,17], which may increase nutritional and energetic stress [3,15,16,17,18,19,20]. Infection with N. ceranae compromises immunity [21] and induces oxidative stress in bees [5], especially in combination with pesticides [22,23]. It has also been shown that infection of bees with Nosema spp. can reduce the effectiveness of acaricides used for the control of honey bee mite Varroa destructor [24]. In addition to bee diseases, many problems in beekeeping are caused by chemical substances used in the control of bee pathogens due to the many side effects on adult worker bees (increased mortality, shortened lifespan, down-regulation of immune-related genes, induction of toxic stress and up-regulation of detoxification-related genes, decreased worker mobility, learning, memory and trophallaxis, increased Nosema ceranae infection rate), bee brood (increased egg, larval and pupal mortality, reduced brood survival and brood area, delayed larval development, delayed adult emergence), reproduction (reduced drone production, longevity and weight, decreased number and viability of drone sperm, increased queen mortality, failure in queen’s development, reduced queen mating success, queen pupal weight, queen adult weight, queen cell acceptance), consequently leading to weakening of bee colonies and increase in susceptibility to diseases even if used at recommended doses (reviewed in [25]).
The control of nosemosis includes a wide range of beekeeping practices [3] and application of chemicals, such as fumagillin, an antibiotic derived from the fungus Aspergillus fumigatus [26,27]. Although fumagillin use is prohibited in most of European countries due to risk of its commercial formulations (Fumagilin-B, Fumidil-B,) to leave residues in bee products [28,29,30], to affect food safety [31,32], and to increase bee mortality [30], however, it is still licensed in the United States [33], Canada [34], and Argentina [35]. Moreover, its effectiveness has been questioned [28], imposing a constant effort of scientists to discover alternative substances, which would be effective against Nosema spp. Among many natural compounds tested [5,36,37,38,39,40,41,42,43,44,45,46,47], some of them showed promising anti-Nosema effects such as algae and fungus extracts [5,22,36,37,38,39], chitosan and peptidoglycan [40], naringenin, sulforaphane and carvacrol [41], probiotics [42,46], natural substances from Brassicaceae defatted seed meals [43], and natural-based commercial formulations [5,44,47,48]. Diet with the addition of plant-based, amino acid and vitamin supplements, led to reduction of N. ceranae spore number [5,48], immunostimulation, and reduction of oxidative stress in N. ceranae-infected bees [5], and consequently to the improved condition of bees. Interest in mushrooms has been increasing among researchers due to their nutritional and medicinal properties; mushrooms of the genus Agaricus contain numerous biologically-active substances (such as glucans, mannan, lentinan, schizophyllan, scleroglucan) with certain antitumor, antidiabetic, and immunostimulatory effects [49,50,51,52,53,54,55,56]. Stevanovic et al. [38] observed a favorable effect of A. blazei extract on the strength parameters of bee colonies in a field experiment, while Glavinic et al. [5] revealed the positive effect of A. blazei extract in laboratory experiment. The extract stimulated the expression of genes important for immunity, reducing oxidative stress caused by N. ceranae and consequently reducing N. ceranae infection. Beneficial effects on honey bees were observed for other mushroom species, too; extracts derived from the mycelia of Fomes fomentarius, Ganoderma applanatum, G. Resinaceum, and Trametes versicolor demonstrated strong anti-viral efficacy against two bee viruses (deformed wing virus—DWV) and Lake Sinai virus—LSV) in both laboratory and field trials [57].
Having in mind the described positive effects of A. blazei on honey bees and its potential in Nosema control, we decided to assess the effect of A. bisporus extract on bee survival, Nosema infection, and the expression of genes important for bee immunity in a laboratory experiment. A. bisporus is the most cultivated mushroom species among Western countries which makes this research and its application in beekeeping more cost-effective compared to the research and application of A. blazei.

2. Materials and Methods

2.1. Agaricus bisporus Extract Preparation

Water extract of the commercially-cultivated white button mushroom (Agaricus bisporus, strain A15) was prepared according to the procedure described by Klaus et al. [58]. In summary, dry powdered fruit bodies of mushrooms were extracted with distilled water at 121 °C, 1.2 bar, for 60 min. After being filtered, the liquid part was evaporated up to 1/3 of its volume and precipitated with 96% ethanol overnight. The material was then centrifuged, dried at 40 °C, powdered, and kept in the refrigerator (RK6333W, Gorenje, Velenje, Slovenia) before analysis.

2.2. Bees and the Design of Cage Experiment

During April 2020, frames containing areas with sealed brood were taken from three honey bee colonies at the experimental apiary of the Faculty of Veterinary Medicine, University of Belgrade. The frames were placed in net bags (to prevent the dissipation of hatched bees) and kept overnight in a preset incubator (Inkubatori, Pozarevac, Serbia) at the temperature 34 ± 1 °C and humidity 66 ± 1%. The next morning, the newly emerged worker bees were collected from the frames and transferred to experimental cages (60 bees per experimental cage: 10 bees were sampled for the RNA extraction, 20 for Nosema spore counting and the remaining 30 bees served for monitoring the survival) and each group comprised three cages (replicates). Cages were specifically designed by Glavinic et al. [21] for this experiment. Briefly, a plastic jar was punched to allow entry of air, placed with the lid down, and equipped with a plastic strainer inserted in the center of the lid allowing bees to take the syrup from the small petri dish placed below. The whole experiment was repeated, and the results were merged into a single dataset.

2.3. The Selection of an Appropriate Extract Concentration

To determine the optimal concentration of the extract, only the survival of bees was monitored in the first part of the experiment. Newly emerged bees were divided into four experimental groups. The control group (C group) received pure sucrose syrup (50% w/v). The remaining three groups (Table 1) received sucrose syrup (50% w/v) supplemented with A. bisporus extract at concentrations of 100 µg/g (Abs-100 group), 200 µg/g (Abs-200 group) and 400 µg/g (Abs-400 group). The experiment lasted 15 days. The dead bees were counted and removed from the cages on a daily basis.

2.4. Effects of A. bisporus Extract on Nosema Infection

In the second part of the cage experiment, the effect of A. bisporus extract at a concentration of 200 µg/g was evaluated. Six groups were established and all were fed with 50% (w/v) sucrose syrup. There were two control groups: non-infected (NI) and infected with N. ceranae (I). The remaining four experimental groups received sucrose syrup enriched with A. bisporus extract either from the first day (in group Abs, those are non-infected and in Nosema-infected, group I-Abs1), or from the third or sixth day (groups I-Abs3 and I-Abs6, respectively, both Nosema-infected (Table 1)).

2.5. Inoculum Preparation, Experimental Infection, and Bee Sampling

Inoculum preparation and experimental infection of bees were performed according to the previously described methodology [5,21]. Briefly, the inoculum was prepared by crushing the abdomens of N. ceranae-infected bees in distilled water. Number of spores were determined according to Cantwell [59]. Freshly-prepared spore suspension with 99% viability, assessed with 4% trypan blue (Sigma–Aldrich, Steinheim, Germany), mixed with 50% sucrose (Centrohem, Stara Pazova, Serbia) solution was used to obtain 1 × 106 spores/mL final concentration. Bees in the infected control group (I) and treated groups (I-Abs1, I-Abs3, and I-Abs6) were infected with N. ceranae spores on day 3 [5]. From each cage, on days 7 and 15, bees were sampled for counting Nosema spores and gene expression analysis (Table 1). The remaining bees from the cage were used to determine the survival rate. Dead bees were removed from the cage and counted daily. During the experiment, syrup consumption was measured by weighing the food before and after the bees had been fed for 24 h [60]. According to these data, average consumption/bee/day was calculated.

2.6. Nosema Spore Counting

On the day of sampling (day 7 and day 15), 10 bees were taken from each cage. The abdomen of each bee was placed in a 1.5 mL tube and macerated in 1 mL of distilled water in Tissue Lyser II (QIAGEN, Hilden, Germany) for 1 min at 25 Hz. The number of N. ceranae spores was determined using a hemocytometer described in Cantwell [59] and OIE [61], and used also in our previous studies [5,21,22,23].

2.7. RNA Extraction and cDNA Synthesis

The total RNA was extracted with Quick-RNA MiniPrep Kit (Zymo Research, Irvine, CA, USA). A single bee was placed in a 1.5 mL tube with 500 μL of Genomic Lysis Buffer. Homogenization was performed in a TissueLyser II (QIAGEN, Germany) for 1 min at 25 Hz using a 3 mm tungsten carbide bead (Qiagen, Hilden, Germany). Other extraction steps were performed according to the manufacturer’s instructions. In-column DNase treatment (treatment with DNase I Reaction Mix) was applied for all samples during the extraction process with the aim to remove contaminating DNA. cDNA was immediately generated from extracted RNA using the RevertAid™ First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Vilnius, Lithuania).

2.8. Real-Time Quantitative PCR

SYBR green method was used for real-time PCR (qPCR) amplification in a 20 µL reaction mixture with “FastGene® IC Green 2 x qPCR Universal Mix” (Nippon Genetics, Düren, Germany) according to instructions of the manufacturer and modifications described by Glavinic et al. [5]. A specific primer pair was used for each gene (Table 2). The qPCR reactions were performed in a Rotor-Gene Q 5 plex (Qiagen, Valencia, CA, USA). Gene expression level of abaecin, hymenoptaecin, defensin, apidaecin, and vitellogenin was determined using the 2−ΔΔCT method described in Galvinic et al. [5] while β-actin was used as an internal control for normalization of each gene expression.

3. Statistical Methods

The survival of bees was monitored by the number of dead bees per day in each experimental group. The data on the survival distribution obtained in the Kaplan–Meier survival estimator were compared in the log-rank test. The results for N. ceranae spores and gene expression were tested for normality by using Shapiro–Wilk’s test. Due to the normal distribution of data (Shapiro–Wilk’s test, p > 0.05), groups were compared in two-way ANOVA with repeated measures in one factor, followed by Tukey’s test within and Sidak’s test between groups over time. The levels of significance below 0.05 (p < 0.05) were considered significant. The analyses were done using GraphPad Prism 7.0 (GraphPad Software, San Diego, CA, USA).

4. Results

4.1. Bee Survival and Food Consumption

In the first part of the experiment, which was conducted to determine the optimal concentration of the extract for further investigation, no significant differences in bee survival (p > 0.05) were detected between all groups (Figure 1). The lowest number of dead bees was in the group treated with 200 µg/g of A. bisporus extract (Abs-200). Consequently, this concentration was used in the second part of the experiment.
The number of dead bees in the second part of the experiment (Figure 2) was significantly higher in the infected control group (I) compared to NI (p = 0.009), Abs (p = 0.003), I-Abs1 (p = 0.036), I-Abs3 (p = 0.018), and not significantly different (p = 0.185) in comparison with group I-Abs6 (log-rank test). The survival of bees in the non-infected control group (NI) did not differ statistically compared to the groups of Abs (p = 0.714), I-Abs1 (p = 0.552), I-Abs3 (p = 0.760), and I-Abs6 (p = 0.173).
There were no differences in daily food consumption between the control group and all treatment groups. Mean consumption across all groups was 121.63 mg/bee/day (Figure S1).

4.2. Quantification of N. ceranae Spores

In samples of bees from the control non-infected group (NI) and non-infected but treated with A. bisporus extract (Abs), no spores of N. ceranae were detected at any time of sampling. By comparing the number of spores in groups infected with N. ceranae on the 7th and 15th day of sampling, Shidak’s multiple comparison test showed a significantly higher (p < 0.001) number of spores on day 15 compared to day 7. In bee samples from day 7 of the experiment, the Tukey test revealed no significant differences in the number of spores among all groups (p > 0.05). In contrast, on day 15 (Figure 3), the number of spores was significantly higher in group I compared to all other groups (p < 0.001). The lowest number of spores was detected in group I-Abs3, significantly lower than in groups I and I-Abs6 (p < 0.001) and I-Abs1 (p < 0.05).

4.3. Gene Expression Analyses

On day 7, the highest expression levels for the majority of monitored genes were in groups Abs and I-Abs6, in contrast to the infected control (I) group where the lowest gene expression was detected (Figure 4). However, the most important and most significant changes in expression levels were obtained on day 15 (Figure 4 and Figure 5). According to the Tukey test, abaecin expression levels (Figure 5A) were significantly lower in group I compared to all other groups (p < 0.001), but also in group I-Abs6 compared to I-Abs1 (p < 0.05). Gene expression for hymenoptaecin (Figure 5B), on day 15 of the experiment, was significantly lower in group I (p < 0.001) compared to all other groups. However, pairwise comparisons of all treated groups revealed that the expression of the hymenoptaecin gene was significantly higher in the I-Abs1 group compared to I-Abs3 (p < 0.001) and I-Abs6 (p < 0.01). The expression of apidaecin (Figure 5C) and vitellogenin (Figure 5D) was also found to be lower in the control infected group (I) compared to all other groups (p < 0.01). The expression of the gene for apidaecin did not differ among the groups treated with A. bisporus extract, while the level for vitellogenin was higher (p < 0.01) in the group I-Abs3 compared to the groups I-Abs1 and Abs. Regarding gene expression for defensin, although the lowest level was in the group I (Figure 5E), the Tukey test showed no significant differences between the experimental groups.

5. Discussion

Nosemosis is a common and widespread disease that negatively affects adult bees [37]. Infection with N. ceranae is especially dangerous due to its implied role in colony losses [3]. There is a relatively small number of safe preparations used as alternatives to fumagillin in nosemosis control. Thus, there is a constant effort of scientists to discover new natural substances with beneficial effects in the control of this disease [5,36,37,38,39,40,41,42,43,44,45,46,47].
This is the first study in which A. bisporus extract was tested on honey bees. In the first part of the experiment, none of the tested concentrations of A. bisporus extract (100, 200, and 400 µg/g) increased bee mortality compared to control. This has been expected, bearing in mind already reported beneficial effects of other Agaricus spp. extracts on bees [5,38] as well as of other natural-based dietary supplements [21,48,64,65,66,67]. Despite the absence of significant differences among groups, the lowest number of dead bees was in the group fed with 200 µg/g of A. bisporus extract. This result, along with the economic aspect (optimal ratio between the extract amount and the benefit), led us to choose this concentration for further testing. In this experiment, a significantly lower survival rate in the group of infected bees (I) compared to the non-infected group (Figure 2) suggests undoubted fatal effects of N. ceranae infection, which is consistent with previous studies [5,21,68,69]. However, feeding bees with the addition of A. bisporus extract starting from day 1 and 3 at a concentration of 200 µg/g significantly increased the survival rate of infected bees compared to infected bees (group I) fed without the addition of mushroom extract (Figure 2). This result is in accordance with our previous findings where an extract of related fungus A. blazei induced better bee survival [5]. In a field experiment, Stevanović et al. [38] revealed the beneficial impact of A. blazei extract on the strength of honey bee colonies. However, when the extract was applied to infected bees starting from day 6, it did not contribute significantly to mortality decrease compared to group I (Figure 2). This finding indicates a better protective-preventive effect (application before or at the moment of infection) compared to the effect obtained by post-infection application. Having in mind that the main action of medicinal mushroom metabolites is immunomodulation [70], this result was expected. In addition, the extract used in this study was rich in polysaccharides (more than 68%) which are the most reported immunomodulatory compounds from mushrooms [71,72]. The absence of significant differences in bee mortality between the control non-infected group (NI) and all groups that received A. bisporus extract in the diet (Abs, I-Abs1, I-Abs3, and I-Abs6) is an additional confirmation of the extract’s positive effects on bee survival regardless of the application period, similarly as previously reported for A. blazei extract [5], plant extracts (Aristotelia chilensis, Ugni molinae, Gevuina avellan), and propolis [73].
The level of nosema infection was monitored by counting spores on days 7 and 15 of the experiment. The presence of spores in infected groups, and its absence in non-infected groups (NI and Abs) suggest that there was no cross-contamination between the experimental groups, and the design of the cage [21] is adequate for such research. This confirms that the experiment has been performed accurately and in line with COLOSS BEEBOOK recommendations [74]. A significantly higher number of spores was detected on day 15 compared to day 7 in all infected groups. Analysis of the number of spores in the samples collected on day 7 did not reveal significant difference among infected groups. This finding was expected since the infection was still in the initial stage [75]. In contrast, on day 15, a significantly higher number of spores was in group I (Figure 3) compared to all other groups that received the extract. Comparing groups infected with the Nosema and treated with A. bisporus extract (I-Abs1, I-Abs3, and I-Abs6), the lowest spore number was detected in the group I-Abs3 (Figure 3). Thus, we can conclude that the extract of white button mushroom has a noticeable anti-Nosema effect. Moreover, this effect is the highest when applied to start from the third day which coincides with the time of infection with N. ceranae. Such effects have already been demonstrated for A. blazei [5], algae extract also rich in polysaccharides [37], and other supplements [21,73]. Hayman et al. [76] explained microsporidia reduction by inhibition of adhesion to the target cells. Vunduk et al. [77] also showed that mushroom extract exhibits antiadhesion and biofilm formation effect against foodborne bacteria. The extract’s more beneficial effect in groups IAbs-1 and I-Abs3 could be explained by the absence of infected epithelial cells with N. ceranae [75], which gives a better opportunity for more efficient action (adhesion inhibition) of the extract.
Infection with N. ceranae suppressed most of the immune-related genes examined in this study (Figure 4 and Figure 5), which is in line with previous reports of the immunosuppressive effect of this endoparasite [5,21,78,79,80]. The expression level of all genes, except defensin, was significantly lower in group I compared to all other experimental groups (Figure 4 and Figure 5). This result is not surprising considering the amount of N. ceranae spores detected at the end of the experiment (highest spore load in group I—Figure 3) but also the bee mortality (highest number of dead bees in group I—Figure 2). The gene expression levels in all the groups supplemented with A. bisporus extract (Abs, I-Abs1, I-Abs3, and I-Abs6) indicate its stimulatory effect on the expression of all monitored immune genes except defensin (Figure 4 and Figure 5). This finding is consistent with the previous study demonstrating the stimulating effect of A. blazei on honey bee immunity [5,39]. Higher levels of immune-related gene expression in infected and treated groups compared to the infected control group (I) indicate the immunoprotective and immunomodulating effect of A. bisporus extract. Moreover, higher gene expression levels (Figure 4 and Figure 5) in infected and treated groups, and lower spore loads in those groups (Figure 3) revealed an inverse correlation between spore loads and levels of immune-related gene expression. Gene expression levels on day 15 compared to day 7 were significantly higher for all tested genes in group I-Abs3 (except the one for defensin); significantly higher for all tested genes in group I-Abs1 (except those for defensin and apidaecin); significantly higher only for vitellogenin gene in I-Abs6 group (Figure 4), and significantly lower for all tested genes in the infected control group (I). Greater stimulation of gene expression in group I-Abs1 and I-Abs3 compared to I-Abs6 indicates better efficacy of the extract before and at the moment of infection with N. ceranae. A better protective effect is expected as the extract is rich in polysaccharides [5,36,37,38], while the anti-Nosema effect is more typical for antibiotics such as fumagillin [5,29,30,33,34,35]. Moreover, we used crude water extract which, besides polysaccharides (almost 70%), contains proteins (5.31%) and phenolic compounds (2.7%) as well [71,81]. These metabolites express different modes of action. Proteins are often bound to polysaccharides and cumulative immunomodulatory effect can be expected. Phenolics, as fungal secondary metabolites, mainly act as antioxidants, and can be important in the early stage of infection development [82].

6. Conclusions

This is the first study of the effects of A. bisporus extract on honey bees that showed the potential for improving the survival and the immunity of bees infected with N. ceranae. The effect on immunity has been demonstrated through increased expression of immune-related genes in both non-infected bees and bees infected with N. ceranae. Besides, A. bisporus extract was effective in reducing the number of Nosema spores. The best results were observed when the extract was applied at the moment of infection or preventively (before or simultaneously with the Nosema infection). Finally, the tested extract has a strong stimulatory effect on gene expression in both N. ceranae-infected and uninfected bees. In the absence of adequate and safe natural-based therapy for nosemosis, we can conclude that A. bisporus extract has a great potential for use in the control of this bee disease and needs to be further investigated in the field experiments.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/insects12100915/s1, Figure S1: Daily food consumption per bee in the non-infected group (NI), infected group (I) and the groups infected with N. ceranae and treated with A. bisporus extract from the day 1 (I-Abs1), day 3 (I-Abs3) and day 6 (I-Abs6).

Author Contributions

Conceptualization: Z.S., U.G., and I.M.; Design of experiment and methodology: U.G., and Z.S.; Laboratory analysis: U.G., J.V., M.R., and B.V.; Data curation: U.G., M.R., and B.V.; Writing, review and editing: U.G., M.R., Z.S., J.S., J.V., B.V., and I.M. All authors have read and agreed to the published version of the manuscript.

Funding

The study was supported by the Ministry of Education, Science and Technological Development of the Republic of Serbia (contract no. 451-03-9/2021-14/200143 for the project led by Zoran Stanimirovic).

Institutional Review Board Statement

Ethical review and approval were waived for this study, due to the study of invertebrates only (honey bees are exempted from ethical review).

Data Availability Statement

The data presented in this study are available on request from the corresponding author. The data are not publicly available due to the excessive data size.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Burnham, A.J. Scientific Advances in Controlling Nosema ceranae (Microsporidia) Infections in Honey Bees (Apis mellifera). Front. Vet. Sci. 2019, 6, 79. [Google Scholar] [CrossRef] [Green Version]
  2. Reeves, A.M.; O’Neal, S.T.; Fell, R.D.; Brewster, C.C.; Anderson, T.D. In-Hive Acaricides Alter Biochemical and Morphological Indicators of Honey Bee Nutrition, Immunity, and Development. J. Insect Sci. 2018, 18. [Google Scholar] [CrossRef]
  3. Stanimirović, Z.; Glavinić, U.; Ristanić, M.; Aleksić, N.; Jovanović, N.M.; Vejnović, B.; Stevanović, J. Looking for the causes of and solutions to the issue of honey bee colony losses. Acta Vet. 2019, 69, 1–31. [Google Scholar] [CrossRef] [Green Version]
  4. Barroso-Arévalo, S.; Vicente-Rubiano, M.; Puerta, F.; Molero, F.; Sánchez-Vizcaíno, J.M. Immune related genes as markers for monitoring health status of honey bee colonies. BMC Vet. Res. 2019, 15, 72. [Google Scholar] [CrossRef] [Green Version]
  5. Glavinic, U.; Stevanovic, J.; Ristanic, M.; Rajkovic, M.; Davitkov, D.; Lakic, N.; Stanimirovic, Z. Potential of Fumagillin and Agaricus blazei Mushroom Extract to Reduce Nosema ceranae in Honey Bees. Insects 2021, 12, 282. [Google Scholar] [CrossRef] [PubMed]
  6. Araneda, X.; Cumian, M.; Morales, D. Distribution, epidemiological characteristics and control methods of the pathogen Nosema ceranae Fries in honey bees Apis mellifera L. (Hymenoptera, Apidae). Arch. Med. Vet. 2015, 47, 129–138. [Google Scholar] [CrossRef] [Green Version]
  7. Martín-Hernandez, R.; Bartolomé, C.; Chejanovsky, N.; Le Conte, Y.; Dalmon, A.; Dussaubat, C.; García-Palencia, P.; Meana, A.; Pinto, M.A.; Soroker, V.; et al. Nosema ceranae in Apis mellifera: A 12 years postdetection perspective. Environ. Microbiol. 2018, 20, 1302–1329. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Chen, Y.P.; Evans, J.; Murphy, C.; Gutell, R.; Zuker, M.; Gundensen-Rindal, D.; Pettis, J.S. Morphological, Molecular, and Phylogenetic Characterization ofNosema ceranae, a Microsporidian Parasite Isolated from the European Honey Bee, Apis mellifera. J. Eukaryot. Microbiol. 2009, 56, 142–147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Gisder, S.; Hedtke, K.; Möckel, N.; Frielitz, M.C.; Linde, A.; Genersch, E. Five-year cohort study of Nosema spp. in Germany: Does climate shape virulence and assertiveness of Nosema ceranae? Appl. Environ. Microb. 2010, 76, 3032–3038. [Google Scholar] [CrossRef] [Green Version]
  10. Copley, T.; Jabaji, S. Honeybee glands as possible infection reservoirs of Nosema ceranae and Nosema apis in naturally infected forager bees. J. Appl. Microbiol. 2011, 112, 15–24. [Google Scholar] [CrossRef]
  11. Glavinic, U.; Stevanovic, J.; Gajic, B.; Simeunovic, P.; Đuric, S.; Vejnovic, B.; Stanimirovic, Z. Nosema ceranae DNA in honey bee haemolymph and honey bee mite Varroa destructor. Acta Vet.-Beograd 2014, 64, 349–357. [Google Scholar]
  12. Gajger, I.; Kozaric, Z.; Berta, D.; Nejedli, S.; Petrinec, Z. Effect of the Herbal preparation Nozevict on the mid-gut structure of honeybees (Apis melífera) infected with Nosema sp. Spores. Vet. Med. 2011, 56, 344–351. [Google Scholar] [CrossRef] [Green Version]
  13. Traver, B.E.; Fell, R.D. Nosema ceranae in drone honey bees (Apis mellifera). J. Invertebr. Pathol. 2011, 107, 234–236. [Google Scholar] [CrossRef]
  14. Dussaubat, C.; Brunet, J.-L.; Higes, M.; Colbourne, J.; Lopez, J.; Choi, J.H.; Hernández, R.M.; Botías, C.; Cousin, M.; McDonnell, C.; et al. Gut Pathology and Responses to the Microsporidium Nosema ceranae in the Honey Bee Apis mellifera. PLoS ONE 2012, 7, e37017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Mayack, C.; Naug, D. Energetic stress in the honeybee Apis mellifera from Nosema ceranae infection. J. Invertebr. Pathol. 2009, 100, 185–188. [Google Scholar] [CrossRef]
  16. Aliferis, K.A.; Copley, T.; Jabaji, S. Gas chromatography–mass spectrometry metabolite profiling of worker honey bee (Apis mellifera L.) hemolymph for the study of Nosema ceranae infection. J. Insect Physiol. 2012, 58, 1349–1359. [Google Scholar] [CrossRef]
  17. Vidau, C.; Panek, J.; Texier, C.; Biron, D.G.; Belzunces, L.P.; Le Gall, M.; Broussard, C.; Delbac, F.; El Alaoui, H. Differential proteomic analysis of midguts from Nosema ceranae-infected honeybees reveals manipulation of key host functions. J. Invertebr. Pathol. 2014, 121, 89–96. [Google Scholar] [CrossRef]
  18. Mayack, C.; Naug, D. Parasitic infection leads to decline in hemolymph sugar levels in honeybee foragers. J. Insect Physiol. 2010, 56, 1572–1575. [Google Scholar] [CrossRef]
  19. Hernández, R.M.; Botías, C.; Barrios, L.; Martínez-Salvador, A.; Meana, A.; Mayack, C.; Higes, M. Comparison of the energetic stress associated with experimental Nosema ceranae and Nosema apis infection of honeybees (Apis mellifera). Parasitol. Res. 2011, 109, 605–612. [Google Scholar] [CrossRef]
  20. Aufauvre, J.; Misme-Aucouturier, B.; Viguès, B.; Texier, C.; Delbac, F.; Blot, N. Transcriptome Analyses of the Honeybee Response to Nosema ceranae and Insecticides. PLoS ONE 2014, 9, e91686. [Google Scholar] [CrossRef]
  21. Glavinic, U.; Stankovic, B.; Draskovic, V.; Stevanovic, J.; Petrovic, T.; Lakic, N.; Stanimirovic, Z. Dietary amino acid and vitamin complex protects honey bee from immunosuppression caused by Nosema ceranae. PLoS ONE 2017, 12, e0187726. [Google Scholar] [CrossRef]
  22. Glavinic, U.; Tesovnik, T.; Stevanovic, J.; Zorc, M.; Cizelj, I.; Stanimirovic, Z.; Narat, M. Response of adult honey bees treated in larval stage with prochloraz to infection with Nosema ceranae. PeerJ 2019, 7, e6325. [Google Scholar] [CrossRef] [Green Version]
  23. Tesovnik, T.; Zorc, M.; Ristanić, M.; Glavinić, U.; Stevanović, J.; Narat, M.; Stanimirović, Z. Exposure of honey bee larvae to thiamethoxam and its interaction with Nosema ceranae infection in adult honey bees. Environ. Pollut. 2020, 256, 113443. [Google Scholar] [CrossRef] [PubMed]
  24. Botías, C.; Barrios, L.; Nanetti, A.; Meana, A.; Martín-Hernández, R.; Garrido-Bailón, E.; Higes, M. Nosema spp. parasitization decreases the effectiveness of acaricide strips (Apivar®) in treating varroosis of honey bee (Apis mellifera iberiensis) colonies. Environ. Microbiol. Rep. 2011, 4, 57–65. [Google Scholar] [CrossRef]
  25. Tihelka, E. Effects of synthetic and organic acaricides on honey bee health: A review. Slov. Vet.-Res. 2018, 55. [Google Scholar] [CrossRef] [Green Version]
  26. Katznelson, H.; Jamieson, C.A. Control of Nosema Disease of Honeybees with Fumagillin. Science 1952, 115, 70–71. [Google Scholar] [CrossRef] [PubMed]
  27. Bailey, L. Effect of Fumagillin upon Nosema apis (Zander). Nature 1953, 171, 212–213. [Google Scholar] [CrossRef] [PubMed]
  28. Huang, W.-F.; Solter, L.F.; Yau, P.; Imai, B.S. Nosema ceranae Escapes Fumagillin Control in Honey Bees. PLOS Pathog. 2013, 9, e1003185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Heever, J.P.V.D.; Thompson, T.; Otto, S.; Curtis, J.M.; Ibrahim, A.; Pernal, S.F. Evaluation of Fumagilin-B® and other potential alternative chemotherapies against Nosema ceranae-infected honeybees (Apis mellifera) in cage trial assays. Apidologie 2015, 47, 617–630. [Google Scholar] [CrossRef] [Green Version]
  30. Heever, J.P.V.D.; Thompson, T.; Otto, S.; Curtis, J.M.; Ibrahim, A.; Pernal, S.F. The effect of dicyclohexylamine and fumagillin on Nosema ceranae-infected honey bee (Apis mellifera) mortality in cage trial assays. Apidologie 2015, 47, 663–670. [Google Scholar] [CrossRef]
  31. Stanimirovic, Z.; Stevanovic, J.; Bajic, V.; Radovic, I. Evaluation of genotoxic effects of fumagillin (dicyclohexylamine) by citogenetic tests in vivo. Mut. Res.-Genet. Toxicol. Environ. Mutagenes. 2007, 628, 1–10. [Google Scholar] [CrossRef] [PubMed]
  32. Stevanovic, J.; Stanimirović, Z.; Radakovic, M.; Stojić, V. In vitro evaluation of the clastogenicity of fumagillin. Environ. Mol. Mutagenes. 2008, 49, 594–601. [Google Scholar] [CrossRef] [PubMed]
  33. Higes, M.; Nozal, M.J.; Alvaro, A.; Barrios, L.; Meana, A.; Hernández, R.M.; Bernal, J.L. The stability and effectiveness of fumagillin in controlling Nosema ceranae (Microsporidia) infection in honey bees (Apis mellifera) under laboratory and field conditions. Apidologie 2011, 42, 364–377. [Google Scholar] [CrossRef] [Green Version]
  34. McCallum, R.; Olmstead, S.; Shaw, J.; Glasgow, K. Evaluating efficacy of Fumagilin-B® against Nosemosis and tracking seasonal srends of Nosema spp. in Nova Scotia Honey bee colonies. J. Apic. Sci. 2020, 64, 277–286. [Google Scholar]
  35. Sarlo, E.G.; Medici, S.K.; Porrini, M.P.; Garrido, P.M.; Floris, I.; Eguaras, M.J. Comparison between different fumagillin dosage and evaluation method in the apiary control of Nosemosis type C. Redia 2011, 94, 39–44. [Google Scholar]
  36. Charistos, L.; Parashos, N.; Hatjina, F. Long term effects of a food supplement HiveAlive™ on honey bee colony strength and Nosema ceranae spore counts. J. Apic. Res. 2015, 54, 420–426. [Google Scholar] [CrossRef]
  37. Roussel, M.; Villay, A.; Delbac, F.; Michaud, P.; Laroche, C.; Roriz, D.; El Alaoui, H.; Diogon, M. Antimicrosporidian activity of sulphated polysaccharides from algae and their potential to control honeybee nosemosis. Carbohydr. Polym. 2015, 133, 213–220. [Google Scholar] [CrossRef]
  38. Stevanovic, J.; Stanimirovic, Z.; Simeunovic, P.; Lakic, N.; Radovic, I.; Sokovic, M.; Van Griensven, L.J. The effect of Agaricus brasiliensis extract supplementation on honey bee colonies. Acad. Bras. Ciências 2018, 90, 219–229. [Google Scholar] [CrossRef]
  39. Glavinic, U. The effects of various antimicrobials and supplements on the expression of immune-related genes, oxidative stress and survival of honey bee Apis mellifera infected with microsporidium Nosema ceranae. Ph.D. Thesis, Faculty of Veterinary Medicine, University of Belgrade, Belgrade, Serbia, 2019. [Google Scholar]
  40. Valizadeh., P.; Guzman-Novoa, E.; Goodwin, P.H. Effect of immune inducers on Nosema ceranae multiplication and their impact on Honey Bee (Apis mellifera L.) survivorship and behaviors. Insects 2020, 11, 572. [Google Scholar] [CrossRef]
  41. Borges, D.; Guzman-Novoa, E.; Goodwin, P.H. Control of the microsporidian parasite Nosema ceranae in honey bees (Apis mellifera) using nutraceutical and immuno-stimulatory compounds. PLoS ONE 2020, 15, e0227484. [Google Scholar] [CrossRef]
  42. Borges., D.; Guzman-Novoa., E.; Goodwin, P.H. Effects of prebiotics and probiotics on honey bees (Apis mellifera) infected with the microsporidian parasite Nosema ceranae. Microorganisms 2021, 9, 481. [Google Scholar] [CrossRef] [PubMed]
  43. Nanetti, A.; Ugolini, L.; Cilia, G.; Pagnotta, E.; Malaguti, L.; Cardaio, I.; Matteo, R.; Lazzeri, L. Seed meals from Brassica nigra and Eruca sativa control artificial Nosema ceranae infections in Apis mellifera. Microorganisms 2021, 9, 949. [Google Scholar] [CrossRef]
  44. Cilia, G.; Garrido, C.; Bonetto, M.; Tesoriero, D.; Nanetti, A. Effect of Api-Bioxal® and ApiHerb® treatments against Nosema ceranae infection in Apis mellifera investigated by two qPCR methods. Vet. Sci. 2020, 7, 125. [Google Scholar] [CrossRef] [PubMed]
  45. Cilia, G.; Fratini, F.; Tafi, E.; Turchi, B.; Mancini, S.; Sagona, S.; Nanetti, A.; Cerri, D.; Felicioli, A. Microbial profile of the ven-triculum of honey bee (Apis mellifera ligustica Spinola, 1806) fed with veterinary drugs, dietary supplements and non-protein amino acids. Vet. Sci. 2020, 7, 76. [Google Scholar] [CrossRef] [PubMed]
  46. El Khoury, S.; Rousseau, A.; Lecoeur, A.; Cheaib, B.; Bouslama, S.; Mercier, P.-L.; Demey, V.; Castex, M.; Giovenazzo, P.; Derome, N. Deleterious Interaction Between Honeybees (Apis mellifera) and its Microsporidian Intracellular Parasite Nosema ceranae Was Mitigated by Administrating Either Endogenous or Allochthonous Gut Microbiota Strains. Front. Ecol. Evol. 2018, 6. [Google Scholar] [CrossRef] [Green Version]
  47. Michalczyk, M.; Sokół, R. Estimation of the influence of selected products on co-infection with N. apis/N. ceranae in Apis mellifera using real-time PCR. Invertebr. Reprod. Dev. 2018, 62, 92–97. [Google Scholar] [CrossRef]
  48. Jovanovic, N.M.; Glavinic, U.; Delic, B.; Vejnovic, B.; Aleksic, N.; Mladjan, V.; Stanimirovic, Z. Plant-based supplement containing B-complex vitamins can improve bee health and increase colony performance. Prev. Vet.-Med. 2021, 190, 105322. [Google Scholar] [CrossRef]
  49. Ishii, P.L.; Prado, C.K.; de Oliveira Mauro, M.; Carreira, C.M.; Mantovani, M.S.; Ribeiro, L.R.; Dichi, J.B.; Oliveira, R.J. Eval-uation of Agaricus blazei in vivo for antigenotoxic, anticarcinogenic, phagocytic and immunomodulatory activities. Regul. Toxicol. Pharm. 2011, 59, 412–422. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Soković, M.; Ćirić, A.; Glamočlija, J.; Nikolić, M.; Van Griensven, L.J.L.D. Agaricus Blazei Hot Water Extract Shows Anti Quorum Sensing Activity in the Nosocomial Human Pathogen Pseudomonas Aeruginosa. Molecules 2014, 19, 4189–4199. [Google Scholar] [CrossRef] [Green Version]
  51. Stojković, D.; Reis, F.S.; Glamočlija, J.; Ćirić, A.; Barros, L.; Van Griensven, L.J.; Ferreira, C.F.R.I.; Soković, M. Cultivated strains of Agaricus bisporus and A. brasiliensis: Chemical characterization and evaluation of antioxidant and antimicrobial properties for the final healthy product–natural preservatives in yoghurt. Food Funct. 2014, 5, 1602–1612. [Google Scholar] [CrossRef]
  52. Stojkovic, D.; Smiljkovic, M.; Ciric, A.; Glamočlija, J.; Van Griensven, L.; Ferreira, I.; Sokovic, M. An insight into antidiabetic properties of six medicinal and edible mushrooms: Inhibition of α-amylase and α-glucosidase linked to type-2 diabetes. S. Afr. J. Bot. 2019, 120, 100–103. [Google Scholar] [CrossRef] [Green Version]
  53. da Silva de Souza, A.C.; Correa, V.G.; Goncalves, G.A.; Soares, A.A.; Bracht, A.; Peralta, R.M. Agaricus blazei bioactive com-pounds and their effects on human health: Benefits and controversies. Curr. Pharm. Des. 2017, 23, 2807–2834. [Google Scholar] [CrossRef] [PubMed]
  54. Gargano, M.L.; van Griensven, L.J.; Isikhuemhen, O.S.; Lindequist, U.; Venturella, G.; Wasser, S.P.; Zervakis, G.I. Medicinal mushrooms: Valuable biological resources of high exploitation potential. Plant Biosyst. 2017, 151, 548–565. [Google Scholar] [CrossRef]
  55. Gallego, P.; Rojas, Á.; Falcón, G.; Carbonero, P.; García-Lozano, M.R.; Gil, A.; Grande, L.; Cremades, O.; Romero-Gómez, M.; Bautista, D.J.; et al. Water-soluble extracts from edible mushrooms (Agaricus bisporus) as inhibitors of hepatitis C viral replication. Food Funct. 2019, 10, 3758–3767. [Google Scholar] [CrossRef]
  56. Vunduk, J.; Kozarski, M.; Djekic, I.; Tomašević, I.; Klaus, A. Effect of modified atmosphere packaging on selected functional characteristics of Agaricus bisporus. Eur. Food Res. Technol. 2021, 247, 829–838. [Google Scholar] [CrossRef]
  57. Stamets, P.E.; Naeger, N.L.; Evans, J.D.; Han, J.O.; Hopkins, B.K.; Lopez, D.; Moershel, H.M.; Nally, R.; Sumerlin, D.; Taylor, A.W.; et al. Extracts of polypore mushroom mycelia reduce viruses in honey bees. Sci. Rep. 2018, 8, 13936. [Google Scholar] [CrossRef] [PubMed]
  58. Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Van Griensven, L.J.L.D. Antioxidative activities and chemical char-acterization of polysaccharides extracted from the basidiomycete Schizophyllum commune. LWT-Food Sci. Technol. 2011, 44, 1–7. [Google Scholar] [CrossRef]
  59. Cantwell, G.E. Standard methods for counting Nosema spores. Am. Bee J. 1970, 110, 222–223. [Google Scholar]
  60. Williamson, S.M.; Wright, G.A. Exposure to multiple cholinergic pesticides impairs olfactory learning and memory in honey-bees. J. Exp. Biol. 2013, 216, 1799–1807. [Google Scholar]
  61. OIE–Office International Des Epizooties. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter 2.2.4. Nosemosis of Honey Bees. 2018. Available online: https://www.oie.int/fileadmin/Home/eng/Health_standards/tahm/3.02.04_NOSEMOSIS_FINAL.pdf (accessed on 30 August 2021).
  62. Simone, M.; Evans, J.D.; Spivak, M. Resin collection and social immunity in honey bees. Evolution 2009, 63, 3016–3022. [Google Scholar] [CrossRef]
  63. Evans, J.D.; Aronstein, K.; Chen, Y.P.; Hetru, C.; Imler, J.L.; Jiang, H.; Kanost, M.; Thompson, G.J.; Zou, Z.; Hultmark, D. Immune pathways and defence mechanisms in honey bees Apis mellifera. Insect Mol. Biol. 2006, 15, 645–656. [Google Scholar] [CrossRef] [Green Version]
  64. Jehlík, T.; Kodrík, D.; Krištůfek, V.; Koubová, J.; Sábová, M.; Danihlík, J.; Tomčala, A.; Frydrychová, R.Č. Effects of Chlorella sp. on biological characteristics of the honey bee Apis mellifera. Apidologie 2019, 50, 564–577. [Google Scholar] [CrossRef]
  65. Ricigliano, V.A.; Simone-Finstrom, M. Nutritional and prebiotic efficacy of the microalga Arthrospira platensis (spirulina) in honey bees. Apidologie 2020, 51, 898–910. [Google Scholar] [CrossRef]
  66. Ricigliano, V.A.; Ihle, K.E.; Williams, S.T. Nutrigenetic comparison of two Varroa-resistant honey bee stocks fed pollen and spirulina microalgae. Apidologie 2021, 52, 873–886. [Google Scholar] [CrossRef]
  67. Shumkova, R.; Balkanska, R.; Hristov, P. The Herbal Supplements NOZEMAT HERB® and NOZEMAT HERB PLUS®: An Alternative Therapy for N. ceranae Infection and Its Effects on Honey Bee Strength and Production Traits. Pathogens 2021, 10, 234. [Google Scholar] [CrossRef]
  68. Williams, G.R.; Shutler, D.; Burgher-MacLellan, K.L.; Rogers, R.E. Infra-population and-community dynamics of the parasites Nosema apis and Nosema ceranae, and consequences for honey bee (Apis mellifera) hosts. PLoS ONE 2014, 9, e99465. [Google Scholar] [CrossRef] [Green Version]
  69. Huang, W.F.; Solter, L.; Aronstein, K.; Huang, Z. Infectivity and virulence of Nosema ceranae and Nosema apis in commercially available North American honey bees. J. Invertebr. Pathol. 2015, 124, 107–113. [Google Scholar] [CrossRef]
  70. Lull, C.; Wichers, H.J.; Savelkoul, H.F. Antiinflammatory and immunomodulating properties of fungal metabolites. Mediat. Inflamm. 2005, 2, 63–80. [Google Scholar] [CrossRef] [Green Version]
  71. Vunduk, J.; Djekic, I.; Petrović, P.; Tomašević, I.; Kozarski, M.; Despotović, S.; Nikšić, M.; Klaus, A. Challenging the difference between white and brown Agaricus bisporus mushrooms: Science behind consumers choice. Br. Food J. 2018, 120, 1381–1394. [Google Scholar] [CrossRef]
  72. Zhao, S.; Gao, Q.; Rong, C.; Wang, S.; Zhao, Z.; Liu, Y.; Xu, J. Immunomodulatory effects of edible and medicinal mushrooms and their bioactive immunoregulatory products. J. Fungi 2020, 6, 269. [Google Scholar] [CrossRef]
  73. Arismendi, N.; Vargas, M.; López, M.D.; Barría, Y.; Zapata, N. Promising antimicrobial activity against the honey bee parasite Nosema ceranae by methanolic extracts from Chilean native plants and propolis. J. Apic. Res. 2018, 57, 522–535. [Google Scholar] [CrossRef]
  74. Fries, I.; Chauzat, M.P.; Chen, Y.P.; Doublet, V.; Genersch, E.; Gisder, S.; Higes, M.; McMahon, P.D.; Martín-Hernández, R.; Natsopoulou, M.; et al. Standard methods for Nosema research. J. Apicult. Res. 2013, 52, 1–28. [Google Scholar] [CrossRef] [Green Version]
  75. Higes, M.; Garcia-Palencia, P.; Martín-Hernández, R.; Meana, A. Experimental infection of Apis mellifera honeybees with Nosema ceranae (Microsporidia). J. Invertebr. Pathol. 2007, 94, 211–217. [Google Scholar] [CrossRef]
  76. Hayman, J.R.; Southern, T.R.; Nash, T.E. Role of sulfated glycans in adherence of the microsporidian Encephalitozoon intestinalis to host cells in vitro. Infect. Immun. 2005, 73, 841–848. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  77. Vunduk, J.; Wan-Mohtar, W.A.A.Q.I.; Mohamad, S.A.; Halim, N.H.A.; Dzomir, A.Z.M.; Žižak, Ž.; Klaus, A. Polysaccharides of Pleurotus flabellatus strain Mynuk produced by submerged fermentation as a promising novel tool against adhesion and biofilm formation of foodborne pathogens. LWT-Food Sci. Technol. 2019, 112, 108221. [Google Scholar] [CrossRef]
  78. Antunez, K.; Martín-Hernández, R.; Prieto, L.; Meana, A.; Zunino, P.; Higes, M. Immune-suppression in the honey bee (Apis mellifera) following infection by Nosema ceranae (Microsporidia). Environ. Microbiol. 2009, 11, 2284–2290. [Google Scholar] [CrossRef]
  79. Chaimanee, V.; Chantawannakul, P.; Chen, Y.; Evans, J.D.; Pettis, J.S. Differential expression of immune genes of adult honey bee (Apis mellifera) after inoculated by Nosema ceranae. J. Insect. Physiol. 2012, 58, 1090–1095. [Google Scholar] [CrossRef] [PubMed]
  80. Badaoui, B.; Fougeroux, A.; Petit, F.; Anselmo, A.; Gorni, C.; Cucurachi, M.; Cersini, A.; Granato, A.; Cardeti, G.; Formato, G.; et al. RNA-sequence analysis of gene expression from honeybees (Apis mellifera) infected with Nosema ceranae. PLoS ONE 2017, 12, e0173438. [Google Scholar] [CrossRef] [PubMed]
  81. Djekic, I.; Vunduk, J.; Tomašević, I.; Kozarski, M.; Petrovic, P.; Niksic, M.; Pudja, P.; Klaus, A. Total quality index of Agaricus bisporus mushrooms packed in modified atmosphere. J. Sci. Food Agric. 2017, 97, 3013–3021. [Google Scholar] [CrossRef] [PubMed]
  82. Kozarski, M.; Klaus, A.; Jakovljevic, D.; Todorovic, N.; Vunduk, J.; Petrović, P.; Niksic, M.; Vrvic, M.M.; Van Griensven, L. Antioxidants of edible mushrooms. Molecules 2015, 20, 19489–19525. [Google Scholar] [CrossRef] [Green Version]
Insects 12 00915 g001 550
Figure 1. Survival of bees treated with A. bisporus extract: 100 µg/g (Abs-100), 200 µg/g (Abs-200), 400 µg/g (Abs-400), and control (C) group.
Figure 1. Survival of bees treated with A. bisporus extract: 100 µg/g (Abs-100), 200 µg/g (Abs-200), 400 µg/g (Abs-400), and control (C) group.
Insects 12 00915 g001
Insects 12 00915 g002 550
Figure 2. Survival of bees infected with N. ceranae (I), non-infected but treated with A. bisporus extract (Abs), bees infected with N. ceranae and treated with A. bisporus extract from day 1 (group I-Abs1), day 3 (I-Abs3), and day 6 (I-Abs6), as well as bees from the control non-infected (NI) group.
Figure 2. Survival of bees infected with N. ceranae (I), non-infected but treated with A. bisporus extract (Abs), bees infected with N. ceranae and treated with A. bisporus extract from day 1 (group I-Abs1), day 3 (I-Abs3), and day 6 (I-Abs6), as well as bees from the control non-infected (NI) group.
Insects 12 00915 g002
Insects 12 00915 g003 550
Figure 3. Number of N. ceranae spores in infected group (I) and groups of bees infected with N. ceranae and treated with A. bisporus extract from day 1 (I-Abs1), day 3 (I-Abs3), and day 6 (I-Abs6). * p < 0.05.
Figure 3. Number of N. ceranae spores in infected group (I) and groups of bees infected with N. ceranae and treated with A. bisporus extract from day 1 (I-Abs1), day 3 (I-Abs3), and day 6 (I-Abs6). * p < 0.05.
Insects 12 00915 g003
Insects 12 00915 g004 550
Figure 4. Heatmap of immune−related genes (means of Log2 of relative expression ratios for abaecin, hymenoptaecin, defensin, apidaecin and vitellogenin) at different time points in experimental groups. N. ceranae infected control (I), group treated with extract (Abs), and groups infected and treated with A. bisporus extract from day 1 (I-Abs1), day 3 (I-Abs3), and day 6 (I-Abs6). Range log2 value of relative expression ratio is given in the legend on the right indicating up- or down-regulation of the expression. Group names are indicated in Table 1.
Figure 4. Heatmap of immune−related genes (means of Log2 of relative expression ratios for abaecin, hymenoptaecin, defensin, apidaecin and vitellogenin) at different time points in experimental groups. N. ceranae infected control (I), group treated with extract (Abs), and groups infected and treated with A. bisporus extract from day 1 (I-Abs1), day 3 (I-Abs3), and day 6 (I-Abs6). Range log2 value of relative expression ratio is given in the legend on the right indicating up- or down-regulation of the expression. Group names are indicated in Table 1.
Insects 12 00915 g004
Insects 12 00915 g005a 550Insects 12 00915 g005b 550
Figure 5. Gene expression levels for abaecin (A), hymenoptaecin (B), apidaecin (C), vitellogenin (D), and defensin (E) in bees infected with N. cerane (I), non−infected but treated with A. bisporus extract (Abs), as well as bees infected with N. cerane and treated with A. bisporus extract from day 1 (I-Abs1), day 3 (I-Abs3) and day 6 (I-Abs6) of the experiment. * p < 0.05.
Figure 5. Gene expression levels for abaecin (A), hymenoptaecin (B), apidaecin (C), vitellogenin (D), and defensin (E) in bees infected with N. cerane (I), non−infected but treated with A. bisporus extract (Abs), as well as bees infected with N. cerane and treated with A. bisporus extract from day 1 (I-Abs1), day 3 (I-Abs3) and day 6 (I-Abs6) of the experiment. * p < 0.05.
Insects 12 00915 g005aInsects 12 00915 g005b
Table
Table 1. Experimental design.
Table 1. Experimental design.
GROUP 1Day of Starting the Treatment 2N. ceranae Infection Day 2Sampling Day 2
NI––715
I–3715
Abs1–715
I-Abs113715
I-Abs333715
I-Abs663715
1 Bees were non-infected (NI) or infected with N. ceranae (I) and treated with A. bisporus extract (Abs). 2 Days after bee emergence.
Table
Table 2. Primer used for qPCR analysis.
Table 2. Primer used for qPCR analysis.
PrimerSequence 5′–3′Reference
Beta actin-FTTGTATGCCAACACTGTCCTTT[62]
Beta actin-RTGGCGCGATGATCTTAATTT
Abaecin-FCAGCATTCGCATACGTACCA[63]
Abaecin-RGACCAGGAAACGTTGGAAAC
Hymenopt-FCTCTTCTGTGCCGTTGCATA[63]
Hymenopt-RGCGTCTCCTGTCATTCCATT
Defensin-FTGCGCTGCTAACTGTCTCAG[63]
Defensin-RAATGGCACTTAACCGAAACG
ApidNT-FTTTTGCCTTAGCAATTCTTGTTG[62]
ApidNT-RGTAGGTCGAGTAGGCGGATCT
VgMC-FAGTTCCGACCGACGACGA[62]
VgMC-RTTCCCTCCCACGGAGTCC
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Glavinic, U.; Rajkovic, M.; Vunduk, J.; Vejnovic, B.; Stevanovic, J.; Milenkovic, I.; Stanimirovic, Z. Effects of Agaricus bisporus Mushroom Extract on Honey Bees Infected with Nosema ceranae. Insects 2021, 12, 915. https://doi.org/10.3390/insects12100915

AMA Style

Glavinic U, Rajkovic M, Vunduk J, Vejnovic B, Stevanovic J, Milenkovic I, Stanimirovic Z. Effects of Agaricus bisporus Mushroom Extract on Honey Bees Infected with Nosema ceranae. Insects. 2021; 12(10):915. https://doi.org/10.3390/insects12100915

Chicago/Turabian Style

Glavinic, Uros, Milan Rajkovic, Jovana Vunduk, Branislav Vejnovic, Jevrosima Stevanovic, Ivanka Milenkovic, and Zoran Stanimirovic. 2021. "Effects of Agaricus bisporus Mushroom Extract on Honey Bees Infected with Nosema ceranae" Insects 12, no. 10: 915. https://doi.org/10.3390/insects12100915

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop