Identification and Functional Analysis of Apoptotic Protease Activating Factor-1 (Apaf-1) from Spodoptera litura
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Antibodies
2.2. Cloning of Sl-apaf-1 Gene
2.3. Structure and Phylogenetic Analysis of the Sl-Apaf-1 Protein
2.4. Cell Transfection and RNA Interference of SL-1 Cells
2.5. Western Blot Analysis
2.6. Microscopy
2.7. Flow Cytometric Analysis
2.8. Expression and Purification of Proteins in E. coli
2.9. Protein Cleavage Experiments
2.10. Isothermal Titration Calorimetry Assay
2.11. Statistical Analysis
2.12. GenBank Accession Numbers
3. Results
3.1. Sequence and Phylogeny of Sl-Apaf-1
3.2. Effect of Silencing Sl-apaf-1 Expression on Act-D-Induced Apoptosis
3.3. Sl-Apaf-1 Overexpression Promoted Apoptosis
3.4. Sl-Apaf-1 Activation of Caspase-5—Caspase-1 Pathway In Vitro
3.5. Interaction of Sl-Apaf-1 and Sl-Caspase-5
3.6. Sl-Apaf-1 Promotes Apoptosis in Both Insect and Mammalian Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Stteller, H. Mechanisms and genes of celluar sucid. Science 1995, 267, 1445–1449. [Google Scholar] [CrossRef] [PubMed]
- White, E. Life, death, and pursuit of apoptosis. Gene Dev. 1996, 10, 1–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singh, R.; Letai, A.; Sarosiek, K. Regulation of apoptosis in health and disease: The balancing act of BCL-2 family proteins. Nat. Rev. Mol. Cell Biol. 2019, 20, 175–193. [Google Scholar] [CrossRef] [PubMed]
- Nagata, S. Apoptosis by death factor. Cell 1997, 88, 355–365. [Google Scholar] [CrossRef] [Green Version]
- Krammer, P.H. CD95’s deadly mission in the immune system. Nature 2000, 407, 789–795. [Google Scholar] [CrossRef]
- Strasser, A.; Jost, P.J.; Nagata, S. The many roles of FAS receptor signaling in the immune system. Immunity 2009, 30, 180–192. [Google Scholar] [CrossRef] [Green Version]
- Qin, H.; Srinivasula, S.M.; Wu, G.; Fernandes-Alnemri, T.; Alnemri, E.S.; Shi, Y. Structural basis of procaspase-9 recruitment by the apoptotic protease-activating factor 1. Nature 1999, 399, 547–555. [Google Scholar] [CrossRef]
- Raducka-Jaszul, O.; Bogusławska, D.M.; Jędruchniewicz, N.; Sikorski, A.F. Role of extrinsic apoptotic signaling pathway during definitive erythropoiesis in normal patients and in patients with beta-Thalassemia. Int. J. Mol. Sci. 2020, 21, 3325. [Google Scholar] [CrossRef]
- Zou, H.; Henzel, W.J.; Liu, X.; Lutschg, A.; Wang, X. Apaf-1, a human protein homologous to C. elegans Ced-4, participates in cytochrome c dependent activation of caspase-3. Cell 1997, 90, 405–413. [Google Scholar] [CrossRef] [Green Version]
- Yuan, S.; Akey, C.W. Apoptosome structure, assembly, and procaspase activation. Structure 2013, 21, 501–515. [Google Scholar] [CrossRef] [Green Version]
- Yadav, N.; Gogada, R.; O’Malley, J.; Gundampati, R.K.; Jayanthi, S.; Hashmi, S.; Lella, R.; Zhang, D.; Wang, J.; Kumar, R.; et al. Molecular insights on cytochrome c and nucleotide regulation of apoptosome function and its implication in cancer. Biochim. Biophys. Acta Mol. Cell Res. 2020, 1867, 118573. [Google Scholar] [CrossRef] [PubMed]
- Hu, Q.; Wu, D.; Chen, W.; Yan, Z.; Shi, Y. Proteolytic processing of the caspase-9 zymogen is required for apoptosome-mediated activation of caspase-9. J. Biol. Chem. 2013, 288, 15142–15147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.N.; Zhou, M.Y.; Hu, Q.; Bai, X.C.; Huang, W.Y.; Scheres, S.; Shi, Y.G. Mechanistic insights into caspase-9 activation by the structure of the apoptosome holoenzyme. Proc. Natl. Acad. Sci. USA 2017, 114, 1542–1547. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, L.J.; Huang, J.F.; Chen, F.; Yu, Z.Y.; Wu, Z.L.; Wu, G. Identifications of cytochrome c and Apaf-1 and their mRNA expressions under heat stress in insecticide-susceptible and -resistant Plutella xylostella (Lepidoptera: Plutellidae). Eur. J. Entomol. 2014, 111, 457–468. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.Y.; Ding, X.Y.; Chen, Q.Y.; Zhang, K.X.; Zhao, C.X.; Tang, X.D.; Wu, Y.C.; Li, M.E. Bmapaf-1 is involved in the response against BmNPV infection by the mitochondrial apoptosis pathway. Insects 2020, 11, 647. [Google Scholar] [CrossRef]
- Hamajima, R.; Iwamoto, A.; Tomizaki, M.; Suganuma, I.; Kitaguchi, K.; Kobayashi, M.; Yamada, H.; Ikeda, M. Functional analysis of inhibitor of apoptosis of the silkworm Bombyx mori. Insect Biochem. Mol. Biol. 2016, 79, 97–107. [Google Scholar] [CrossRef]
- Kumarswamy, R.; Seth, R.K.; Dwarakanath, B.S.; Chandna, S. Mitochondrial regulation of insect cell apoptosis: Evidence for permeability transition pore-independent cytochrome-c release in the Lepidopteran Sf9 cells. Int. J. Biochem. Cell Biol. 2009, 41, 1430–1440. [Google Scholar] [CrossRef]
- Clavier, A.; Rincheval-Arnold, A.; Colin, J.; Mignotte, B.; Guénal, I. Apoptosis in Drosophila: Which role for mitochondria? Apoptosis 2016, 21, 239–251. [Google Scholar] [CrossRef]
- Ren, X.; Zhang, L.; Zhang, Y.; Mao, L.; Jiang, H. Mitochondria response to camptothecin and hydroxycamptothecine-induced apoptosis in Spodoptera exigua cells. Pestic. Biochem. Physiol. 2017, 140, 97–104. [Google Scholar] [CrossRef]
- Athar, M. Baculoviral p35 inhibits oxidant-induced activation of mitochondrial apoptotic pathway. Biochem. Biophy. Res. Commun. 2003, 307, 483–490. [Google Scholar]
- Mohan, M.; Taneja, T.K.; Sahdev, S.; Mohareer, K.; Begum, R.; Athar, M.; Sah, N.K.; Hasnain, S.E. Antioxidants prevent UV-induced apoptosis by inhibiting mitochondrial cytochrome-c release and caspase activation in Spodoptera frugiperd (Sf9) cells. Cell Biol. Int. 2003, 27, 483–490. [Google Scholar] [CrossRef]
- Xiu, M.H.; Peng, J.X.; Hong, H.Z. Mitochondrial response and calcium ion change in apoptotic insect cells induced by SfaMNPV. Chinese Sci. Bull. 2005, 50, 1191–1198. [Google Scholar] [CrossRef]
- Liu, L.; Peng, J.; Liu, K.; Yang, H.; Hong, H. Influence of cytochrome c on apoptosis induced by Anagrapha (Syngrapha) falcifera multiple nuclear polyhedrosis virus (AfMNPV) in insect Spodoptera litura cells. Cell Biol. Int. 2007, 31, 996–1001. [Google Scholar] [CrossRef] [PubMed]
- Shan, S.; Liu, K.; Peng, J.; Yao, H.; Li, Y.; Hong, H. Mitochondria are involved in apoptosis induced by ultraviolet radiation in lepidopteran Spodoptera litura cell line. Insect Sci. 2009, 16, 485–491. [Google Scholar] [CrossRef]
- Huang, J.; Tian, M.; Lv, C.; Li, H.; Muhammad, R.; Zhong, G. Preliminary studies on induction of apoptosis by abamectin in Spodoptera frugiperda (Sf9) cell line. Pestic. Biochem. Physiol. 2011, 100, 256–263. [Google Scholar] [CrossRef]
- Liu, K.; Shu, D.; Song, N.; Gai, Z.; Yuan, Y.; Li, J.; Li, M.; Guo, S.; Peng, J.; Hong, H. The role of cytochrome c on apoptosis induced by Anagrapha falcifera multiple nuclear polyhedrosis virus in insect Spodoptera litura cells. PLoS ONE 2012, 7, e40877. [Google Scholar] [CrossRef] [Green Version]
- Zoog, S.J.; Schiller, J.J.; Wetter, J.A.; Chejanovsky, N.; Friesen, P.D. Baculovirus apoptotic suppressor P49 is a substrate inhibitor of initiator caspases resistant to P35 in vivo. Embo. J. 2002, 21, 5130–5140. [Google Scholar] [CrossRef] [Green Version]
- Liu, Q.; Qi, Y.; Chejanovsky, N. Spodoptera littoralis caspase-1, a Lepidopteran effector caspase inducible by apoptotic signaling. Apoptosis 2005, 10, 787–795. [Google Scholar] [CrossRef]
- Huang, N.; Civciristov, S.; Hawkins, C.J.; Clem, R.J. SfDronc, an initiator caspase involved in apoptosis in the fall armyworm Spodoptera frugiperda. Insect Biochem. Mol. Biol. 2013, 43, 444–454. [Google Scholar] [CrossRef] [Green Version]
- Yang, J.; Yan, R.; Roy, A.; Xu, D.; Poisson, J.; Zhang, Y. The I-TASSER Suite: Protein structure and function prediction. Nat. Methods 2015, 12, 7–8. [Google Scholar] [CrossRef] [Green Version]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, Y.; Yuan, M.; Gao, X.; Kang, T.; Zhan, S.; Wan, H.; Li, J. Identification and validation of reference genes for gene expression analysis using quantitative PCR in Spodoptera litura (Lepidoptera: Noctuidae). PLoS ONE 2013, 8, e68059. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Y.Q.; Liu, J.J.; Yuan, B.; Cao, C.L.; Qin, S.; Cao, X.Y.; Bian, G.K.; Wang, Z.; Jiang, J.H. Methylated actinomycin D, a novel actinomycin D analog induces apoptosis in HepG2 cells through Fas- and mitochondria-mediated pathways. Mol. Carcinog. 2013, 52, 983–996. [Google Scholar] [CrossRef] [PubMed]
- Kumarswamy, R.; Chandna, S. Inhibition of microRNA-14 contributes to actinomycin-D-induced apoptosis in the Sf9 insect cell line. Cell Biol. Int. 2010, 34, 851–857. [Google Scholar] [CrossRef]
- Yu, X.; Wang, L.; Acehan, D.; Wang, X.; Akey, C. Three-dimensional structure of a double apoptosome formed by the Drosophila Apaf-1 related killer. J. Mol. Biol. 2006, 355, 577–589. [Google Scholar] [CrossRef]
- Mills, K.; Daish, T.; Harvey, K.F.; Pfleger, C.M.; Hariharan, I.K.; Kumar, S. The Drosophila melanogaster Apaf-1 homologue ARK is required for most, but not all, programmed cell death. J. Cell Biol. 2006, 172, 809–815. [Google Scholar] [CrossRef] [Green Version]
- Srivastava, M.; Sherr, H.; Luckey, M.; Xu, D.; Chen, Z.; Lu, J.; Bergmann, A. ARK, the Apaf-1 related killer in Drosophila, requires diverse domains for its apoptotic activity. Cell Death Differ. 2007, 14, 92–102. [Google Scholar] [CrossRef]
- Pang, Y.; Bai, X.; Yan, C.; Hao, Q.; Chen, Z.; Wang, J.; Scheres, S.; Shi, Y. Structure of the apoptosome: Mechanistic insights into activation of an initiator caspase from Drosophila. Genes Dev. 2015, 29, 277–287. [Google Scholar] [CrossRef] [Green Version]
- Shiozaki, E.N.; Chai, J.J.; Shi, Y.G. Oligomerization and activation of caspase-9, induced by Apaf-1 CARD. Proc. Natl. Acad. Sci. USA 2002, 99, 4197–4202. [Google Scholar] [CrossRef] [Green Version]
- Suganuma, i.; Ushiyama, T.; Yamada, H.; Iwamoto, A.; Kobayashi, M.; Ikeda, M. Cloning and characterization of a dronc homologue in the silkworm, Bombyx mori. Insect Biochem. Mol. Biol. 2011, 41, 909–921. [Google Scholar] [CrossRef]
- Kitaguchi, K.; Hamajima, R.; Yamada, H.; Kobayashi, M.; Ikeda, M. Cloning and functional characterization of the Lymantria dispar initiator caspase dronc. Biochem. Biophy. Res. Commun. 2013, 436, 331–337. [Google Scholar] [CrossRef] [PubMed]
Application | Gene | Sequences (5′–3′) |
---|---|---|
qPCR | ||
Sl-apaf-1 | ACGATGAACTGTTTGCGAAGC | |
ATTTCTCCCAAAGCCACCC | ||
Sl-GADPH | GCCACCACCGCTACCCAGAA | |
GGAACACGGAAAGCCATAC | ||
Protein expression | ||
Sl-Af88 | CCGCATATGGACAAGCACAAAAGGCTACTC | |
TAGCTCGAGAGCCAATTTCTCCCAAAGCCAC | ||
Sl-Af627 | CCGCATATGGACAAGCACAAAAGGCTACTC | |
CTGGCGGCCGCTTCATCTACGTTTTGTTCATGC | ||
Sl-apaf-1 | AATCTCGAGCCACCATGGACAAGCACAAAAGGCTAC | |
AATGGATCCGTGTTATTCGAGCGCATAACGTTC | ||
Caspase-1 | AGCCATATGGCGGACGGAAAACAAGAC | |
TGTCTCGAGCTTTTTACCAAACACAAG | ||
Caspase-5 | GAACCATATGCAAAGAGAACACAGGGATG | |
CAGGAATTCACTCGTAGAGACCGGGG | ||
Caspase-5 (CARD) | GAACCATATGCAAAGAGAACACAGGGATG | |
TCACTCGAGAACGGCAGGAGGAGGTGGTGTAG |
siRNA | Sequences (5′–3′) |
---|---|
Control | UUCUCCGAACGUGUCACGUTT |
ACGUGACACGUUCGGAGAATT | |
siRNA_1 | GGAUGUUAUCGAAGAAGAATT |
UUCUUCUUCGAUAACAUCCTT | |
siRNA_2 | GCUUCAUACAUCUCACAAATT |
UUUGUGAGAUGUAUGAAGCTT | |
siRNA_3 | GGGCGUCAUUACAGUUGAATT |
UUCAACUGUAAUGACGCCCTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, H.; Yan, X.; Yan, L.; Zhao, J.; Song, J.; Peng, R.; Yang, Y.; Peng, J.; Liu, K. Identification and Functional Analysis of Apoptotic Protease Activating Factor-1 (Apaf-1) from Spodoptera litura. Insects 2021, 12, 64. https://doi.org/10.3390/insects12010064
Ma H, Yan X, Yan L, Zhao J, Song J, Peng R, Yang Y, Peng J, Liu K. Identification and Functional Analysis of Apoptotic Protease Activating Factor-1 (Apaf-1) from Spodoptera litura. Insects. 2021; 12(1):64. https://doi.org/10.3390/insects12010064
Chicago/Turabian StyleMa, Haihao, Xiumei Yan, Lin Yan, Jingyan Zhao, Jiping Song, Rong Peng, Yongbo Yang, Jianxin Peng, and Kaiyu Liu. 2021. "Identification and Functional Analysis of Apoptotic Protease Activating Factor-1 (Apaf-1) from Spodoptera litura" Insects 12, no. 1: 64. https://doi.org/10.3390/insects12010064