Next Article in Journal
Organic Mulch Increases Insect Herbivory by the Flea Beetle Species, Disonycha glabrata, on Amaranthus spp.
Next Article in Special Issue
Volatile Organic Compounds from Entomopathogenic and Nematophagous Fungi, Repel Banana Black Weevil (Cosmopolites sordidus)
Previous Article in Journal
Phylogeny of the Subtribe Monoctonina (Hymenoptera, Braconidae, Aphidiinae)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

First Report of Aleurocanthus spiniferus on Ailanthus altissima: Profiling of the Insect Microbiome and MicroRNAs

by
Giovanni Bubici
1,*,
Maria Isabella Prigigallo
1,
Francesca Garganese
2,
Francesco Nugnes
3,
Maurice Jansen
4 and
Francesco Porcelli
2
1
Istituto per la Protezione Sostenibile delle Piante, Consiglio Nazionale delle Ricerche, via Amendola 165/A, 70126 Bari, Italy
2
Dipartimento di Scienze del Suolo, della Pianta e degli Alimenti, Università degli Studi di Bari Aldo Moro, via Amendola 165/A, 70126 Bari, Italy
3
Istituto per la Protezione Sostenibile delle Piante, Consiglio Nazionale delle Ricerche, via Università 133, 80055 Portici, Italy
4
Ministry of Agriculture, Nature and Food Quality, Laboratories Division, Netherlands Food and Consumer Product Safety Authority (NVWA), Geertjesweg 15, 6706 EA Wageningen, The Netherlands
*
Author to whom correspondence should be addressed.
Insects 2020, 11(3), 161; https://doi.org/10.3390/insects11030161
Submission received: 23 January 2020 / Revised: 20 February 2020 / Accepted: 27 February 2020 / Published: 3 March 2020

Abstract

We report the first occurrence of the orange spiny whitefly (Aleurocanthus spiniferus; OSW) on the tree of heaven (Ailanthus altissima) in Bari, Apulia region, Italy. After our first observation in 2016, the infestation recurred regularly during the following years and expanded to the neighboring trees. Since then, we have also found the insect on numerous patches of the tree of heaven and other plant species in the Bari province. Nevertheless, the tree of heaven was not particularly threatened by the insect, so that a possible contribution by OSW for the control of such an invasive plant cannot be hypothesized hitherto. This work was also aimed at profiling the microbiome of OSW feeding on A. altissima. For this purpose, we used the denaturing gradient gel electrophoresis (DGGE) and the deep sequencing of small RNAs (sRNAs). Both techniques unveiled the presence of “Candidatus Portiera” (primary endosymbiont), Wolbachia sp. and Rickettsia sp., endosymbionts already reported for other Aleyrodidae. Deep sequencing data were analyzed by four computational pipelines in order to understand the reliability of the detection of fungi, bacteria, and viruses: Kraken, Kaiju, Velvet, and VelvetOptimiser. Some contigs assembled by Velvet or VelvetOptimiser were associated with insects, but not necessarily in the Aleurocanthus genus or Aleyrodidae family, suggesting the non-specificity of sRNAs or possible traces of parasitoids in the sample (e.g., Eretmocerus sp.). Finally, deep sequencing data were used to describe the microtranscriptome of OSW: 56 canonical and at least four high-confidence novel microRNAs (miRNAs) were identified. The overall miRNA abundance in OSW was in agreement with previous works on Bemisia tabaci, and bantam-3p, miR-276a-3p, miR-317-3p, miR-750-3p, and mir-8-3p were the most represented miRNAs.

1. Introduction

The orange spiny whitefly (OSW), Aleurocanthus spiniferus (Quaintance, 1903) originated in tropical Asia and has spread to Africa, Australia, and the Pacific Islands. In Europe, it was reported for the first time in Italy [1], and it is spreading all over the Mediterranean Countries [2,3]. Aleurocanthus Quaintance and Baker is a paleotropical genus, currently including about 80 described species [4]. OSW is listed as a quarantine pest in Europe and it is now included in the EU Annex II/A1 (from December 2020 it will be included in EU 2016/2031 Annex II/part B) as well as in the EPPO A2 list [5]. It has been reported to infest about 90 plant species of 38 plant botanical families [6]. Citrus spp. L. are the main economically important hosts, and grapes (Vitis vinifera L.), guavas (Psidium guajava L.), pears (Pyrus spp. L.), persimmons (Diospyros kaki L. f.), and roses (Rosa spp. L.) are commonly infested as well [6,7].
The tree of heaven [Ailanthus altissima (Mill.) Swingle] is a deciduous tree in the family Simaroubaceae, native to China and Taiwan (http://www.plantsoftheworldonline.org). The tree grows rapidly, has a remarkable suckering ability, and suppresses competition with allelopathic chemicals that make it a noxious weed and vigorous invasive species in Australia, the United States of America, New Zealand, and Europe [8]. In several European countries, it is officially regulated or listed as an invasive alien plant [9]. A number of pathogens and pests have been reported on A. altissima: 46 phytophagous arthropods, 16 fungi, and one potyvirus have been reported from its native areal, China, whereas nine insect herbivores and 68 fungi have been reported from North America, Europe, and Asia. However, only a few of them have been considered as major threats, e.g., Verticillium albo-atrum Reinke and Berthold, V. nonalfalfae Inderbitzin et al. [10,11], Lycorma delicatula (White) (Hemiptera: Fulgoridae) [9], two weevils, Eucryptorrhynchus brandti (Harold) and E. chinensis Olivier (Coleoptera: Curculionidae), and two lepidopteran species, Samia cynthia Drury (Lepidoptera: Saturnidae) and Eligma narcissus Cramer (Lepidoptera: Nolidae) [12]. Due to the damage caused on the tree, these pests have gained much attention for the evaluation of their potential in the biological control of the tree of heaven [12,13].
In July 2016, we observed a heavy insect infestation on a few trees of heaven located in the university campus of Bari, Apulia region, Italy (Figure 1). The insect was identified as OSW (Hemiptera: Aleyrodidae) according to Porcelli [1] and Jansen and Porcelli [4]. Very likely, the insect moved or was driven to the trees of heaven from the neighboring citrus trees, which are among their main hosts [6]. Ailanthus altissima infested shoots showed growth stunting with chlorotic leaves, which developed necrotic areas and eventually shed prematurely in the early summer. The insect demes were covered by plenty of honeydew drops. The infestation recurred regularly and expanded during the following years across the Bari province but with lower population densities in comparison with the first observed.
It is known that Aleyrodidae species harbor endocytobiont Bacteroides playing fundamental roles for their fitness. Also, it has been demonstrated that endosymbionts can both protect their host against enemies (i.e., parasitoids, other bacteria, and viruses) and influence some biological traits (e.g., fitness, sex ratio, and host range) usually ameliorating the growth rate of the host under certain stress conditions [14,15]. Although OSW has a wide host range, we hypothesized that shifting to a new host, A. altissima, could be also associated with some extent to a new assembly of endosymbionts.
Therefore, we aimed at describing the microbiome of that OSW population and, for this purpose, we carried out the deep sequencing of small RNAs (sRNAs), which allowed us to identify in one assay bacteria, fungi, viruses, and insects associated with OSW. In fact, sRNAs are produced in all these organisms [16], thus they can be used to track their presence in a microbiome. In addition, sRNA-Seq allows the identification and quantification of microRNAs (miRNAs), a class of non-coding RNA molecules (ca. 18–24 nucleotides or nt) found in plants, animals and some viruses, that functions in RNA silencing and post-transcriptional regulation of gene expression [17].
The RNA sequencing has not been used so far in insects to detect at the same time both microorganisms and viruses, but several other techniques, including the polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) [18,19,20,21] and the next-generation sequencing (NGS) [22,23,24,25,26,27,28], have been adopted to investigate particular taxa.
In this work, we documented the first occurrence of OSW on A. altissima and used sRNA deep sequencing to obtain the microbiome profile and sRNA transcriptome.

2. Materials and Methods

2.1. Insect Identification

OSW puparia were collected yearly since July 2016 from diverse host plants, including the tree of heaven, in the Bari province. More than one hundred puparia were slide-mounted after discarding the layering previous instar exuvia [29]. The slide mounting procedure (https://zenodo.org/record/3471649#.Xk1cr2hKhPY) made the puparia cuticle clear enough to discriminate relevant details. Thus, the mounted puparia were scrutinized and identified using a compound light microscope to study taxonomic characters [1,4].

2.2. Denaturing Gradient Gel Electrophoresis (DGGE)

Before DNA extraction, 10 single specimens of OSW infesting A. altissima were surface sterilized in 70% ethanol and rinsed three times in sterile distilled water. DNA was extracted with a slight modification of the protocol described by Gebiola et al. [30], where specimens were homogenized with a sterile pestle directly in the extraction buffer (Chelex 100 + pK). The V3 hypervariable region of 16S rDNA was amplified by PCR [31,32] and the products were analyzed by a slight modification of the DGGE technique described by Muyzer et al. [33] using a 40%–65% denaturing gradient (90 V for 20 h). Known endosymbionts such as Wolbachia Hertig from Encarsia formosa Gahan, Cardinium Zchori-Fein et al. from Encarsia pergandiella Howard, Rickettsia da Rocha-Lima from Pnigalio soemius (Walker), Spiroplasma Saglio et al. from Drosophila neotestacea Grimaldi, James and Jaenike, and Arsenophonus Gherna et al. from Bemisia tabaci (Gennadius) were used as positive controls. All dominant DGGE bands were excised, eluted, used as templates for PCR with the primers 341f/518r, and directly sequenced. Obtained sequences were blasted against the GenBank database.

2.3. Deep Sequencing of Small RNAs

Total RNA was extracted from 100 mg of OSW puparia using TRIzol™ (Thermo Fisher Scientific, Bedford, MA, USA), according to the manufacturer’s instructions, subjected to DNase digestion using TURBO DNA-free™ Kit (Thermo Fisher Scientific, Bedford, MA, USA), and suspended in nuclease-free water. OSW puparia were rinsed three times in sterile distilled water before RNA extraction. One microgram RNA was sent to IGA Technology Services (Udine, Italy) for library preparation and sequencing. The TruSeq Small RNA Library Prep Kit (Illumina, San Diego, CA, USA) was used for library construction, and 50 bp reads were sequenced on HiSeq 2500 system (Illumina, San Diego, CA, USA) in single-end mode.
The sequencing raw reads were subjected to adapter removal, quality control and filtering using FASTX-toolkit version 0.1 [34], FASTQC version 0.72+ (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/), and Filter FASTQ tool version 1.1.1 [35], respectively, in order to obtain high-quality reads of 15–35 nt to be used for the downstream analysis. These steps were performed within a locally-installed Galaxy version 19.01 [36].

2.4. NGS Data Analysis

2.4.1. Microbiomics

High-quality sequencing reads of 15–35 nt were used to infer the complete microbiome of OSW, i.e., the presence of reads associated with insects, fungi, bacteria, and viruses. Since the taxonomic assignment of sequencing reads might be affected by the bioinformatics approach, including the reference database, we used four computational pipelines and compared their results: Kraken, Kaiju, Velvet, and VelvetOptimiser (the latter two tools were followed by a blastn search). Kraken is a taxonomic sequence classifier that assigns taxonomic labels to short DNA reads [37]. We subjected the high-quality sequencing reads to version 1.2.4 of this tool within the public Galaxy server (https://usegalaxy.org/), where it utilizes databases for bacteria, fungi or plasmids. Kaiju is a web-based program (http://kaiju.binf.ku.dk/) for taxonomic classification of sequencing reads from metagenomic whole genome sequencing or metatranscriptomics experiments [38]. We used version 1.7.2. with default parameters and the NCBI nr database including non-redundant proteins of bacteria, archaea, viruses, fungi, and microbial eukaryotes. Velvet 1.2.10.0 was used to assemble reads into contigs with a hash length of 21 [39]. The hash length value affects the number and length of contigs finally obtained: smaller hash lengths yield more contigs, but shorter in size, whereas higher hash lengths yield fewer contigs, but longer. VelvetOptimiser assembles reads using a range of hash length values in order to maximize the contig length, contig number, N50 value or other parameters as specified by the user [40]. We used this tool with a range of hash length between 19 and 31. Contigs assembled with Velvet or VelvetOptimiser were then used as queries for the search against NCBI BLAST nucleotide collection database (nr/nt) using the blastn algorithm on the web service. Only BLAST hits with more than 95% sequence similarity and e-value lower than 10−5 were retained.
The outputs of these four pipelines were processed with MEGAN6 for the graphical representations [41].

2.4.2. Classification of Small RNAs

In order to have an overview of the sRNA features in OSW, we carried out several analyses. Length distribution of reads was extracted from the FASTQC output, imported into Microsoft Excel Professional 2016 and used to generate histograms. This procedure was done both for redundant and non-redundant reads, the latter obtained using Collapse sequences tool version 1.0.1 [34] within the locally-installed Galaxy.
Sequencing reads were used as queries to search sequence similarities in the Rfam database, separately by RNA categories such as rRNAs, miRNAs, several classes of repetitive elements, transcripts and other Rfam families. Alignment to the B. tabaci genome using bowtie 2 with default parameters [42] was used to determine the number of reads matching the genome. B. tabaci isolate MEAM1 (assembly ASM185493v1; 19,751 scaffolds) was used because it is a species in the same family (Aleyrodidae) of OSW, which genome is not yet available. The remaining reads were considered as unassigned RNA. The number of reads associated with these features was used to generate pie charts by Microsoft Excel Professional 2016.

2.4.3. Identification of Known and Novel MicroRNAs Including IsomiRs

miRDeep2 was used to identify miRNAs in OSW [43]. As inputs to this tool, we submitted the sequencing reads and the genome of B. tabaci isolate MEAM1 (assembly ASM185493v1), without known miRNA and precursor sequences. MiRDeep2 predicts precursors and miRNAs in a genome and associates them with a 0–10 score and a randfold significance. No arbitrary threshold was used to select sequences, and all predicted miRNAs were retained. MicroRNA precursors available in miRBase (release 22.1, October, 2018) [44] were mapped to the B. tabaci genome and compared to the miRDeep2 output in order to discriminate known and novel microRNA loci. Also, mature miRNAs available in the same database were aligned with the sequences predicted by miRDeep2 using the blastn algorithm. We considered as canonical miRNAs of OSW the reads with a perfect match or sharing up to two mismatches with the sequences in the database, regardless of their length. According to the miRBase guidelines on miRNA annotation [45,46] and with the concept of miRNA isoforms (isomiRs; sequences sharing very few mismatches with a miRNA and differing in length at the 5′ and/or 3′ ends) [47], the reads with more than two mismatches were considered as novel miRNAs in OSW. We propose to prepend the prefix ‘asp’ to the canonical miRNA name in order to associate it to OSW (e.g., asp-bantam, asp-miR-276a, asp-miR-317, etc.). IDs not present among the miRBase miRNAs were used for the novel miRNAs identified in this study, similarly preceded by the ‘asp’ prefix. Per each miRNA, the mature and star sequences were identified, as well as the indication of their 5p or 3p location in the precursor. Also, genomic coordinates of the precursors were determined in the B. tabaci genome. Normalized read count was expressed as reads per million (RPM) of reads mapping to the B. tabaci genome.
miRDeep2 calculates the number of raw reads per each predicted miRNA as the sum of the mature sequence and its isomiRs. In order to distinguish between read counts of mature miRNAs and isomiRs, we used the isomiRID tool [48]. Sequencing reads, mature and star sequences of miRNAs as well as their precursor sequences were submitted to isomiRID. Only isomiRs with up to one mismatch and differing in length up to ±2 and ±5 nt at the 5′ and 3′ ends, respectively, were retained. The output was manipulated in Microsoft Excel Professional 2016 for an arbitrary numbering of isomiRs. Also, the isomiR sequences were blasted against the miRBase database to find perfect matches with mature miRNAs. In order to assess the attitude of certain miRNA loci to generate more or less isomiRs, two indices were defined: the isomiR diversity index (IDI) was the number of different isomiRs relative to the normalized read count of a miRNA, and the isomiR abundance index (IAI) was the normalized read count of all isomiRs of a miRNA (excluding the mature sequence read count) relative to the normalized read count of the same miRNA.

3. Results and Discussion

3.1. Aleurocanthus spiniferus Was Found for the First Time on Ailanthus altissima in Italy

More than 100 puparia mounted on microscope slides were scrutinized. Based on taxonomic characters, the insects were identified as A. spiniferus because the number of marginal teeth ranged from 7 to 11, the crenulation sums 205–242 teeth, the ratio of longest spines were (1:9)–(1:17), the wide fringe represented 17.3%–30% of puparia width, cephalic eye spot were weakly defined, placed closer to the third sub-marginal spines rather than to the second ones, and microscopic papillae were situated between the sub-marginal spines [1,4]. Furthermore, the morphological identification was confirmed by a molecular study recently carried out on the same OSW population infesting the tree of heaven [3].
To the best of our knowledge, this is the first report of A. spiniferus infesting A. altissima. In fact, several studies have documented a number of pathogens and pests on A. altissima, but no mention of OSW has been reported [9,10,11,12,13]. This would suggest a host shift of OSW to A. altissima, but it cannot be excluded that the insect has infested this plant at extremely low population densities for a long time and it has not been observed or documented until now. Such a probable host shift merits a detailed investigation because it would add precious information about insect biology and ethology. It could be also studied whether insect endosymbionts, known as modulators of insect fitness [14,15], are involved in the colonization of this new plant host.
Moreover, the infestation by a so aggressive insect pest on the tree of heaven could have implications in the control of this alien and invasive plant. In our inspections, the tree of heaven was not particularly threatened by OSW, even under heavy infestation levels. Therefore, a possible contribution by OSW for the control of the tree of heaven cannot be hypothesized hitherto.

3.2. “Candidatus Portiera”, Wolbachia, and Rickettsia Were Identified in the OSW Microbiome

DGGE profiles of the 16S rDNA showed three different dominant bands. All samples shared a band that could be ascribed to the Wolbachia reference, a known endosymbiont of Aleyrodidae [49] and other insect species [50]. Another band occurring in all samples had no correspondence to any employed positive controls. Furthermore, four out of ten samples showed a band corresponding to the Rickettsia reference, another endosymbiont of several insect species [51].
Sequencing and BLAST analysis confirmed that the DNA sequences obtained from the excised bands matched Rickettsia spp. and Wolbachia spp. accessions, while those obtained from the band with no correspondence to the used references matched accessions of “Candidatus Portiera” Thao and Baumann (Gammaproteobacteria) (here referred to as “Ca. Portiera”).
By using deep sequencing of sRNAs we were able to infer a more variegated microbiome composition (Figure 2). Most of the reads or contigs were unassigned to a Taxon. In fact, Kraken was able to classify only 0.28% reads, and Kaiju only 0.31%; among the 1289 contigs assembled with Velvet, only 242 were assigned to taxonomic units using a blastn search. On the other hand, 28 out of the 41 contigs assembled with VelvetOptimiser were classified by blastn.
Some microbial taxa were detected by different pipelines, while others only by one of them. Interestingly, the Aleyrodidae endosymbiont “Ca. Portiera” was identified by all the pipelines, and it was the most represented genus in three of them (except VelvetOptimiser). This bacterium is a well-known primary endosymbiont of Aleyrodidae species, including Aleurocanthus woglumi Ashby [49] and B. tabaci [14,52,53].
The Kraken tool detected considerable reads matching the Wolbachia genus. Also, the genera Rickettsia, Pseudomonas, Frateuria, and other taxa were identified by Kraken.
Kaiju identified the genera Methylobacterium Patt et al., Mycobacterium Lehmann and Neumann, and Streptomyces Waksman and Henrici among the bacteria, as well as Basidiomycota and Ascomycota (Bipolaris genus) among the fungi. Moreover, the genus Fragillariopsis (O’Meara) Hustedt (Bacillarophyceae) was also well represented. Besides Rickettsia, none of the latter microorganisms have been reported as Aleyrodidae endosymbionts. We did not find evidence for the presence of other secondary (facultative) endosymbionts of Aleyrodidae such as Hamiltonella Moran et al. [14,15,54,55] and another 14 genera [49]. Some species of the found guild of microorganisms might survive on the leaf surface, near or on the OWS; others seem frankly host-plant inhabitants that were taken by OSW during feeding and eventually concentrated in the filter chamber of the insect [56].
By using the contig-based pipelines (Velvet and VelvetOptimiser followed by blastn search), a number of sequences were assigned to Insecta, including Bemisia genus and other Aleyrodidae. No sequences were assigned to Aleurocanthus genus, probably because less represented than Bemisia or other Aleyrodidae in the databases. Remarkably, some contigs assembled by Velvet were assigned to the genus Eretmocerus Mercet (Hymenoptera), an Aleyrodidae parasitoid [57], and to the sub-order Cucujiformia (Coleoptera: Polyphaga), that encompasses plant-eating beetles and insect-predators [58].
Deep sequencing of insect sRNAs revealed that no plant-infecting viruses were present in the population of OSW hosted by the tree of heaven. When used with a virus database, Kraken detected three viral taxa: Mason-Pfizer monkey virus (M-PMV, Retroviridae; 2726 reads), Enterobacteriaceae phage phiX174 (Microviridae; 451 reads), and Herpesviridae (37 reads). Escherichia virus phiX174 was also detected by the Velvet + blastn pipeline (7 out of 242 contigs). Very likely, these hits were artifacts due to the forcing of search against viral sequences. Retroviridae (positive single-stranded RNA genome) and Herpesviridae (double-stranded DNA genome) infect vertebrates [59,60,61], but they have not been reported in insects, even after large screening surveys based on NGS [24,25,26,62]. Moreover, phiX174 (positive single-stranded DNA) is routinely used as a positive control in DNA sequencing on Illumina platforms [63].

3.3. Features of Small RNAs

After quality filtering, we obtained 10,122,023 reads that were classified as tRNA, rRNA, miRNA, repetitive element, other Rfam families, others in B. tabaci genome, and unassigned RNA (Figure 3B). About 29% of reads were tRNAs, and 41% remained unassigned, while the remaining reads were classified as rRNAs, miRNAs, repetitive elements, other Rfam elements, or other features in the B. tabaci genome. About 54% of reads (5,499,517) were mapped to the B. tabaci genome. We retained only reads with length ranging from 15 to 35 nt, and their length distribution is shown in Figure 3. Frequency peaks were observed for sRNAs of 21 and 28 nt, in agreement with previous works on B. tabaci B and Q biotypes or other insects [64,65,66]. Thirty-six percent reads between 19 and 22 nt mapped to miRNAs, while 74% of 28 nt reads were unassigned (Figure 3B). They accounted for 8% of library (Figure 4A), and 12% of the reads matching the B. tabaci genome (Figure 3B; 5,499,517). Repetitive elements, accounting for 1% of library (Figure 4A), were assigned to reads of a wide range of length, but especially to the 17–18mers (Figure 3B). The families L1-14_BDi, Gypsy-37_NVi-I, Gypsy-97_GM-I, Caulimovirus-23_ATr, and Gypsy-22_RO-I were the top-five represented transposable elements (Figure 5).

3.4. MicroRNAs

Using the B. tabaci genome and miRBase database, the miRDeep2 tool identified 102 miRNAs in the OSW library. Sequence similarity analysis conducted with the blastn algorithm on these miRNAs against the miRBase database allowed us to classify the sequences into canonical (56) and novel miRNAs (46) (Table 1 and Table 2, respectively; also see Tables S1 and S2 for more details). Reads sharing up to two mismatches with the database sequences were considered as canonical OSW miRNAs and the rest as novel miRNAs. Differently, a threshold of four mismatches was used in two previous works on B. tabaci, where more miRNAs than in our research were identified [64,65,67].
Canonical miRNAs were identified in 41 out of 19,751 scaffolds of the B. tabaci genome. MicroRNA precursors were predicted by miRDeep2, and 21 of them were highly similar to those available in miRBase (e.g., dme-mir-276a, dqu-mir-317, dme-mir-184, etc.). Several miRNAs were predicted to originate from diverse precursors, either with different nt sequences or with different positions in the genome. However, we cannot conclude if all these miRNAs actually have different precursors in OSW because we used the B. tabaci genome, and even the complete assembly of this genome into chromosomes is still pending. We found that asp-miR-iab-4 and asp-miR-iab-8 originated from the minus and plus DNA strand, respectively, of the same miRNA locus (Table 1), as already reported in D. melanogaster [68,69]. A similar scenario occurred for asp-miR-134420, which originated the same miRNA/miRNA* from both DNA strands. For most canonical miRNAs, we detected both mature and star sequences (distinguished based on their counts), supporting the reliability of those miRNAs in OSW according to the miRBase guidelines [45,46].
Among the 46 novel miRNAs detected by miRDeep2, at least four miRNAs (asp-miR-111690, asp-miR-131950, asp-miR-73390, and asp-miR-131930p; Table 2) had a high score (>10), significant randfold p-value, high abundance, and/or an expressed star sequence, indicating their high confidence. Moreover, miRNAs such as asp-miR-131930-5p and asp-miR-129380-3p had isomiRs matching perfectly dme-miR-12-5p and dme-miR-981-3p, respectively (data not shown), that were also found as mature miRNAs in previous works [64,65]. Very likely, the remaining novel miRNAs detected by miRDeep2 should be considered with low confidence, and they would need further confirmation.
As expected, most known OSW miRNAs were orthologous of miRNAs previously described in other arthropods (Table S1). In fact, by analyzing miRNAs of three hemimetabolan (Blattella germanica L., Locusta migratoria L., and Acyrthosiphon pisum Harris) and four holometabolan species [Apis mellifera L., Tribolium castaneum (Herbst), Bombyx mori L., and D. melanogaster Meigen], Ylla and coworkers [70] concluded that insects share a conserved microRNA toolkit of 65 families exhibiting very low variation. The asp-bantam-3p, asp-miR-276a-3p, asp-miR-317-3p, asp-miR-750-3p, and asp-mir-8-3p were the top-five miRNAs for abundance in the sampled OSW (3–116 thousand RPM for the mature sequence and its isomiRs), and asp-miR-3049-3p, asp-miR-2796-3p, asp-miR-965-3p, asp-miR-iab-4-5p, and asp-miR-iab-8-3p the less represented (0.4–16 RPM for the mature sequence and its isomiRs). The abundance of these miRNAs was in agreement with miRBase (that reports, for example, 5 × 104 RPM of dme-bantam as an average of 49 experiments; we observed 1 × 103 RPM) and with previous observations in B. tabaci [64,65], confirming their conserved (though multiple) functions in related species.
MicroRNA bantam promotes cell proliferation, inhibits apoptosis, maintains germline stem cells, limits scaling growth of dendrites, and regulates circadian rhythm clock [66,71,72]. MicroRNA miR-8 prevents neurodegeneration in the brain, is involved in the development of wings and eyes, promotes organismal growth in larvae, and controls the morphology of neuromuscular junctions [71]. MicroRNA miR-317 is critical for Drosophila survival, as it is a negative regulator of Drosophila Toll signaling immune response [73]. MicroRNA miR-750 is a cluster conserved in several hemimetabolan and holometabolan insects but lost in D. melanogaster [70]. It was the most abundant miRNA in silkworm infected by Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) [67]. MicroRNA miR-276-5p fine-tunes the duration of the reproductive cycle in Anopheles [74] and promotes egg-hatching synchrony in L. migratoria [75]. Overall low expression of miRNAs, however, does not mean that they are of minor importance in the metabolism. MicroRNA mir-iab-4, for example, causes a dominant homeotic transformation of halteres to wings in D. melanogaster [76]. We found only 4.7 RPM of asp-miR-iab-4-5p, and miRBase reports 438 RPM as an average of 45 experiments for dme-miR-iab-4-5p. The abundance of some OSW miRNAs deviated from the general trend occurring in other insects. For example, let-7 had an intermediate abundance in OSW (745.2 RPM for the mature sequence) but was highly expressed in B. tabaci (1–2 × 105) and induced by TYLCCNV infection [64,65]. MicroRNA let-7-5p, along with miR-100-5p and miR-125-5p, emerged as an important factor in the metamorphic stage of B. germanica [77].
The tool miRDeep2 counts both the mature sequence and its isomiRs for each detected miRNA and miRNA star. In order to count separately the mature sequences and the isomiRs, we used the tool isomiRID and then extracted the counts from its output. Due to their abundance, isomiRs appeared particularly important to assess the expression level of a miRNA. For example, asp-bantam, which was the most abundant miRNA in the OSW library, accounted for 115,692.2 RPM (isomiRID count, Table S4), resulting from 33,695 RPM of mature miRNA and 79,930.3 RPM of isomiRs (606 different sequences). The isomiR diversity index (IDI), here defined as the number of different isomiR sequences relative to the mature miRNA count, decreased with the expression level of miRNAs, meaning that highly abundant miRNAs had a smaller number of different isomiRs (Figure S1). However, such a correlation was not strong (R2 = 0.42), so that miRNAs like asp-miR-2a-3p had 281.9 RPM of mature miRNAs and 181 different isomiRs (IDI = 0.64), while miRNAs like asp-miR-87a-3p had 240.57 RPM of mature miRNA and 31 isomiR sequences (IDI = 0.13). The isomiR abundance index (IAI), here defined as the total isomiR count relative to the mature miRNA count, did not depend on the miRNA abundance. In fact, miRNAs with similar abundance such as the two above-mentioned miRNAs asp-miR-2a-3p and asp-miR-87a-3p had a different IAI (1249.29 and 114.16 RPM of isomiRs, respectively, corresponding to IDIs of 4.43 and 0.47). In contrast, miRNAs with largely different expression levels such as asp-miR-317-3p (811.34 RPM of mature miRNA) and asp-miR-305-5p (99.1 RPM) had similar IDIs, i.e., 3.81 and 3.67, respectively.
By analyzing the isomiRs, we observed that A to C substitution was the most abundant occurrence (data not shown), which is not in line with Naqvi et al. [78], who found that most of the substitutions comprised A to G and C to T events.

4. Conclusions

We report the first documented stable infestation of A. altissima by OSW in Italy, which very likely originated from the neighboring citrus trees, the main host plants of OSW. A possible contribution by OSW for the control of the tree of heaven cannot be hypothesized hitherto because, in our observations, the plant tolerated well the OSW infestation.
By using DGGE and sRNA deep sequencing, we provide sound evidence on the presence of the primary endosymbiont “Ca. Portiera” and other endosymbionts such as Wolbachia spp. and Rickettsia spp. For the first time, we used sRNA-Seq to profile an insect microbiome and paved the way to compare this technique with the most widely used metagenomics approaches. Moreover, further investigations are needed to assess whether endosymbionts play a role in the interaction between OSW and the tree of heaven and whether the OSW microbiome can be harnessed to develop new management strategies against either the OSW or the tree of heaven.
Finally, we identified 56 canonical and 46 novel miRNAs in OSW, the latter group including at least four miRNAs detected with a high confidence level.

Supplementary Materials

The following are available online at https://www.mdpi.com/2075-4450/11/3/161/s1, Figure S1: Relationships between mature miRNAs and isomiRs of Aleurocanthus spiniferus. The isomiR diversity index is defined as the number of different isomiR sequences relative to the mature miRNA count (RPM). The isomiR abundance index is defined as the total isomiR count relative to the mature miRNA count (RPM). Table S1: Canonical miRNAs detected by miRDeep2 tool using Aleurocanthus spiniferus small RNA reads, Bemisia tabaci genome, and miRBase database. Table S2: Novel miRNAs (more than two mismatches shared with miRBase sequences) detected by miRDeep2 tool using Aleurocanthus spiniferus small RNA reads, Bemisia tabaci genome, and miRBase 22 database. Table S3: List and read count of mature miRNAs and isomiRs of Aleurocanthus spiniferus. Table S4: Overview of the isomiRs associated with the miRNAs of Aleurocanthus spiniferus.

Author Contributions

G.B. found the insect infestation, analyzed the data, and wrote the manuscript. F.P. and M.J. identified the insect species based on the morphological traits. G.B. and F.P. conceived the study. M.I.P. and F.G. collected the insects, handled them in the laboratory, and extracted the RNA. F.N. collected the insects and performed the PCR-DGGE assay. All the authors revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Apulia Region grant number CoBIAs/AGG2016 “Controllo biologico per incremento contro A. spiniferus”.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Porcelli, F. First record of Aleurocanthus spiniferus (Homoptera: Aleyrodidae) in Apulia, Southern Italy. EPPO Bull. 2008, 38, 516–518. [Google Scholar] [CrossRef]
  2. Kapantaidaki, D.E.; Antonatos, S.; Kontodimas, D.; Milonas, P.; Papachristos, D.P. Presence of the invasive whitefly Aleurocanthus spiniferus (Hemiptera: Aleyrodidae) in Greece. EPPO Bull. 2019, 49, 127–131. [Google Scholar] [CrossRef]
  3. Nugnes, F.; Laudonia, S.; Jesu, G.; Jansen, M.G.M.; Porcelli, F.; Bernardo, U. Aleurocanthus spiniferus (Hemiptera: Aleyrodidae) in Europe: Diffusion, hosts, molecular characterization, and its natural enemies. Insects 2020, 11, 42. [Google Scholar] [CrossRef] [PubMed]
  4. Jansen, M.; Porcelli, F. Aleurocanthus camelliae (Hemiptera: Aleyrodidae), a species possibly new for the European fauna of a genus in great need of revision. Tijdschr. Entomol. 2018, 161, 63–78. [Google Scholar] [CrossRef]
  5. EPPO. EPPO Global Database. Aleurocanthus spiniferus (ALECSN). Available online: https://gd.eppo.int/taxon/ALECSN (accessed on 23 October 2019).
  6. Cioffi, M.; Cornara, D.; Corrado, I.; Jansen, M.G.M.; Porcelli, F. The status of Aleurocanthus spiniferus from its unwanted introduction in Italy to date. B. Insectol. 2013, 66, 273–281. [Google Scholar]
  7. EFSA; Bragard, C.; Dehnen-Schmutz, K.; Di Serio, F.; Gonthier, P.; Jacques, M.-A.; Jaques Miret, J.A.; Justesen, A.F.; Magnusson, C.S.; Milonas, P.; et al. Pest categorisation of Aleurocanthus spp. EFSA J. 2018, 16, e05436. [Google Scholar] [CrossRef]
  8. CABI. Invasive Species Compendium. Ailanthus altissima. Datasheet 3889. Available online: https://www.cabi.org/isc/datasheet/3889 (accessed on 23 October 2019).
  9. EPPO. EPPO Global Database. Ailanthus altissima (AILAL). Available online: https://gd.eppo.int/taxon/AILAL (accessed on 23 October 2019).
  10. Maschek, O.; Halmschlager, E. Effects of Verticillium nonalfalfae on Ailanthus altissima and associated indigenous and invasive tree species in eastern Austria. Eur. J. For. Res. 2018, 137, 197–209. [Google Scholar] [CrossRef]
  11. Schall, M.J.; Davis, D.D. Verticillium wilt of Ailanthus altissima: Susceptibility of associated tree species. Plant Dis. 2009, 93, 1158–1162. [Google Scholar] [CrossRef]
  12. Ding, J.; Wu, Y.; Zheng, H.; Fu, W.; Reardon, R.; Liu, M. Assessing potential biological control of the invasive plant, tree-of-heaven, Ailanthus altissima. Biocontrol Sci. Techn. 2006, 16. [Google Scholar] [CrossRef]
  13. O’Neal, E.S.; Davis, D.D. Biocontrol of Ailanthus altissima: Inoculation protocol and risk assessment for Verticillium nonalfalfae (Plectosphaerellaceae: Phyllachorales). Biocontrol Sci. Techn. 2015, 25, 950–969. [Google Scholar] [CrossRef]
  14. Su, Q.; Xie, W.; Wang, S.; Wu, Q.; Ghanim, M.; Zhang, Y. Location of symbionts in the whitefly Bemisia tabaci affects their densities during host development and environmental stress. PLoS ONE 2014, 9, e91802. [Google Scholar] [CrossRef] [PubMed]
  15. Su, Q.; Xie, W.; Wang, S.; Wu, Q.; Liu, B.; Fang, Y.; Xu, B.; Zhang, Y. The endosymbiont Hamiltonella increases the growth rate of its host Bemisia tabaci during periods of nutritional stress. PLoS ONE 2014, 9, e89002. [Google Scholar] [CrossRef] [PubMed]
  16. Finnegan, E.J.; Matzke, M.A. The small RNA world. J. Cell Sci. 2003, 116, 4689–4693. [Google Scholar] [CrossRef] [PubMed]
  17. Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
  18. Osimani, A.; Milanović, V.; Garofalo, C.; Cardinali, F.; Roncolini, A.; Sabbatini, R.; De Filippis, F.; Ercolini, D.; Gabucci, C.; Petruzzelli, A.; et al. Revealing the microbiota of marketed edible insects through PCR-DGGE, metagenomic sequencing and real-time PCR. Int. J. Food Microbiol. 2018, 276, 54–62. [Google Scholar] [CrossRef]
  19. Nugnes, F.; Gebiola, M.; Monti, M.M.; Gualtieri, L.; Giorgini, M.; Wang, J.; Bernardo, U. Genetic diversity of the invasive gall wasp Leptocybe invasa (Hymenoptera: Eulophidae) and of its Rickettsia endosymbiont, and associated sex-ratio differences. PLoS ONE 2015, 10, e0124660. [Google Scholar] [CrossRef]
  20. Gualtieri, L.; Nugnes, F.; Nappo, A.G.; Gebiola, M.; Bernardo, U. Life inside a gall: Closeness does not favour horizontal transmission of Rickettsia between a gall wasp and its parasitoid. FEMS Microbiol. Ecol. 2017, 93. [Google Scholar] [CrossRef]
  21. Monti, M.M.; Nugnes, F.; Gualtieri, L.; Gebiola, M.; Bernardo, U. No evidence of parthenogenesis-inducing bacteria involved in Thripoctenus javae thelytoky: An unusual finding in Chalcidoidea. Entomol. Exp. Appl. 2016, 160, 292–301. [Google Scholar] [CrossRef]
  22. Chen, B.; Yu, T.; Xie, S.; Du, K.; Liang, X.; Lan, Y.; Sun, C.; Lu, X.; Shao, Y. Comparative shotgun metagenomic data of the silkworm Bombyx mori gut microbiome. Sci. Data 2018, 5, 180285. [Google Scholar] [CrossRef]
  23. Krishnan, M.; Bharathiraja, C.; Pandiarajan, J.; Prasanna, V.A.; Rajendhran, J.; Gunasekaran, P. Insect gut microbiome - An unexploited reserve for biotechnological application. Asian Pac. J. Trop. Biomed. 2014, 4, S16–S21. [Google Scholar] [CrossRef]
  24. Malacrinò, A. Meta-omics tools in the world of insect-microorganism interactions. Biology 2018, 7, 50. [Google Scholar] [CrossRef]
  25. Liu, S.J.; Chen, Y.T.; Bonning, B.C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 2015, 8, 54–61. [Google Scholar] [CrossRef]
  26. Li, C.X.; Shi, M.; Tian, J.H.; Lin, X.D.; Kang, Y.J.; Chen, L.J.; Qin, X.C.; Xu, J.G.; Holmes, E.C.; Zhang, Y.Z. Unprecedented genomic diversity of RNA viruses in arthropods reveals the ancestry of negative-sense RNA viruses. eLlife 2015, 4, e05378. [Google Scholar] [CrossRef]
  27. Liu, S.; Vijayendran, D.; Bonning, B.C. Next generation sequencing technologies for insect virus discovery. Viruses 2011, 3, 1849–1869. [Google Scholar] [CrossRef]
  28. Wu, Q.; Luo, Y.; Lu, R.; Lau, N.; Lai, E.C.; Li, W.X.; Ding, S.W. Virus discovery by deep sequencing and assembly of virus-derived small silencing RNAs. Proc. Natl. Acad. Sci. USA 2010, 107, 1606–1611. [Google Scholar] [CrossRef] [PubMed]
  29. Porcelli, F. A Method to Slide-Mount Insects and Other Arthropods in a Water-Soluble Medium. Available online: https://zenodo.org/record/3471649#.XbiFD-hKjIU (accessed on 29 October 2019).
  30. Gebiola, M.; Bernardo, U.; Monti, M.M.; Navone, P.; Viggiani, G. Pnigalio agraules (Walker) and Pnigalio mediterraneus Ferrière and Delucchi (Hymenoptera: Eulophidae): Two closely related valid species. J. Nat. Hist. 2009, 43, 2465–2480. [Google Scholar] [CrossRef]
  31. Dar, S.A.; Kuenen, J.G.; Muyzer, G. Nested PCR-denaturing gradient gel electrophoresis approach to determine the diversity of sulfate-reducing bacteria in complex microbial communities. Appl. Environ. Microbiol. 2005, 71, 2325–2330. [Google Scholar] [CrossRef] [PubMed]
  32. Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991, 173, 697–703. [Google Scholar] [CrossRef] [PubMed]
  33. Muyzer, G.; de Waal, E.C.; Uitterlinden, A.G. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 1993, 59, 695–700. [Google Scholar] [CrossRef] [PubMed]
  34. Assaf, G. FASTQ/A short-reads pre-processing tools. Available online: http://hannonlab.cshl.edu/fastx_toolkit/ (accessed on 23 October 2019).
  35. Blankenberg, D.; Gordon, A.; Von Kuster, G.; Coraor, N.; Taylor, J.; Nekrutenko, A.; The Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics 2010, 26, 1783–1785. [Google Scholar] [CrossRef] [PubMed]
  36. Afgan, E.; Baker, D.; van den Beek, M.; Blankenberg, D.; Bouvier, D.; Čech, M.; Chilton, J.; Clements, D.; Coraor, N.; Eberhard, C.; et al. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2016 update. Nucleic Acids Res. 2018, 46, W537–W544. [Google Scholar] [CrossRef] [PubMed]
  37. Wood, D.E.; Salzberg, S.L. Kraken: Ultrafast metagenomic sequence classification using exact alignments. Genome Biol. 2014, 15, R46. [Google Scholar] [CrossRef] [PubMed]
  38. Menzel, P.; Ng, K.L.; Krogh, A. Fast and sensitive taxonomic classification for metagenomics with Kaiju. Nat. Commun. 2016, 7, 11257. [Google Scholar] [CrossRef] [PubMed]
  39. Zerbino, D.R.; Birney, E. Velvet: Algorithms for de novo short read assembly using de Bruijn graphs. Genome Res. 2008, 18, 821–829. [Google Scholar] [CrossRef]
  40. Gladman, S. VelvetOptimiser. Available online: https://github.com/slugger70/VelvetOptimiser (accessed on 23 October 2019).
  41. Huson, D.H.; Beier, S.; Flade, I.; Górska, A.; El-Hadidi, M.; Mitra, S.; Ruscheweyh, H.-J.; Tappu, R. MEGAN Community Edition—Interactive exploration and analysis of large-scale microbiome sequencing data. PLoS Comput. Biol. 2016, 12, e1004957. [Google Scholar] [CrossRef]
  42. Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357. [Google Scholar] [CrossRef]
  43. Friedländer, M.R.; Mackowiak, S.D.; Li, N.; Chen, W.; Rajewsky, N. miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic Acids Res. 2012, 40, 37–52. [Google Scholar] [CrossRef]
  44. Kozomara, A.; Birgaoanu, M.; Griffiths-Jones, S. miRBase: From microRNA sequences to function. Nucleic Acids Res. 2018, 47, D155–D162. [Google Scholar] [CrossRef]
  45. Ambros, V.; Bartel, B.; Bartel, D.P.; Burge, C.B.; Carrington, J.C.; Chen, X.M.; Dreyfuss, G.; Eddy, S.R.; Griffiths-Jones, S.; Marshall, M.; et al. A uniform system for microRNA annotation. RNA 2003, 9, 277–279. [Google Scholar] [CrossRef]
  46. Meyers, B.C.; Axtell, M.J.; Bartel, B.; Bartel, D.P.; Baulcombe, D.; Bowman, J.L.; Cao, X.; Carrington, J.C.; Chen, X.M.; Green, P.J.; et al. Criteria for annotation of plant microRNAs. Plant Cell 2008, 20, 3186–3190. [Google Scholar] [CrossRef]
  47. Morin, R.D.; O’Connor, M.D.; Griffith, M.; Kuchenbauer, F.; Delaney, A.; Prabhu, A.-L.; Zhao, Y.; McDonald, H.; Zeng, T.; Hirst, M.; et al. Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. Genome Res. 2008, 18, 610–621. [Google Scholar] [CrossRef] [PubMed]
  48. de Oliveira, L.F.; Christoff, A.P.; Margis, R. isomiRID: A framework to identify microRNA isoforms. Bioinformatics 2013, 29, 2521–2523. [Google Scholar] [CrossRef] [PubMed]
  49. Pandey, N.; Singh, A.; Rana, V.S.; Rajagopal, R. Molecular characterization and analysis of bacterial diversity in Aleurocanthus woglumi (Hemiptera: Aleyrodidae). Environ. Entomol. 2013, 42, 1257–1264. [Google Scholar] [CrossRef] [PubMed]
  50. Sinkins, S.P. Wolbachia and cytoplasmic incompatibility in mosquitoes. Insect. Biochem. Mol. Biol. 2004, 34, 723–729. [Google Scholar] [CrossRef]
  51. Weinert, L.A.; Werren, J.H.; Aebi, A.; Stone, G.N.; Jiggins, F.M. Evolution and diversity of Rickettsia bacteria. BMC Biol. 2009, 7, 6. [Google Scholar] [CrossRef]
  52. Wang, H.-L.; Lei, T.; Xia, W.-Q.; Cameron, S.L.; Liu, Y.-Q.; Zhang, Z.; Gowda, M.M.N.; De Barro, P.; Navas-Castillo, J.; Omongo, C.A.; et al. Insight into the microbial world of Bemisia tabaci cryptic species complex and its relationships with its host. Sci. Rep. 2019, 9, 6568. [Google Scholar] [CrossRef]
  53. Jiang, Z.F.; Xia, F.; Johnson, K.W.; Brown, C.D.; Bartom, E.; Tuteja, J.H.; Stevens, R.; Grossman, R.L.; Brumin, M.; White, K.P.; et al. Comparison of the genome sequences of “Candidatus Portiera aleyrodidarum” primary endosymbionts of the whitefly Bemisia tabaci B and Q biotypes. Appl. Environ. Microbiol. 2013, 79, 1757–1759. [Google Scholar] [CrossRef]
  54. Gottlieb, Y.; Ghanim, M.; Gueguen, G.; Kontsedalov, S.; Vavre, F.; Fleury, F.; Zchori-Fein, E. Inherited intracellular ecosystem: Symbiotic bacteria share bacteriocytes in whiteflies. FASEB J. 2008, 22, 2591–2599. [Google Scholar] [CrossRef]
  55. Pan, H.; Su, Q.; Jiao, X.; Zhou, L.; Liu, B.; Xie, W.; Wang, S.; Wu, Q.; Xu, B.; Zhang, Y. Relative amount of symbionts in Bemisia tabaci (Gennadius) Q changes with host plant and establishing the method of analyzing free amino acid in B. tabaci. Commun. Integr. Biol. 2013, 6, e23397. [Google Scholar] [CrossRef]
  56. Rosell, R.C.; Davidson, E.W.; Jancovich, J.K.; Hendrix, D.L.; Brown, J.K. Size limitations in the filter chamber and digestive tract of nymphal and adult Bemisia tabaci whiteflies (Hemiptera: Aleyrodidae). Ann. Entomol. Soc. Am. 2003, 96, 544–552. [Google Scholar] [CrossRef]
  57. Hanan, A.; He, X.Z.; Wang, Q. Insight into the success of whitefly biological control using parasitoids: Evidence from the Eretmocerus warrae−Trialeurodes vaporariorum system. Pest Manag. Sci. 2017, 73, 2294–2301. [Google Scholar] [CrossRef] [PubMed]
  58. Leschen, R.A.B.; Ślipiński, A. 7. Cucujiformia Lameere, 1938. Introduction, phylogeny. In Handbook of Zoology. Arthropoda: Insecta. Coleoptera Beetles Vol. 2. Morphology and Systematics (Elateroidea, Bostrichiformia, Cucujiformia partim); Leschen, R.A.B., Beutel, R.G., Lawrence, J.F., Eds.; Walter de Gruyter GmbH & Co. KG: Berlin/New York, NY, USA, 2010; pp. 227–228. [Google Scholar]
  59. King, A.M.Q.; Adams, M.J.; Carstens, E.B.; Lefkowitz, E.J. Family-herpesviridae. In Virus Taxonomy; King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E.J., Eds.; Elsevier: San Diego, CA, USA, 2012; pp. 111–122. [Google Scholar]
  60. King, A.M.Q.; Adams, M.J.; Carstens, E.B.; Lefkowitz, E.J. Family-herpesviridae. In Virus Taxonomy; King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E.J., Eds.; Elsevier: San Diego, CA, USA, 2012; pp. 477–495. [Google Scholar]
  61. Montiel, N.A. An updated review of simian betaretrovirus (SRV) in macaque hosts. J. Med. Primatol. 2010, 39, 303–314. [Google Scholar] [CrossRef]
  62. Junglen, S.; Drosten, C. Virus discovery and recent insights into virus diversity in arthropods. Curr. Opin. Microbiol. 2013, 16, 507–513. [Google Scholar] [CrossRef] [PubMed]
  63. Mukherjee, S.; Huntemann, M.; Ivanova, N.; Kyrpides, N.C.; Pati, A. Large-scale contamination of microbial isolate genomes by Illumina PhiX control. Stand. Genomic Sci. 2015, 10, 18. [Google Scholar] [CrossRef] [PubMed]
  64. Wang, B.; Wang, L.; Chen, F.; Yang, X.; Ding, M.; Zhang, Z.; Liu, S.-S.; Wang, X.-W.; Zhou, X. MicroRNA profiling of the whitefly Bemisia tabaci Middle East-Aisa Minor I following the acquisition of Tomato yellow leaf curl China virus. Virol. J. 2016, 13, 20. [Google Scholar] [CrossRef] [PubMed]
  65. Guo, Q.; Tao, Y.L.; Chu, D. Characterization and comparative profiling of miRNAs in invasive Bemisia tabaci (Gennadius) B and Q. PLoS ONE 2013, 8, e59884. [Google Scholar] [CrossRef]
  66. Zhu, L.; Zhao, J.; Wang, J.; Hu, C.; Peng, J.; Luo, R.; Zhou, C.; Liu, J.; Lin, J.; Jin, Y.; et al. MicroRNAs are involved in the regulation of ovary development in the pathogenic blood fluke Schistosoma japonicum. PLoS Pathog. 2016, 12, e1005423. [Google Scholar] [CrossRef]
  67. Wu, P.; Han, S.; Chen, T.; Qin, G.; Li, L.; Guo, X. Involvement of microRNAs in infection of silkworm with Bombyx mori cytoplasmic polyhedrosis virus (BmCPV). PLoS ONE 2013, 8, e68209. [Google Scholar] [CrossRef]
  68. Ruby, J.G.; Stark, A.; Johnston, W.K.; Kellis, M.; Bartel, D.P.; Lai, E.C. Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs. Genome Res. 2007, 17, 1850–1864. [Google Scholar] [CrossRef]
  69. Stark, A.; Bushati, N.; Jan, C.H.; Kheradpour, P.; Hodges, E.; Brennecke, J.; Bartel, D.P.; Cohen, S.M.; Kellis, M. A single Hox locus in Drosophila produces functional microRNAs from opposite DNA strands. Genes Dev. 2008, 22, 8–13. [Google Scholar] [CrossRef]
  70. Ylla, G.; Fromm, B.; Piulachs, M.D.; Belles, X. The microRNA toolkit of insects. Sci. Rep. 2016, 6, 37736. [Google Scholar] [CrossRef] [PubMed]
  71. Smibert, P.; Lai, E.C. A view from Drosophila: Multiple biological functions for individual microRNAs. Semin. Cell Dev. Biol. 2010, 21, 745–753. [Google Scholar] [CrossRef] [PubMed]
  72. Brennecke, J.; Hipfner, D.R.; Stark, A.; Russell, R.B.; Cohen, S.M. Bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. Cell 2003, 113, 25–36. [Google Scholar] [CrossRef]
  73. Li, R.; Huang, Y.; Zhang, Q.; Zhou, H.; Jin, P.; Ma, F. The miR-317 functions as a negative regulator of Toll immune response and influences Drosophila survival. Dev. Comp. Immunol. 2019, 95, 19–27. [Google Scholar] [CrossRef]
  74. Lampe, L.; Jentzsch, M.; Levashina, E.A. Metabolic balancing by miR-276 shapes the mosquito reproductive cycle and Plasmodium falciparum development. bioRxiv 2019, 548784. [Google Scholar] [CrossRef]
  75. He, J.; Chen, Q.; Wei, Y.; Jiang, F.; Yang, M.; Hao, S.; Guo, X.; Chen, D.; Kang, L. MicroRNA-276 promotes egg-hatching synchrony by up-regulating brm in locusts. Proc. Natl. Acad. Sci. USA 2016, 113, 584–589. [Google Scholar] [CrossRef]
  76. Ronshaugen, M.; Biemar, F.; Piel, J.; Levine, M.; Lai, E.C. The Drosophila microRNA iab-4 causes a dominant homeotic transformation of halteres to wings. Genes Dev. 2005, 19, 2947–2952. [Google Scholar] [CrossRef]
  77. Rubio, M.; de Horna, A.; Belles, X. MicroRNAs in metamorphic and non-metamorphic transitions in hemimetabolan insect metamorphosis. BMC Genomics 2012, 13, 386. [Google Scholar] [CrossRef]
  78. Naqvi, A.; Cui, T.; Grigoriev, A. Visualization of nucleotide substitutions in the (micro) transcriptome. BMC Genomics 2014, 15 (Suppl. 4), S9. [Google Scholar] [CrossRef][Green Version]
Figure 1. Aleurocanthus spiniferus on Ailanthus altissima leaves in Bari, Apulia region, Italy. Puparia on the underside of the leaves (on the left). Close-up of puparia taken by a photo camera (top right) and a scanning electron microscope (bottom right).
Figure 1. Aleurocanthus spiniferus on Ailanthus altissima leaves in Bari, Apulia region, Italy. Puparia on the underside of the leaves (on the left). Close-up of puparia taken by a photo camera (top right) and a scanning electron microscope (bottom right).
Insects 11 00161 g001
Figure 2. Dendrograms of the microbiome of Aleurocanthus spiniferus infesting Ailanthus altissima based on the results obtained using four different tools for taxonomic assignment of small RNA reads. The size of the circles is proportional to the number of reads or contigs placed in the taxon. Small RNA reads were subjected to Kraken and Kaiju or were assembled into contigs using Velvet or VelvetOptimiser prior to search sequence similarities against the BLAST nr database.
Figure 2. Dendrograms of the microbiome of Aleurocanthus spiniferus infesting Ailanthus altissima based on the results obtained using four different tools for taxonomic assignment of small RNA reads. The size of the circles is proportional to the number of reads or contigs placed in the taxon. Small RNA reads were subjected to Kraken and Kaiju or were assembled into contigs using Velvet or VelvetOptimiser prior to search sequence similarities against the BLAST nr database.
Insects 11 00161 g002
Figure 3. Length distribution of small RNAs of Aleurocanthus spiniferus: redundant, unique sequencing reads (A) and associated features (B).
Figure 3. Length distribution of small RNAs of Aleurocanthus spiniferus: redundant, unique sequencing reads (A) and associated features (B).
Insects 11 00161 g003
Figure 4. Features of small RNAs of Aleurocanthus spiniferus and their abundance in the library: sequencing reads of the entire library (A) and those mapping to Bemisia tabaci genome (B).
Figure 4. Features of small RNAs of Aleurocanthus spiniferus and their abundance in the library: sequencing reads of the entire library (A) and those mapping to Bemisia tabaci genome (B).
Insects 11 00161 g004
Figure 5. Abundance of several transposable element families in the Aleurocanthus spiniferus the library.
Figure 5. Abundance of several transposable element families in the Aleurocanthus spiniferus the library.
Insects 11 00161 g005
Table 1. Canonical miRNAs detected by miRDeep2 tool using Aleurocanthus spiniferus small RNA reads, Bemisia tabaci genome, and miRBase database.
Table 1. Canonical miRNAs detected by miRDeep2 tool using Aleurocanthus spiniferus small RNA reads, Bemisia tabaci genome, and miRBase database.
Provisional MiRNA Name (Mature/Star)miRDeep2 IDmiRDeep2 ScoreRead Count (RPM)Example of miRBase miRNA with the Same SeedAlignment between A. spiniferus miRNA (up) and miRbase miRNA (Bottom)Precursor Coordinate in the Bemisia tabaci Genome
MatureStar
asp-bantam-3p
asp-bantam-5p
NW_017547202.1_50675.2115,812.75.5dme-bantam-3pUGAGAUCAUCGUGAAAGCUG
.........UU.........AUU
NW_017547202.1:1932321..1932378: +
asp-miR-276a-3p
asp-miR-276a-5p
NW_017547107.1_13085 × 10417,936.810.8dme-miR-276a-3pUAGGAACUUCAUACCGUGCUC
.....................U
NW_017547107.1:5694695..5694839: − b
asp-miR-317-3p
asp-miR-317-5p
NW_017550575.1_118791.1 × 1044034.04.0dqu-miR-317-3pUGAACACAGCUGGUGGUAUCUCAG
........................
NW_017550575.1:773861..774000: + b
asp-miR-750-3p
asp-miR-750-5p
NW_017547443.1_88849.4 × 1033348.718.5ame-miR-750-3pCCAGAUCUAACUCUUCCAGCUC
......................
NW_017547443.1:370244..370308: −
asp-mir-8-3p
asp-mir-8-5p
NW_017547115.1_21044.43101.03.7api-mir-8UAAUACUGUCAGGUAAUGAU
....................GUC
NW_017547115.1:1766399..1766456: −
asp-miR-184-3p
asp-miR-184-5p
NW_017563531.1_155595.126.20dme-miR-184-3pUGGACGGAAAACUGAUAAGGGU
........G............C
NW_017563531.1:2205..2265: +
NW_017552810.1_133064.826.20UGGACGGAAAACUGAUAAGGGU
........G............C
NW_017552810.1:1753402..1753462: −
NW_017547113.1_168153074.10.6UGGACGGAGAACUGAUAAGGG
.....................C
NW_017547113.1:1014029..1014184: + b
asp-miR-2765-5p
asp-miR-2765-3p
NW_017547098.1_4123.8 × 1031355.45.1ame-miR-2765-5pUGGUAACUCCACCACCGUUGG
.....................C
NW_017547098.1:2423456..2423512: +
NW_017547098.1_4104.82424.90UGGUAACUCCACACCACCGUUGG
............--.........C
NW_017547098.1:2422100..2422160: +
asp-miR-100-5p
asp-miR-100-3p
NW_017547299.1_78604.9 × 1031758.52.0dme-miR-100-5pAACCCGUAGAUCCGAACUUGU
.....................G
NW_017547299.1:803546..803601: +
asp-miR-13a-3p
asp-miR-13a-5p
NW_017547352.1_85634.6 × 1031617.449.2tca-miR-13a-3pUAUCACAGCCACUUUGAUGAAC
....................G.
NW_017547352.1:37273..37334: +
asp-miR-2a-3p
asp-miR-2a-5p
NW_017547352.1_85612.9 × 1031039.50.2mse-miR-2aUCACAGCCAGCUUUGAUGAGCA
......................
NW_017547352.1:36468..36531: +
NW_017547352.1_85691.7 × 103636.60.9dme-miR-2a-3pUAUCACAGCCAGCUUUGAUGA
.....................GC
NW_017547352.1:40230..40282: +
NW_017547352.1_85675.4638.81.1NW_017547352.1:40048..40201: + b
NW_017561640.1_152571.7 × 103636.60.9NW_017561640.1:532..683: + b
NW_017561640.1_152555.4638.81.1NW_017561640.1:382..438: +
asp-miR-315-5p
asp-miR-315-3p
NW_017547334.1_84514.81501.80dme-miR-315-5pUUUUGAUUGUUGCUCAGAAAGC
......................
NW_017547334.1:1004963..1005023: −
asp-miR-9a-5p
asp-miR-9a-3p
NW_017551177.1_122833.9 × 1031395.922.2dme-miR-9a-5pUCUUUGGUUACCUAGCUGUAUG
..........T...........
NW_017551177.1:699591..699652: −
asp-miR-277-3p
asp-miR-277-5p
NW_017550575.1_118812.9 × 1031062.82.0dme-miR-277-3pUAAAUGCACUAUCUGGUACGAC
......................A
NW_017550575.1:818061..818121: +
asp-miR-71-3p
asp-miR-71-5p
NW_017547352.1_85592.8 × 103860.6139.8tca-miR-71-3pUCUCACUACCUUGUCUUUCAU
.....................G
NW_017547352.1:36323..36463: + b
asp-miR-14-3p
asp-miR-14-5p
NW_017547098.1_4932.5 × 103847.357.8dme-miR-14-3pUCAGUCUUUUUCUCUCUCCUA
.....................U
NW_017547098.1:8908667..8908729: +
asp-miR-275-3p
asp-miR-275-5p
NW_017547297.1_76295.6820.1101.1dme-miR-275-3pUCAGGUACCUGAAGUAGCGCG
.....................CG
NW_017547297.1:1465090..1465268: + b
asp-let-7-5p
asp-let-7-3p
NW_017547299.1_78624.8745.26.2dme-let-7-5pUGAGGUAGUAGGUUGUAUAG
....................U
NW_017547299.1:803734..803802: +
asp-miR-263a-5p
asp-miR-263a-3p
NW_017547161.1_31925.1696.14.8dme-miR-263a-5pAAUGGCACUAGAAGAAUUCACG
.........G............GG
NW_017547161.1:912282..912340: +
asp-miR-31-5p
asp-miR-31-5p
NW_017547107.1_13455654.40aca-miR-31-5pAGGCAAGAUGUUGGCAUAGC
....................U
NW_017547107.1:9048192..9048254: −
asp-miR-306-5p
asp-miR-306-3p
NW_017547320.1_81385.3597.31.5dme-miR-306-5pUCAGGUACUGAGUGACUCU
.........G.........
NW_017547320.1:2159894..2159951: +
asp-miR-305-5p
asp-miR-305-3p
NW_017547297.1_76325.1522.02.4dme-miR-305-5pAUUGUACUUCAUCAGGUGCUC
.....................UG
NW_017547297.1:1466885..1466944: +
asp-miR-92b-3p
asp-miR-92b-5p
NW_017564582.1_159920.6 a488.40dme-miR-92b-3pAAUUGCACUAGUCCCGGCCUG
.....................C
NW_017564582.1:513918..513972: −
asp-miR-13b-3p
asp-miR-13b-5p
NW_017561640.1_152531.1 × 103311.8109.2bmo-miR-13bUAUCACAGCCAUUUUUGACGUGCC
....................A.U
NW_017561640.1:204..265:+
NW_017547352.1_8565NW_017547352.1:39883..39944: +
asp-miR-34-5p
asp-miR-34-3p
NW_017550575.1_118845.1297.115.4dme-miR-34-5pUGGCAGUGUGGUUAGCUGGUUG
......................UG
NW_017550575.1:854739..854841: + b
asp-miR-87a-3p
asp-miR-87a-5p
NW_017547298.1_77172.8 × 10298.72.8tca-miR-87a-3pGUGAGCAAAGUUUCAGGUGUG
.....................
NW_017547298.1:2017127..2017227: +
NW_017547298.1_77198.2 × 102285.85.7tca-miR-87a-3pGUGAGCAACGUAUCAGGUGUC
........A..U........GA
NW_017547298.1:2017271..2017332: +
asp-miR-993-3p
asp-miR-993-5p
NW_017547290.1_72999.5 × 102276.964.2dme-miR-993-3pGAAGCUCGUCUCUACAGGUAUC
......................U
NW_017547290.1:727642..727815: + b
asp-miR-125-5p
asp-miR-125-3p
NW_017547299.1_78647.8 × 102262.414.9dme-miR-125-5pUCCCUGAGACCCUAAUUUGUG
...............C.....A
NW_017547299.1:822960..823021: +
asp-miR-927-3p
asp-miR-927-5p
NW_017547282.1_70138.7 × 102227.383.3dme-miR-927-3pCAAAGCGUUUGAAUUCUGGAA
...........G......A..C
NW_017547282.1:1940947..1941008: +
asp-miR-281-2-5p
asp-miR-281-2-3p
NW_017561619.1_152488.1 × 102219.868.8dme-miR-281-2-5pAAGAGAGCUAUCCUUCGACAG
.............G.......U
NW_017561619.1:12115..12174: +
asp-miR-252a-5p
asp-miR-252a-3p
NW_017554870.1_138845.9 × 102a212.40.2dpu-miR-252aCUAAGUACUCCGUGCCGCAGG
..........-..........AG
NW_017554870.1:193643..193702: +
asp-miR-1-3p
asp-miR-1-5p
NW_017547904.1_95683.9 × 102137.82.2dme-miR-1-3pUGGAAUGUAAAGAAGUAUGGA
.....................G
NW_017547904.1:1209882..1209940: −
asp-miR-190-5p
asp-miR-190-3p
NW_017547096.1_3593.3 × 102117.30.6dme-miR-190-5pAGAUAUGUUUGAUAUUCUUGGUU
.......................G
NW_017547096.1:1449782..1449864: − b
asp-miR-279b-3p
asp-miR-279b-5p
NW_017547145.1_31725.2114.40pxy-miR-279b-3pUGACUAGAUUUUCACUCAUUC
...................C.
NW_017547145.1:2285467..2285523: −
asp-miR-92a-3p
asp-miR-92a-5p
NW_017564582.1_159945.186.90dme-miR-92a-3pUAUUGCACUUGUCCCGGCC
C..................UAU
NW_017564582.1:514087..514138: −
asp-miR-133-3p
asp-miR-133-5p
NW_017547904.1_95642.3 × 10283.80.2dme-miR-133-3pUUGGUCCCCUUCAACCAGCUG
.....................U
NW_017547904.1:1012752..1012934: − b
asp-miR-263b-5p
asp-miR-263b-3p
NW_017547161.1_31962.4 × 10281.33.7api-miR-263bCUUGGCACUGGAAGAAUUCACAG
.......................A
NW_017547161.1:950587..950647: +
asp-miR-252b-5p
asp-miR-252b-3p
NW_017554870.1_138822 × 10 2a72.90.9api-miR-252bCUAAGUAGUAGCGCCGAAGGUG
...............A.C....A
NW_017554870.1:149158..149217: +
asp-miR-124-3p
asp-miR-124-5p
NW_017557672.1_148770.3 a64.037.4dme-miR-124-3pUAAGGCACGCGGUGAAUGCC
....................AAG
NW_017557672.1:97524..97666: + b
asp-miR-375-3p
asp-miR-375-5p
NW_017547090.1_761.5 × 10253.51.5ame-miR-375-3pUUUGUUCGUUCGGCUCGAGUU
.....................A
NW_017547090.1:1647645..1647829: − b
asp-miR-10-5p
asp-miR-10-3p
NW_017547290.1_73614.451.80.9oar-miR-10aUACCCUGUAGAUCCGAAAUU
.................U..G
NW_017547290.1:727642..727815: − b
asp-miR-996-3p
asp-miR-996-5p
NW_017553907.1_136571.5 × 10246.29.2api-miR-996UGACUAGAGUUACACUCGUC
....................A
NW_017553907.1:824153..824211: −
asp-miR-7-5p
asp-miR-7-3p
NW_017556795.1_144611.1 × 10238.21.1dme-miR-7-5pUGGAAGACUAGUGAUUUUGUUGU
.......................
NW_017556795.1:161510..161612: − b
asp-miR-210-3p
asp-miR-210-5p
NW_017550873.1_120174.836.50.4dme-miR-210-3pCUUGUGCGUGUGACAGCGGC
....................UAU
NW_017550873.1:911604..911762: + b
asp-miR-1000-5p
asp-miR-1000-3p
NW_017547246.1_6234532.00.9dme-miR-1000-5pAUAUUGUCCUGUCACAGCAG
....................U
NW_017547246.1:2709831..2709911: + b
asp-miR-929-5p
asp-miR-929-3p
NW_017547330.1_8238525.60.2dme-miR-929-5pAAAUUGACUCUAGUAGGGAG
....................UC
NW_017547330.1:415939..415997: +
asp-miR-137-3p
asp-miR-137-5p
NW_017547181.1_42017325.10.4dme-miR-137-3pUAUUGCUUGAGAAUACACGUA
.....................G
NW_017547181.1:4906197..4906365: + b
asp-miR-29b-3p
asp-miR-29b-5p
NW_017547261.1_65734.323.60aca-miR-29bUAGCACCAUUUGAAAUCAGUG
.....................
NW_017547261.1:4373495..4373551: +
NW_017548020.1_10048NW_017548020.1:5969402..5969450: −
asp-miR-971b-5p
asp-miR-971b-3p
NW_017547177.1_37727221.62.8tca-miR-971b-5pCACUCUAAGCUCGAACAUCAAG
.........U.U..........C
NW_017547177.1:2847368..2847428: +
asp-miR-307a-3p
asp-miR-307a-5p
NW_017547096.1_3644.820.70dme-miR-307a-3pUCACAACCUCCUUGAGUGAG
....................CGA
NW_017547096.1:1789984..1790139: − b
asp-miR-3049-3p
asp-miR-3049-5p
NW_017547142.1_30356916.27.0ame-miR-3049-3pUCCGUCCAACUCUUUUCCGCC
............C......U.U
NW_017547142.1:3651122..3651182: +
asp-miR-2796-3p
asp-miR-2796-5p
NW_017547276.1_67825015.80.7ame-miR-2796-3pGUAGGCCGGCGGAAACUACUUG
......................C
NW_017547276.1:164674..164899: − b
asp-miR-998-3p
asp-miR-998-5p
NW_017547112.1_15365.314.5 0api-miR-998UAGCACCAUGGAAUUCAGCUU
....................G
NW_017547112.1:1633093..1633150: −
asp-miR-1175-3p
asp-miR-1175-5p
NW_017547443.1_88823.313.5 0dme-miR-958-3pUGAGAUUCAACUCCUCCAUC
....................
NW_017547443.1:363797..363852: −
asp-miR-965-3p
asp-miR-965-5p
NW_017551483.1_125664.410.73.7dme-miR-965-3pUAAGCGUAUAGCUUUUCCCC
....................UU
NW_017551483.1:4663002..4663057: −
asp-miR-iab-4-5p
asp-miR-iab-4-3p
NW_017549609.1_114454.74.70.7dme-miR-iab-4-5pACGUAUACUAAAUGUAUCCU
.........G..........GA
NW_017549609.1:2987912..2987972: −
asp-miR-iab-8-3p
asp-miR-iab-8-5p
NW_017549609.1_113681.50.40.6dps-miR-iab-8-3pAGGAUACAUUUAGUAUACGUC
..........C.........AUA
NW_017549609.1:2987914..2987973: +
a Non-significant randfold p-value. b Significant (e-value < 0.01) BLAST alignment between miRBase precursor and Bemisia tabaci genome.
Table 2. Novel miRNAs (more than two mismatches shared with miRBase sequences) detected by miRDeep2 tool using Aleurocanthus spiniferus small RNA reads, Bemisia tabaci genome, and miRBase 22 database.
Table 2. Novel miRNAs (more than two mismatches shared with miRBase sequences) detected by miRDeep2 tool using Aleurocanthus spiniferus small RNA reads, Bemisia tabaci genome, and miRBase 22 database.
Provisional miRNA Name (Mature/Star)miRDeep2 IDmiRDeep2 ScoreRead Count (RPM)Example of miRBase miRNA with the Same SeedAlignment between A. spiniferus miRNA (up) and miRbase miRNA (Bottom)Precursor Coordinate in the Bemisia tabaci Genome
MatureStar
asp-miR-111690-5p
asp-miR-111690-3p
NW_017549178.1_111692.2 × 10268.99.0efu-mir-9235bUGUGAUGUGCCUGUGGGCUUU
UAAU.U.......G.......AAG
NW_017549178.1:3495258..3495320: −
asp-miR-131950-5p
asp-miR-131950-3p
NW_017552654.1_131951 × 10229.66.8dme-miR-304-5pUAAUCUCAUACAGUUAUCCAUGA
..........UUUG..AAUG...G
NW_017552654.1:189212..189276: −
asp-miR-73390-3p
asp-miR-73390-5p
NW_017547290.1_7339112.00.6rno-miR-3590-3pUGUCACAUUCGAAAAGAGCUG
UA.CACA..GU..........C
NW_017547290.1:2474877..2474936: +
asp-miR-131930-5p
asp-miR-131930-3p
NW_017552654.1_131934.51467.222.2dme-miR-12-5pUGAGUAUUACAUCAGAUAUUU
...............G..C.GGU
NW_017552654.1:186778..186837: −
asp-miR-81360-5p
asp-miR-81360-3p
NW_017547320.1_81364.3405.10dme-miR-9a-5pUCUUUGGUAUUCUAGCUGUAG
........UA..........UGA
NW_017547320.1:2154975..2155034: +
asp-miR-36450-5p
asp-miR-36450-3p
NW_017547174.1_36455.2343.10dme-miR-5-5pUAAGGAACUAGGAAUGAGAUG
A.......G.UCGU..U...AUG
NW_017547174.1:1937885..1937946: −
asp-miR-129380-3p
asp-miR-129380-5p
NW_017552322.1_12938565.80dme-miR-981-3pUUCGUUGUCGCCGAAAACUCGUC
..........A.....C..GCA
NW_017552322.1:646402..646467: −
asp-miR-38410-3p
asp-miR-38410-5p
NW_017547177.1_38412.846.90zma-miR396e-3pACUUUGGCCGUGAAAGCCGUG
..U.AA..........GGAAG
NW_017547177.1:5603872..5603954: +
asp-miR-161110-3p
asp-miR-161110-5p
NW_017564655.1_161115.236.50api-miR-3016UUUGGUAAAAGAUAGCCGGUA
A.......C.C.....UCU.UAG
NW_017564655.1:2288547..2288606: +
asp-miR-1011900-3p
asp-miR-1011900-5p
NW_017548094.1_101195.133.30dme-miR-993-3pCAAGCUCGUUGAAGUAUACCC
G........CUCUAC.GGUAUCU
NW_017548094.1:36089..36137: +
asp-miR-64150-3p
asp-miR-64150-5p
NW_017547257.1_64151.3 a26.70bmo-miR-3322CCUCGUCGGCGUCGGCGGC
U........UU.GAAGUUGGCUAG
NW_017547257.1:1451280..1451335: +
asp-miR-22650-3p
asp-miR-22650-5p
NW_017547116.1_22650.4 a11.80ame-miR-9883-5pGUCGGGCGUAGUUAGUACU
U.......GGC.CG.GCGAGA
NW_017547116.1:7925742..7925790: +
NW_017548020.1_1004800NW_017548020.1:5969402..5969450: −
NW_017547090.1_190 a21.80GUCGGGCGUAGUUAGUACUUAGAU
U.......GGC.CG.GCGAGA
NW_017547090.1:1477845..1477898: +
asp-miR-33410-5p
asp-miR-33410-3p
NW_017547161.1_33413.218.90mmu-miR-6976-5pCAGGGAAUUUUUGACCAAAA
.......G..GA..GG....UUG
NW_017547161.1:1252883..1252946: −
asp-miR-161130-3p
asp-miR-161130-5p
NW_017564655.1_16113513.50dme-miR-9c-3pACUUUGGUAAAAACAGCUGUG
UAAAG....UA..CC..AGCUC
NW_017564655.1:2292773..2292828: +
asp-miR-144320-5p
asp-miR-144320-3p
NW_017556720.1_144325.812.50eca-miR-9128ACUCGCGCGGGCACCGUCGU
CUGGUG......U....CA....AC
NW_017556720.1:451897..451955: +
NW_017549581.1_1131400NW_017549581.1:39602..39660: +
NW_017555149.1_1393800NW_017555149.1:1072638..1072696: +
asp-miR-169840-3p
asp-miR-169840-5p
NW_017566817.1_169843.67.50eca-miR-9047AGUUCCCGGGUUUCGGCACC
U........C.GA.CCUGG.UAGG
NW_017566817.1:2966919..2966963: −
asp-miR-81390-3p
asp-miR-81390-5p
NW_017547320.1_81394.75.30dme-miR-4-3pAUAAAGCUGGAUUACCAAAGC
........A..CA....UU.A
NW_017547320.1:2163341..2163400: +
asp-miR-147030-3p
asp-miR-147030-5p
NW_017557621.1_147030.8 a5.30mmu-miR-7648-3pCGGCGCGGCCCGGGCGGCGG
A...UG........AC....G
NW_017557621.1:10736677..10736742: +
asp-miR-1850-5p
asp-miR-1850-3p
NW_017547093.1_1851.4 a4.70hbv-miR-B4UCGGGGCGGCCGUUGCCG
A.......UGGU.G.UG.GCG
NW_017547093.1:1632977..1633017: −
asp-miR-129190-3p
asp-miR-129190-5p
NW_017552322.1_129193.84.40mdv1-miR-M10-3pUCCCGGAGAAAUUUCGAGCU
..U..U...G.......UAACA
NW_017552322.1:437934..437995: +
asp-miR-29250-5p
asp-miR-29250-3p
NW_017547136.1_29250 a4.40mdo-miR-7380-5pAGGUCCCAGGUUCGAUCCCU
.........C.CUAC...UCAU
NW_017547136.1:599807..599880: −
NW_017547136.1_29270 a00AGGUCCCAGGUUCGAUCCCU
...........CUAC...UCAU
NW_017547136.1:603764..603837: −
asp-miR-75080-3p
asp-miR-75080-5p
NW_017547292.1_75080.4 a4.00gga-miR-6592-3pCGCGUCUCCUCCCUCGGA
A........CG...GACGGCC
NW_017547292.1:2958777..2958832: −
asp-miR-87590-3p
asp-miR-87590-5p
NW_017547427.1_875953.80atr-miR8572CGACCCGGUCGGCGUCGG
U..........UU.GAAUCCUCUC
NW_017547427.1:2779263..2779325: +
asp-miR-140930-5p
asp-miR-140930-3p
NW_017555629.1_140930 a3.60dme-miR-959-5pUUAGUACUUAGAUGGGAGAC
U.......CG.G.U.AUA.AG
NW_017555629.1:127516..127600: −
asp-miR-151900-3p
asp-miR-151900-5p
NW_017560566.1_151900.83.30bta-miR-11982AUUACCCGGCGCCUCCACC
UU.............CUGCGGGU
NW_017560566.1:657..718: −
asp-miR-8520-5p
asp-miR-8520-3p
NW_017547103.1_8520.8 a3.10mmu-miR-3081-5pGGCCGCGAGCGUGGAGUGGUGA
.A.UG....U.....C.....
NW_017547103.1:943997..944071: +
asp-miR-35640-5p
asp-miR-35640-3p
NW_017547174.1_356452.90dme-miR-5-5pUAAGGAACUGUUUGAUGUGGU
A.......GA.CGUUGUGAUAUG
NW_017547174.1:1945099..1945157: +
asp-miR-70610-3p
asp-miR-70610-5p
NW_017547282.1_70613.32.90ame-miR-750-3pCAGCUCUAACUCUUAAAGCUG
.CAGA..........CCAG.C
NW_017547282.1:4449832..4449878: +
asp-miR-29460-5p
asp-miR-29460-3p
NW_017547139.1_29461.22.90ame-bantam-3pAGAUCCUUGUGACAGCUU
UG.....A......A....GAUU
NW_017547139.1:273731..273785: +
asp-miR-46090-5p
asp-miR-46090-3p
NW_017547184.1_46094.22.40dvi-miR-9709-5pUUGCACUUCGGUAUCUCCAACCUAU
..........C.U.U.UAU..AACG
NW_017547184.1:3061811..3061874: −
asp-miR-109-5p
asp-miR-42860-3p
NW_017547182.1_42863.92.40gsa-miR-10b-5pUGUAGACCUGAAUCA
AACCC........C....UUGA
NW_017547182.1:1044722..1044786: +
asp-miR-49480-3p
asp-miR-49480-5p
NW_017547098.1_4451.9 a2.40dme-miR-4948-5pCGGCGGGCCGGGCGGCGU
........GU....UGCGUGAU
NW_017547098.1:4979831..4979950: +
asp-miR-125030-5p
asp-miR-125030-3p
NW_017551483.1_125030.92.20efu-miR-9212UUCGCAUGGAGUCAUCUGUUAU
ACA........GG.....GAGA
NW_017551483.1:448169..448229: −
asp-miR-165650-5p
asp-miR-165650-3p
NW_017566689.1_165652.92.00hsa-miR-10523-5pGACAAUGAUGACAAAAUUUGGU
...........G..G.CC..AGGA
NW_017566689.1:494135..494184: −
asp-miR-54140-5p
asp-miR-54140-3p
NW_017547211.1_54144.61.80hsa-miR-1538GGGCCCGGGGUUCGAUUCC
C........C.G.UGC.GUUCC
NW_017547211.1:1082752..1082825: +
asp-miR-1077800-3p
asp-miR-1077800-5p
NW_017549038.1_107784.41.50.4pxy-miR-8536b-3pAGGUAUCUGAGCGAUGUCCCCAC
CC.....C...U.....A.U.
NW_017549038.1:8023737..8023796: +
NW_017551711.1_1271300NW_017551711.1:428822..428883: −
asp-miR-131970-5p
asp-miR-131970-3p
NW_017552654.1_131971.71.30dme-miR-283-5pAAAUAUCAGCUAGAUGCCUG
...........G.UAAUUCUGG
NW_017552654.1:190394..190458: −
asp-miR-125790-3p
asp-miR-125790-5p
NW_017551561.1_125792.10.90aca-miR-9573-3pCAAAACUAGAAUUGCCUAGG
.........G....U...U.
NW_017551561.1:47313..47366: +
NW_017549024.1_106311.90.90NW_017549024.1:233711..233804: +
asp-miR-56900-5p
asp-miR-56900-3p
NW_017547229.1_56900.30.90hsa-miR-483-5pAUAAGACUGGAGGAAUGUAG
.....C.......A.G...GAG
NW_017547229.1:2771708..2771774: +
asp-miR-77520-5p
asp-miR-77520-3p
NW_017547298.1_77521.80.70sfr-miR-10458-5pCACUGGAUACAUGUUAAACG
GC.G......G....U.C..
NW_017547298.1:3903205..3903268: +
asp-miR-147690-5p
asp-miR-147690-3p
NW_017557621.1_1476900.70cre-miR1171AGGAGUGGAUUUUCGAAC
U........G.GGA.UGGAGUGG
NW_017557621.1:3670592..3670638: −
asp-miR-102140-5p
asp-miR-102140-3p
NW_017548287.1_102140.50.50ppc-miR-2263GUCUCGGGUUCGAUUCCCG
........C.UCU..GAG.AU
NW_017548287.1:869888..869958: +
asp-miR-64380-3p
asp-miR-64380-5p
NW_017547257.1_64380.70.40.4spu-miR-4848aAGGGUUGAGUAAGGACAUCAAC
U........GCUUUUGGG..GGA
NW_017547257.1:3219088..3219147: +
asp-miR-134420-3p
asp-miR-134420-5p
NW_017553232.1_134420.90.20bta-miR-2489AAGGGCUCAUGAGUUUUUG
AAAUG.C....GA.........
NW_017553232.1:988520..988580: −
NW_017553232.1_134050.90.20NW_017553232.1:988522..988582: +
asp-miR-98810-5p
asp-miR-98810-3p
NW_017548003.1_98810.40.20efu-miR-9304UAAGCCCCCCUCCCCUCCC
G.......UUGAAGGG..AGGGG
NW_017548003.1:5351436..5351483: −
asp-miR-33140-5p
asp-miR-33140-3p
NW_017547161.1_33140.10.20bta-miR-2460GAAACUCAUGAGCCCUGGC
U..G...U....G......AU
NW_017547161.1:6988319..6988379: +
a Non-significant randfold p-value. b Significant (e-value < 0.01) BLAST alignment between miRBase precursor and Bemisia tabaci genome.

Share and Cite

MDPI and ACS Style

Bubici, G.; Prigigallo, M.I.; Garganese, F.; Nugnes, F.; Jansen, M.; Porcelli, F. First Report of Aleurocanthus spiniferus on Ailanthus altissima: Profiling of the Insect Microbiome and MicroRNAs. Insects 2020, 11, 161. https://doi.org/10.3390/insects11030161

AMA Style

Bubici G, Prigigallo MI, Garganese F, Nugnes F, Jansen M, Porcelli F. First Report of Aleurocanthus spiniferus on Ailanthus altissima: Profiling of the Insect Microbiome and MicroRNAs. Insects. 2020; 11(3):161. https://doi.org/10.3390/insects11030161

Chicago/Turabian Style

Bubici, Giovanni, Maria Isabella Prigigallo, Francesca Garganese, Francesco Nugnes, Maurice Jansen, and Francesco Porcelli. 2020. "First Report of Aleurocanthus spiniferus on Ailanthus altissima: Profiling of the Insect Microbiome and MicroRNAs" Insects 11, no. 3: 161. https://doi.org/10.3390/insects11030161

APA Style

Bubici, G., Prigigallo, M. I., Garganese, F., Nugnes, F., Jansen, M., & Porcelli, F. (2020). First Report of Aleurocanthus spiniferus on Ailanthus altissima: Profiling of the Insect Microbiome and MicroRNAs. Insects, 11(3), 161. https://doi.org/10.3390/insects11030161

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop