Next Article in Journal
Seasonal Dynamics of the Leaffooted Bug Leptoglossus zonatus and Its Implications for Control in Almonds and Pistachios
Previous Article in Journal
Exposure to Non-Native Tropical Milkweed Promotes Reproductive Development in Migratory Monarch Butterflies
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 10
Issue 8
10.3390/insects10080254
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

CRISPR Disruption of BmOvo Resulted in the Failure of Emergence and Affected the Wing and Gonad Development in the Silkworm Bombyx mori

by
Honglun Bi
1,
Xia Xu
1,
Xiaowei Li
2,
Yong Zhang
3,
Yongping Huang
2,
Kai Li
1,* and
Jun Xu
2,*
1
College of Life Science, East China Normal University, Shanghai 200062, China
2
Key Laboratory of Insect Developmental and Evolutionary Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China
3
Department of Biology, University of Nevada, Reno, NV 89557, USA
*
Authors to whom correspondence should be addressed.
Insects 2019, 10(8), 254; https://doi.org/10.3390/insects10080254
Submission received: 23 July 2019 / Revised: 14 August 2019 / Accepted: 15 August 2019 / Published: 19 August 2019
Browse Figures
Versions Notes

Abstract

:
The domesticated silkworm is an economically important insect that is widely used as a lepidopteran insect model. Although somatic sex determination in the silkworm is well characterized, germline sex determination is not. Here, we used the transgenic-based CRISPR/Cas9 genome editing system to study the function of the Ovo gene in Bombyx mori. BmOvo is the homolog of a factor important in germline sex determination in Drosophila melanogaster. BmOvo mutants had abnormally shaped eggs that were disordered in the ovarioles, and gonad development was abnormal. Interestingly, wing discs and wings did not develop properly, and most of the mutants failed to eclose. Gene expression analyses by qRT-PCR showed that BmOvo gene was highly expressed in the wing disc and epidermis. Genes involved in the WNT signaling pathway and wing development genes BmWCP10 and BmE74 were downregulated in the BmOvo mutants when compared with wild-type animals. These results demonstrate that the BmOvo gene product plays an important role in wing metamorphosis. Thus, this study provides new insights into the multiple functions of BmOvo beyond germline sex determination.

1. Introduction

The insect OVO protein belongs to the zinc finger protein family, and it regulates many biological processes such as neural tube formation [1], eye maintenance [2], epidermal differentiation [3,4,5], and development of germ cells [3,6,7]. In Drosophila melanogaster, the Ovo gene encodes two functionally antagonistic isoforms, OVO-A, a transcriptional repressor, and OVO-B, which is a transcriptional activator [8]. The expression of Ovo is regulated by the X:A ratio and is required in XX germ cells [9,10]. The genes Ovo, Otu, and Sxl are necessary for female germ cell development in Drosophila [11,12], and the Ovo gene has been shown to be important for female germline survival and oogenesis [13]. During oogenesis, OVO-B is necessary and sufficient for female germline development [13]. Thus, Ovo is responsive to germ cell-autonomous cues in Drosophila [14,15,16].
The silkworm, Bombyx mori, as the foundation of sericulture, is an economically important insect; it is also an important model of lepidopteran species. In recent years, genetic manipulation technologies have been implemented in the silkworm; these include germline transformation methods [17,18] and genome-editing techniques such as transcription activator-like effector nuclease (TALEN) and clustered, regularly interspaced, short palindromic repeat (CRISPR)/Cas9 endonuclease-mediated systems [19,20,21,22,23]. The germline transformation using the piggyBac transposon element has also been widely used as a genetic manipulation technology to study gene function in the silkworm [24,25,26]. We combined transgenic methods and the genome-editing CRISPR/Cas9 system to explore the gene function in the silkworm [27,28,29,30].
Four transcript isoforms are expressed from the Ovo gene in the silkworm. A previous report showed that BmOvo-1 is most highly expressed [31]. BmOvo-1 is highly homologous with DmOVO-B. BmOvo-1 reportedly regulates ovary size, protein synthesis, nutrition transportation, and oviposition number through an RNA interference mechanism [31]. In the present study, we further analyzed the function of Ovo in B. mori. We found that BmOvo-1 is highly expressed in the wing disc and epidermis. When we knocked out all of four isoforms of the BmOvo gene using the CRISPR/Cas9 system, we found that gonad and wing development were defective, and the mutants did not emerge from the pupae. These data indicate that the BmOvo gene is not only crucial for germ cell sex development, but is also important for normal wing development.

2. Materials and Methods

2.1. Silkworm Strain

A multivoltine, nondiapausing silkworm strain, Nistari, was used for germline transformation and subsequent experiments. Larvae were reared on fresh mulberry leaves under standard conditions [28].

2.2. Quantitative Real-Time PCR (qRT-PCR)

For qRT-PCR analyses, total RNA was extracted from the silkworm larvae using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and treated with RNase-free DNAse I (Ambion, Austin, TX, USA), according to the manufacturer’s protocol. cDNAs were synthesized using the Omniscript Reverse Transcriptase kit (Qiagen, Hilden, Germany) in a 20-μL reaction mixture containing 1 μg total RNA. RT-PCR reactions were carried out using gene-specific primers (forward, 5′-GCCCCTTACCGCTCCTTTCG-3′, reverse, 5′-ATCGCCTCCAAGAATCGATG-3′) to amplify a 137-bp fragment of the BmOvo-1 gene. Another primer pair set (forward, 5′-TCAATCGGATCGCTATGACA-3′, reverse, 5′-ATGACGGGTCTTCTTGTTGG-3′) was used to amplify a 136-bp fragment from the B. mori ribosomal protein 49 (Bmrp49) as an internal control.

2.3. Plasmid Construction

Two small guide RNAs (sgRNAs) targeting sites on the first and third exons of BmOvo (GenBank accession number 477588.1) were designed according to the GN19NGG rule [32]. Selected sgRNA sequences were examined for potential off-target binding to silkworm genomic sequences using CRISPRdirect (http://crispr.dbcls.jp/) [33]. Moreover, sequences were subjected to BLAST analysis against the silkworm genome to avoid sequences with high homology to non-targeted genes. The binary transgenic system was established by expressing Cas9 and two sgRNAs in separate plasmids. The plasmid pBac[IE1-EGFP-SV40-nos-Cas9 -SV40], which constitutively expresses Cas9 under the control of the nos gene promoter, has been described by our lab [34]. To obtain a transgenic plasmid constitutively expressing two BmOvo sgRNAs, two cassettes of U6:sgRNA scaffold:polIII terminator were constructed using the silkworm U6 promoter [35]. Two U6 promoter sequences were amplified by PCR using primers complementary to the endonuclease restriction enzyme sites NheI and SalI using the silkworm genomic DNA as the template, and sub-cloned into the initial plasmid to generate pBac[IE1-DsRed-U6-NheI-U6-SalI]. The two sgRNAs were amplified using the primers Ovo-sgRNA1-F/sgRNA-R and Ovo-sgRNA2-F/sgRNA-R and inserted into the NheI and SalI restriction enzyme sites, respectively, to generate the final plasmid U6-Ovo sgRNA×2. The plasmids were extracted with a Plasmid Midi Kit (Qiagen) according to the manufacturer’s instructions and purified by phenol-chloroform extraction [28]. All primers sequences are listed in Table 1.

2.4. Germline Transformation

For silkworm germline transformation, preblastoderm Nistari embryos were microinjected with a mixture of transgenic plasmid and helper plasmids and subsequently incubated at 25 °C in a humidified chamber for 10–12 days until larval hatching. Putative transgenic generation 0 (G0) moths were sib-mated or mated to wild-type (WT) moths and G1 progeny were scored for the presence of the fluorescent marker using fluorescence microscopy (Nikon AZ100, Minato, Tokyo, Japan).

2.5. Mutagenesis Analysis

Genomic PCR, followed by sequencing, was carried out to identify BmOvo mutant alleles induced by CRISPR/Cas9. The genomic DNA was extracted from larvae at the fifth instar with a DNA extraction buffer, incubated with proteinase K, and purified via phenol:chloroform extraction and isopropanol precipitation, followed by an RNaseA treatment. The PCR conditions were as follows: 98 °C for 2 min, followed by 35 cycles of 94 °C for 10 s, 55 °C for 30 s, and 72 °C for 1 min, followed by a final extension period of 72 °C for 10 min. The PCR products were cloned into the pJET1.2-T vectors (Fermentas, Waltham, MA, USA) and sequenced directly as previous reported [36]. The primers F1 and R1 (Table 1) were designed to detect mutations in the targeted sites. These mutants were photographed to observe the abnormal phenotypes and compare them with the wild type with a digital stereoscope (Nikon AZ100).

2.6. Statistical Analysis

Data were analyzed with SPSS 2.0 using the two-tailed t-test. t-test: *, p < 0.05, **, p < 0.01, ***, p < 0.001. At least three independent replicates were used for each treatment, and the error bars show means ± S.E.M.

3. Results

3.1. BmOvo-1 Is Highly Expressed in Wing Disc and Epidermis

A previous study evaluated the expression patterns of BmOvo-1 in a few tissues [31]. To investigate the spatial expression pattern of BmOvo-1 in detail, qRT-PCR was used to analyze cDNA prepared from the head, fat body, wing disc, epidermis, middle silk gland, posterior silk gland, midgut, testis, and ovary. Tissues were collected from the final instar larvae (the third day of the fifth larval instar, L5D3). qPCR analysis showed that BmOvo-1 transcripts were detected in all these tissues. This transcript was most abundant in the wing disc and epidermis (Figure S1). This suggested that BmOvo might play a role in the development of the wing or epidermis.

3.2. CRISPR/Cas9-Mediated Mutagenesis of BmOvo Gene

To explore the function of BmOvo gene in vivo, we constructed a binary CRISPR/Cas9 system to knock out the BmOvo gene essentially, as previously described [28,34,37]. This system consisted of two transgenic lines, nos-Cas9, expressing the Cas9 protein driven by the nanos promoter, and U6-sgRNA, expressing sgRNAs driven by U6 promoter (Figure S2A). According to previous reports [31], there are four different transcript isoforms of BmOvo gene. These four isoforms all include exon 1 and three include exon 2. sgRNAs were designed to target sites in these exons (Figure 1A). By selecting the red and green fluorescence protein markers, we obtained binary lines that expressed Cas9 and sgRNA, respectively (Figure S2B).
The binary lines nos-Cas9 and U6-sgRNA were crossed and double fluorescence G1 individuals were obtained. These animals were subjected to somatic mutagenesis analysis. None of the BmOvo transcripts were detected in these lines (Figure 1A). Genome sequencing demonstrated successful deletion of the sequence between the two targeted sites in the BmOvo gene (Figure 1B). We used the primers F1 and R1 to detect the wild-type and mutant sequence. No PCR product was obtained from extracts of wild-type insects because the primer binding sites were about 16 kb apart, but PCR products were detected in mutants (Figure 1C,D).

3.3. Loss of BmOvo Results in Abnormal Development of Wings and Some Other Organs

Morphologically, there were no obvious differences in metamorphosis when BmOvo mutants were compared to WT animals in the larval stage. However, we found that pupal and adult wings were twisted and short and that female mutants were shorter than the wild type at the pupal stage (Figure 2A). The wing defect had no sexual bias; 85.9% and 84.2% of the female and male pupae were abnormal, respectively (Figure 2B,C). About 8% and 13% of wild-type female and male pupae, respectively, had a wing defect. Through the dissection, we also detected some abnormalities in the internal organs. The wing disc was atrophic and malformed when compared with the wild type (Figure S3a,a′), and the testes and ovaries of the mutants were smaller than those of the wild type in L5D3 larvae (Figure S3b–c′). For the female moth mutants, we found that the arrangement of eggs in the ovarioles was disordered when compared with the wild type (Figure S3d,d′). As a result of the defective wings, only 25% of mutants eclosed normally, whereas 88% of wild-type animals did (Figure 3). The failed or abnormal metamorphosis of pupa to adult appeared to be due to failure of wing extension from the puparium. These results demonstrate that BmOvo plays important roles in reproduction and wing development in B. mori.

3.4. BmOvo Influences Expression of Genes Involved in Wing Development and Metamorphosis

In order to investigate the mechanism that underlies BmOvo phenotypes, we used qRT-PCR to analyze the genes involved in wing development and pupal metamorphosis. Compared with the wild type, the expression of BmOvo-1 was significantly downregulated in female and male mutants (Figure 4). These results showed the BmOvo genes were disrupted successfully. The levels of wing development-related transcripts including wing cuticle protein genes BmWCP10, BmWCP5, BmWCP4, and BmWnt1 and metamorphosis-related genes BmFTZ-F1, BmUSP, BmE74, and BmBRC were quantified. BmWCP10, BmWnt1, and BmE74 were downregulated significantly in BmOvo mutants when compared to wild-type silkworms, and BmWCP4 was significantly upregulated in both female and male mutants (Figure 4). There were no significant differences in the expression of metamorphosis-related genes (Figure 4). These results suggest that BmOvo affects wing development by influencing the expression of wing development-related genes.

4. Discussion

In the present study, we analyzed the function of the BmOvo-1 gene in vivo by using the CRISPR/Cas9 genome editing system. Due to abnormal wing development, the BmOvo deletion mutants failed to eclose from the pupal stage to the adult stage. The wing discs, testes, and ovaries of the BmOvo mutants were atrophic and small when compared with the wild type at the L5D3 stage. In mutant female moths, the arrangement of eggs in the ovarioles was disordered when compared with wild-type females. These results demonstrate that the BmOvo gene plays an important role in wing development as well as reproduction in B. mori. In a previous study, Xue et al. used the RNAi method to inhibit the expression of BmOvo-1 and BmOvo-2 and demonstrated that both are involved in reproduction in the silkworm [31]. They did not report wing defects. The 20% decrease in mRNA levels might not be enough to cause wing malformation.
Insects are the most diversified and arguably the most successfully animal group, with more than two million species identified. Insects have invaded every conceivable ecological niche and are the dominant class of organisms on land. Acquisition of flight enabled insects to exploit new habitats and escape from unfavorable environments [38,39]. Wings are also important for predation and mating [40,41]. In butterflies, the wing patterns are variable and are involved in warning, coloration, mimicry, thermoregulation, and mate selection [42,43,44].
How insect wings evolved is not well understood, but the study of wings may shed light on insect evolution and development of morphological diversification and speciation [45,46]. Certain pathways and genes are known to influence wing development. Insect metamorphosis is orchestrated by the pathways regulated by the hormone JH and by the ecdysone pathway [47,48], and these pathways also affect wing development [49]. The wing disc forms during the larval stage [50]. In D. melanogaster, the wing disc consists of undifferentiated and proliferating cells [51]. In B. mori, during the larval stage, the wing discs undergo dramatic morphological changes and evaginate from the body to form the pupal wings [52]. These changes and processes are regulated by insect hormones and hundreds of genes [53]. Wing disc cuticle proteins (WCPs) play crucial roles in the stability of the cuticle layer [54,55]. At least 53 WCPs expressed by B. mori are downregulated by JH and upregulated by ecdysone [56,57,58,59].
In Drosophila, Svb and Ovo gene are located in a gene cluster. Ovo is required for female germline development and survival [6]. Most of the Svb coding sequence is shared with that of the Ovo gene. Svb encodes a zinc finger transcription factor homologous with BmOvo gene products [60]. In Drosophila, the Svb gene integrates opposing signals emanating from Wg and the EGF-receptor DER, which repress and activate Svb transcription, respectively [4]. The transcription factor encoded by Svb governs changes in epidermal cell shape and is a major regulator of epidermal development and differentiation [4].
In a previous report, BmOvo was implicated in segmentation [61]. When the expression of BmWnt1 was inhibited in the embryo stage, the expression pattern of BmOvo was altered, suggesting that BmOvo is regulated by BmWnt1 [61]. The Wnt pathway is involved in embryo development and wing disc formation [25,62]. When we analyzed the expression of the wing disc development-related genes BmWCP10, BmWCP5, BmWCP4, and BmWnt1 in the BmOvo mutants, we found that BmWCP10, BmWCP5, and BmWnt1 mRNAs were downregulated compared to levels in wild-type insects. Taken together, our results suggest that the transcription factor encoded by Ovo similarly contributes to the wing development in the silkworm.

5. Conclusions

In female BmOvo created using CRISPR/Cas9, eggs were abnormally shaped and disordered in the ovarioles. In male mutants, gonad development was abnormal. Moreover, knockout of BmOvo impaired wing development, and mutant silkworms failed to molt from the pupal stage. Genes involved in the WNT signaling pathway and wing development genes, BmWCP10 and BmE74, were downregulated in the BmOvo mutants when compared with the wild-type animals, suggesting that the transcription factor encoded by BmOvo is important for wing metamorphosis. The analyses described here demonstrate that BmOvo has functions in addition to those important for germline sex determination.

Supplementary Materials

The following are available online at https://www.mdpi.com/2075-4450/10/8/254/s1, Figure S1: The expression of BmOvo-1 in head, fat body (FB), wing disc (WD), epidermis (Epi), middle silk gland (MSG), posterior silk gland (PSG), midgut (MG), and gonad at L5D3. RNA was extracted and reverse transcribed to cDNA and analyzed by real-time PCR. Three individual biological replicates of real-time PCR were performed., Figure S2: Transgenic plasmid construction and identification of BmOvo knock-out lines. (A) Schematic of the binary transgenic CRISPR/Cas9 system, which involves one line for expression of the full-length Cas9 ORF driven by the nos promoter and another line for U6 promoter-driven expression of two sgRNAs. These two lines also contain the reporter genes EGFP and DsRed, respectively, under the control of the IE1 promoter. (B) Parental transgenic strains expressing Cas9 or sgRNA were established. Somatic mutations were induced in the F1 founder animals following crosses of these two strains. Red and green fluorescence in the entire body confirmed the presence of the appropriate transgene constructs. Scale bars, 1 mm., Figure S3: The BmOvo mutants showed abnormal wing discs, disorder eggs in the ovarioles, small testes and ovaries. (a) Wild-type and (a′) mutant wing disc at L5D3-stage. The black arrows indicate the atrophic and malformed region of wing disc in BmOvo mutant. (b) Wild-type and (b′) mutant testes at L5D3 stage. (c) Wild-type and (c′) mutant ovaries at L5D3 stage. (d) Wild-type and (d′) mutant ovarioles in adults. Scale bars, 0.5 mm.

Author Contributions

Y.H., K.L., and J.X. conceived and designed the experiments. H.B. and X.L. performed the experiments. H.B. and X.X. analyzed the data. H.B., J.X., and Y.Z. wrote the manuscript, and all authors approved the final version of the manuscript prior to submission.

Funding

This work was supported by grants from the National Science Foundation of China (31530072, 31420103918, and 31802005), the Strategic Priority Research Program of Chinese Academy of Sciences (XDB11010600), and the National Postdoctoral Program for Innovative Talents (BX201700268). We would like to thank Jacqueline Wyatt for proofreading the manuscript. We thank two anonymous reviewers for their constructive comments.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Piloto, S.; Schilling, T.F. Ovo1 links Wnt signaling with N-cadherin localization during neural crest migration. Development 2010, 137, 1981–1990. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Lapan, S.W.; Reddien, P.W. Transcriptome Analysis of the Planarian Eye Identifies ovo as a Specific Regulator of Eye Regeneration. Cell Rep. 2012, 2, 294–307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Dai, X.; Schonbaum, C.; Degenstein, L.; Bai, W.; Mahowald, A.; Fuchs, E. The ovo gene required for cuticle formation and oogenesis in flies is involved in hair formation and spermatogenesis in mice. Genes Dev. 1998, 12, 3452–3463. [Google Scholar] [CrossRef] [PubMed]
  4. Payre, F.; Vincent, A.; Carreno, S. Ovo/Svb integrates Wingless and DER pathways to control epidermis differentiation. Nature 1999, 400, 271–275. [Google Scholar] [CrossRef] [PubMed]
  5. Delon, I.; Chanutdelalande, H.; Payre, F. The Ovo/Shavenbaby transcription factor specifies actin remodelling during epidermal differentiation in Drosophila. Mech. Dev. 2003, 120, 747–758. [Google Scholar] [CrossRef]
  6. Mevelninio, M.; Terracol, R.; Kafatos, F.C. The ovo gene of Drosophila encodes a zinc finger protein required for female germ line development. EMBO J. 1991, 10, 2259–2266. [Google Scholar] [CrossRef]
  7. Zhu, M.; Hu, X.; Liang, Z.; Jiang, M.; Xue, R.; Gong, Y. Functional characterization of BmOVOs in silkworm, Bombyx mori. BMC Genom. 2019, 20, 342. [Google Scholar] [CrossRef] [PubMed]
  8. Garfinkel, M.; Wang, J.; Liang, Y.; Mahowald, A. Multiple products from the shavenbaby-OVO gene region of Drosophila melanogaster: Relationship to genetic complexity. Mol. Cell Biol. 1994, 14, 6809–6818. [Google Scholar] [CrossRef] [PubMed]
  9. Bielinska, B.; Lu, J.; Sturgill, D.; Oliver, B. Core promoter sequences contribute to OVO-B regulation in the Drosophila melanogaster germline. Genetics 2005, 169, 161–172. [Google Scholar] [CrossRef]
  10. Casper, A.; van Doren, M. The control of sexual identity in the Drosophila germline. Development 2006, 133, 2783–2791. [Google Scholar] [CrossRef]
  11. Oliver, B.; Singer, J.; Laget, V.; Pennetta, G.; Pauli, D. Function of Drosophila ovo+ in germ-line sex determination depends on X-chromosome number. Development 1994, 120, 3185–3195. [Google Scholar] [PubMed]
  12. Matova, N.; Cooley, L. Comparative Aspects of Animal Oogenesis. Dev. Biol. 2001, 231, 291–320. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Andrews, J.; Garcia-Estefania, D.; Delon, I.; Lü, J.; Mével-Ninio, M.; Spierer, A.; Payre, F.; Pauli, D.; Oliver, B. OVO transcription factors function antagonistically in the Drosophila female germline. Development 2000, 127, 881–892. [Google Scholar] [PubMed]
  14. Andrews, J.; Oliver, B. Sex determination signals control OVO-B transcription in Drosophila melanogaster germ cells. Genetics 2002, 160, 537–545. [Google Scholar] [PubMed]
  15. Nagoshi, R.; Patton, S.; Bae, E.; Geyer, P. The somatic sex determines the requirement for ovarian tumor gene activity in the proliferation of the Drosophila germline. Development 1995, 121, 579–587. [Google Scholar] [PubMed]
  16. Salles, C.; Mevelninio, M.; Vincent, A.; Payre, F. A Germline-Specific Splicing Generates an Extended Ovo Protein Isoform Required for Drosophila Oogenesis. Dev. Biol. 2002, 246, 366–376. [Google Scholar] [CrossRef] [PubMed]
  17. Tamura, T.; Thibert, C.; Royer, C.; Kanda, T.; Abraham, E.; Kamba, M.; Komoto, N.; Thomas, J.L.; Mauchamp, B.; Chavancy, G.; et al. Germline transformation of the silkworm Bombyx mori L. using a piggyback transposon-derived vector. Nat. Biotechnol. 2000, 18, 81–84. [Google Scholar] [CrossRef] [PubMed]
  18. Tan, A.; Tanaka, H.; Tamura, T.; Shiotsuki, T. Precocious metamorphosis in transgenic silkworms overexpressing juvenile hormone esterase. Proc. Natl. Acad. Sci. USA 2005, 102, 11751–11756. [Google Scholar] [CrossRef] [Green Version]
  19. Wang, Y.; Li, Z.; Xu, J.; Zeng, B.; Ling, L.; You, L.; Chen, Y.; Huang, Y.; Tan, A. The CRISPR/Cas system mediates efficient genome engineering in Bombyx mori. Cell Res. 2013, 23, 1414–1416. [Google Scholar] [CrossRef]
  20. Xu, J.; Wang, Y.; Li, Z.; Ling, L.; Zeng, B.; James, A.A.; Tan, A.; Huang, Y. Transcription activator-like effector nuclease (TALEN)-mediated female-specific sterility in the silkworm, Bombyx mori. Insect Mol. Boil. 2014, 23, 800–807. [Google Scholar] [CrossRef]
  21. Ma, S.; Chang, J.; Wang, X.; Liu, Y.; Zhang, J.; Lu, W.; Gao, J.; Shi, R.; Zhao, P.; Xia, Q. CRISPR/Cas9 mediated multiplex genome editing and heritable mutagenesis of BmKu70 in Bombyx mori. Sci. Rep. 2014, 4, 4489. [Google Scholar] [CrossRef] [PubMed]
  22. Daimon, T.; Uchibori, M.; Nakao, H.; Sezutsu, H.; Shinoda, T. Knockout silkworms reveal a dispensable role for juvenile hormones in holometabolous life cycle. Proc. Natl. Acad. Sci. USA 2015, 112, 4226–4235. [Google Scholar] [CrossRef] [PubMed]
  23. Dong, Z.; Dong, F.; Yu, X.; Huang, L.; Jiang, Y.; Hu, Z.; Chen, P.; Lu, C.; Pan, M. Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System. Front. Microbiol. 2018, 9, 209. [Google Scholar] [CrossRef] [PubMed]
  24. Sakai, H.; Sumitani, M.; Chikami, Y.; Yahata, K.; Uchino, K.; Kiuchi, T.; Suzuki, M.G. Transgenic Expression of the piRNA-Resistant Masculinizer Gene Induces Female-Specific Lethality and Partial Female-to-Male Sex Reversal in the Silkworm, Bombyx mori. PLoS Genet. 2016, 12, e1006203. [Google Scholar] [CrossRef] [PubMed]
  25. Ling, L.; Ge, X.; Li, Z.; Zeng, B.; Xu, J.; Chen, X.; Tan, A. MiR-2 family targets awd and fng to regulate wing morphogenesis in Bombyx mori. RNA Biol. 2015, 12, 742–748. [Google Scholar] [CrossRef] [PubMed]
  26. Zhang, Z.; Aslam, A.F.; Liu, X.; Li, M.; Huang, Y.; Tan, A. Functional analysis of bombyx wnt1 during embryogenesis using the CRISPR/Cas9 system. J. Insect Physiol. 2015, 79, 73–79. [Google Scholar] [CrossRef] [PubMed]
  27. Liu, Q.; Liu, W.; Zeng, B.; Wang, G.; Hao, D.; Huang, Y. Deletion of the Bombyx mori odorant receptor co-receptor (BmOrco) impairs olfactory sensitivity in silkworms. Insect Biochem. Mol. Biol. 2017, 86, 58. [Google Scholar] [CrossRef] [PubMed]
  28. Xu, J.; Chen, S.; Zeng, B.; James, A.; Tan, A.; Huang, Y. Bombyx mori p-element somatic inhibitor (BmPSI) is a key auxiliary factor for silkworm male sex determination. PLoS Genet. 2017, 13, e1006576. [Google Scholar] [CrossRef] [PubMed]
  29. Zeng, B.; Huang, Y.; Xu, J.; Shiotsuki, T.; Bai, H.; Palli, S.R.; Huang, Y.; Tan, A. The FOXO transcription factor controls insect growth and development by regulating juvenile hormone degradation in the silkworm, Bombyx mori. J. Boil. Chem. 2017, 292, 11659–11669. [Google Scholar] [CrossRef] [PubMed]
  30. Chen, S.; Hou, C.; Bi, H.; Wang, Y.; Xu, J.; Li, M.; James, A.A.; Huang, Y.; Tan, A. Transgenic Clustered Regularly Interspaced Short Palindromic Repeat/Cas9-Mediated Viral Gene Targeting for Antiviral Therapy of Bombyx mori Nucleopolyhedrovirus. J. Virol. 2017, 91. [Google Scholar] [CrossRef]
  31. Xue, R.; Hu, X.; Cao, G.; Huang, M.; Xue, G.; Qian, Y.; Gong, C. BmOvo-1 regulates ovary size in the silkworm, Bombyx mori. PLoS ONE 2014, 9. [Google Scholar] [CrossRef] [PubMed]
  32. Sander, J.; Joung, J. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 2014, 32, 347–355. [Google Scholar] [CrossRef] [PubMed]
  33. Naito, Y.; Hino, K.; Bono, H.; UiTei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics 2015, 31, 1120–1123. [Google Scholar] [CrossRef] [PubMed]
  34. Xu, J.; Chen, R.; Chen, S.; Chen, K.; Tang, L.; Yang, D.; Yang, X.; Zhang, Y.; Song, H.; Huang, Y. Identification of a germline-expression promoter for genome editing in Bombyx mori. Insect Sci. 2018. [Google Scholar] [CrossRef] [PubMed]
  35. Tanaka, H.; Fujita, K.; Sagisaka, A.; Tomimoto, K.; Imanishi, S.; Yamakawa, M. shRNA Expression Plasmids Generated by a Novel Method Efficiently Induce Gene-Specific Knockdown in a Silkworm Cell Line. Mol. Biotechnol. 2009, 41, 173–179. [Google Scholar] [CrossRef] [PubMed]
  36. Bi, H.; Xu, J.; Tan, A.; Huang, Y. CRISPR/Cas9-mediated targeted gene mutagenesis in Spodoptera litura. Insect Sci. 2016, 23, 469–477. [Google Scholar] [CrossRef] [PubMed]
  37. Li, Z.; You, L.; Yan, D.; James, A.; Huang, Y.; Tan, A. Bombyx mori histone methyltransferase BmAsh2 is essential for silkworm piRNA-mediated sex determination. PLoS Genet. 2018, 14, e1007245. [Google Scholar] [CrossRef] [PubMed]
  38. Trautwein, M.; Wiegmann, B.M.; Beutel, R.G.; Kjer, K.M.; Yeates, D.K. Advances in Insect Phylogeny at the Dawn of the Post genomic Era. Annu. Rev. Entomol. 2012, 57, 449–468. [Google Scholar] [CrossRef]
  39. Shimmi, O.; Matsuda, S.; Hatakeyama, M. Insights into the molecular mechanisms underlying diversified wing venation among insects. Proc. R. Soc. B Biol. Sci. 2014, 281, 20140264. [Google Scholar] [CrossRef] [Green Version]
  40. Ewing, A.W.; Bennetclark, H.C. The Courtship Songs of Drosophila. Behaviour 1968, 31, 288–301. [Google Scholar] [CrossRef]
  41. Ding, Y.; Berrocal, A.; Morita, T.; Longden, K.D.; Stern, D.L. Natural courtship song variation caused by an intronic retroelement in an ion channel gene. Nature 2016, 536, 329–332. [Google Scholar] [CrossRef] [PubMed]
  42. Brakefield, P.M.; French, V. Butterfly wings: The evolution of development of colour patterns. BioEssays 1999, 21, 391–401. [Google Scholar] [CrossRef]
  43. Nijhout, H.F. The Development and Evolution of Butterfly Wing Patterns; Smithsonian Institution Scholarly Press: Washington, DC, USA, 1991. [Google Scholar]
  44. Li, X.; Fan, D.; Zhang, W.; Liu, G.S.; Zhang, L.; Zhao, L.; Wang, W. Outbred genome sequencing and CRISPR/Cas9 gene editing in butterflies. Nat. Commun. 2015, 6, 8212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Beldade, P.; Brakefield, P.M. The genetics and evo-devo of butterfly wing patterns. Nat. Rev. Genet. 2002, 3, 442–452. [Google Scholar] [CrossRef] [PubMed]
  46. Mcmillan, W.O.; Monteiro, A.; Kapan, D.D. Development and evolution on the wing. Trends Ecol. Evol. 2002, 17, 125–133. [Google Scholar] [CrossRef]
  47. Gäde, G.; Hoffmann, K.H.; Spring, J.H. Hormonal regulation in insects: Facts, gaps, and future directions. Physiol. Rev. 1997, 77, 963–1032. [Google Scholar] [CrossRef]
  48. Jindra, M.; Palli, S.R.; Riddiford, L.M. The juvenile hormone signaling pathway in insect development. Annu. Rev. Entomol. 2013, 58, 181–204. [Google Scholar] [CrossRef] [PubMed]
  49. Zera, A.J. Juvenile Hormone and the endocrine regulation of wing polymorphism in insects: New insights from circadian and functional genomic studies in Gryllus crickets. Physiol. Entomol. 2016, 41, 313–326. [Google Scholar] [CrossRef]
  50. Ou, J.; Deng, H.; Zheng, S.; Huang, L.; Feng, Q.; Liu, L. Transcriptomic analysis of developmental features of Bombyx mori wing disc during metamorphosis. BMC Genom. 2014, 15, 820. [Google Scholar] [CrossRef]
  51. Klein, T. Wing disc development in the fly: The early stages. Curr. Opin. Genet. Dev. 2001, 11, 470–475. [Google Scholar] [CrossRef]
  52. Truman, J.; Riddiford, L. Endocrine Insights Into The Evolution Of Metamorphosis In Insects. Annu. Rev. Entomol. 2002, 47, 467–500. [Google Scholar] [CrossRef] [PubMed]
  53. Deng, H.; Zhang, J.; Li, Y.; Zheng, S.C.; Liu, L.; Huang, L.; Feng, Q. Homeodomain POU and Abd-A proteins regulate the transcription of pupal genes during metamorphosis of the silkworm, Bombyx mori. Proc. Natl. Acad. Sci. USA 2012, 109, 12598–12603. [Google Scholar] [CrossRef] [PubMed]
  54. Rebers, J.; Riddiford, L. Structure and expression of a manduca sexta larval cuticle gene homologous to drosophila cuticle genes. J. Mol. Biol. 1988, 203, 411–423. [Google Scholar] [CrossRef]
  55. Iconomidou, V.; Willis, J.; Hamodrakas, S. Unique features of the structural model of ‘hard’ cuticle proteins: Implications for chitin-protein interactions and cross-linking in cuticle. Insect Biochem. Mol. Biol. 2005, 35, 553–560. [Google Scholar] [CrossRef] [PubMed]
  56. Takeda, M.; Mita, K.; Quan, G.-X.; Shimada, T.; Okano, K.; Kanke, E.; Kawasaki, H. Mass isolation of cuticle protein cDNAs from wing discs of Bombyx mori and their characterizations. Insect Biochem. Mol. Biol. 2001, 31, 1019–1028. [Google Scholar] [CrossRef]
  57. Noji, T.; Ote, M.; Takeda, M.; Mita, K.; Shimada, T.; Kawasaki, H. Isolation and comparison of different ecdysone-responsive cuticle protein genes in wing discs of Bombyx mori. Insect Biochem. Mol. Biol. 2003, 33, 671–679. [Google Scholar] [CrossRef]
  58. Deng, H.; Zheng, S.; Yang, X.; Liu, L.; Feng, Q. Transcription factors BmPOUM2 and BmβFTZ-F1 are involved in regulation of the expression of the wing cuticle protein gene BmWCP4 in the silkworm, Bombyx mori. Insect Mol. Biol. 2011, 20, 45–60. [Google Scholar] [CrossRef] [PubMed]
  59. Deng, H.; Li, Y.; Zhang, J.; Liu, L.; Feng, Q. Analysis of expression and chitin-binding activity of the wing disc cuticle protein BmWCP4 in the silkworm, Bombyx mori. Insect Sci. 2016, 23, 782–790. [Google Scholar] [CrossRef] [PubMed]
  60. Mevelninio, M.; Terracol, R.; Salles, C.; Vincent, A.; Payre, F. OVO, a Drosophila gene required for ovarian development, is specifically expressed in the germline and shares most of its coding sequences with shavenbaby, a gene involved in embryo patterning. Mech. Dev. 1995, 49, 83–95. [Google Scholar] [CrossRef]
  61. Nakao, H. A Bombyx homolog of ovo is a segmentation gene that acts downstream of bm-wnt1 (bombyx wnt1 homolog). Gene Expr. Patterns 2018, 27, 1–7. [Google Scholar] [CrossRef]
  62. Zhang, Z.; Liu, X.; Shiotsuki, T.; Wang, Z.; Xu, X.; Huang, Y.; Li, M.; Li, K.; Tan, A. Depletion of juvenile hormone esterase extends larval growth in Bombyx mori. Insect Biochem. Mol. Biol. 2017, 81, 72–79. [Google Scholar] [CrossRef] [PubMed]
Insects 10 00254 g001 550
Figure 1. CRISPR/Cas9-induced mutagenesis results in knockout of BmOvo. (A) Schematic of the targeted region of BmOvo. The boxes indicate exons, and the black lines represent introns. The proto spacer adjacent motif (PAM) sequence is shown in red. The sgRNA target sites, S1 and S2, are located on the sense strand within exon 1 and exon 3, respectively. Binding sites for primers F1 and R1 are indicated. The sgRNA target sequence is shown. (B) Representative sequencing chromatogram of PCR products from the genome sequencing of BmOvo mutants. SITE1 and SITE2 indicate sequences of a portion of each target site sequence. In wild-type insects, the two target sites are separated by about 16 kb, but the target sites are adjacent in mutants where BmOvo has been knocked out. (C) Genomic PCR detected BmOvo deletion mutants. WT, wild type. M1, M2, and M3 are the mutants. (D) Sequences of BmOvo deletion mutants. The numbers in parentheses indicate the number of base pairs deleted between the two targeted regions relative to the wild-type sequence. The sequence in red indicates the PAM sequence.
Figure 1. CRISPR/Cas9-induced mutagenesis results in knockout of BmOvo. (A) Schematic of the targeted region of BmOvo. The boxes indicate exons, and the black lines represent introns. The proto spacer adjacent motif (PAM) sequence is shown in red. The sgRNA target sites, S1 and S2, are located on the sense strand within exon 1 and exon 3, respectively. Binding sites for primers F1 and R1 are indicated. The sgRNA target sequence is shown. (B) Representative sequencing chromatogram of PCR products from the genome sequencing of BmOvo mutants. SITE1 and SITE2 indicate sequences of a portion of each target site sequence. In wild-type insects, the two target sites are separated by about 16 kb, but the target sites are adjacent in mutants where BmOvo has been knocked out. (C) Genomic PCR detected BmOvo deletion mutants. WT, wild type. M1, M2, and M3 are the mutants. (D) Sequences of BmOvo deletion mutants. The numbers in parentheses indicate the number of base pairs deleted between the two targeted regions relative to the wild-type sequence. The sequence in red indicates the PAM sequence.
Insects 10 00254 g001
Insects 10 00254 g002 550
Figure 2. BmOvo mutants have abnormal wings in the pupal stage. (A) Photographs of wild-type and BmOvo mutant female (left) and male (right) silkworms in the pupal stage. Arrows indicate wing abnormalities. The back sides of the mutants are normal. Scale bar, 2 mm. (B) Fraction of female wild-type (n = 100) and BmOvo mutants (n = 78) with abnormal wings. Fraction of male wild-type (n = 100) and BmOvo mutants (n = 89) with abnormal wings. The asterisks indicate significant differences (** p < 0.01 and *** p < 0.001) compared with the wild type in the pupae stage determined using a two-tailed t-test.
Figure 2. BmOvo mutants have abnormal wings in the pupal stage. (A) Photographs of wild-type and BmOvo mutant female (left) and male (right) silkworms in the pupal stage. Arrows indicate wing abnormalities. The back sides of the mutants are normal. Scale bar, 2 mm. (B) Fraction of female wild-type (n = 100) and BmOvo mutants (n = 78) with abnormal wings. Fraction of male wild-type (n = 100) and BmOvo mutants (n = 89) with abnormal wings. The asterisks indicate significant differences (** p < 0.01 and *** p < 0.001) compared with the wild type in the pupae stage determined using a two-tailed t-test.
Insects 10 00254 g002
Insects 10 00254 g003 550
Figure 3. The BmOvo mutants do not undergo metamorphosis from the pupal to adult stage. (A) Images of wild-type and BmOvo mutant animals after the pupal to adult transition. Scale bar, 2 mm. (B) The fraction of wild-type (n = 200) and BmOvo mutant animals (n = 167) that eclosed normally. The asterisks indicate significant differences (** p < 0.01 and *** p < 0.001) compared with the wild type in the pupae stage determined using a two-tailed t-test.
Figure 3. The BmOvo mutants do not undergo metamorphosis from the pupal to adult stage. (A) Images of wild-type and BmOvo mutant animals after the pupal to adult transition. Scale bar, 2 mm. (B) The fraction of wild-type (n = 200) and BmOvo mutant animals (n = 167) that eclosed normally. The asterisks indicate significant differences (** p < 0.01 and *** p < 0.001) compared with the wild type in the pupae stage determined using a two-tailed t-test.
Insects 10 00254 g003
Insects 10 00254 g004 550
Figure 4. Genes involved in wing development are downregulated in the BmOvo mutants. (A) Levels of indicated mRNAs in female adult BmOvo mutants relative to wild-type levels. (B) Levels of indicated mRNAs in male adult BmOvo mutants relative to wild-type levels. Three individual biological replicates of real-time PCR were performed. The asterisks indicate significant differences (** p < 0.01 and *** p < 0.001) compared with the wild type in the adult stage determined using a two-tailed t-test.
Figure 4. Genes involved in wing development are downregulated in the BmOvo mutants. (A) Levels of indicated mRNAs in female adult BmOvo mutants relative to wild-type levels. (B) Levels of indicated mRNAs in male adult BmOvo mutants relative to wild-type levels. Three individual biological replicates of real-time PCR were performed. The asterisks indicate significant differences (** p < 0.01 and *** p < 0.001) compared with the wild type in the adult stage determined using a two-tailed t-test.
Insects 10 00254 g004
Table
Table 1. Primers used in this work.
Table 1. Primers used in this work.
Primer NamePrimer Sequence (5′ to 3′)Primer Purpose
Ovo-sgRNA1-FTATCGTGCTCTACAAGTGGTAAGGGGCCATCGTCAAG
GTTTTAGAGCTAGAAATAG		Preparation of sgRNA template
Ovo-sgRNA2-FTATCGTGCTCTACAAGTGGAGGTGCAGCTCCGTCTTC
GTTTTAGAGCTAGAAATAG		Preparation of sgRNA template
sgRNA-RTAGATATCAAGCTGCTAGAAAAAAAAGCACCGACTC
GGTGCC		Preparation of sgRNA template
F1ATGCCGAAAATCTTCTGGATTAAGDetection of mutations
R1GTTTTTGGTTGATGGACCGAGTGTDetection of mutations
Ovo-1-qFGCCCCTTACCGCTCCTTTCGqRT-PCR
Ovo-1-qRATCGCCTCCAAGAATCGATGqRT-PCR
RP49-qF TCAATCGGATCGCTATGACAqRT-PCR
RP49-qR ATGACGGGTCTTCTTGTTGGqRT-PCR
WCP10-qFTGGAGCACGCCTTCATATCAqRT-PCR
WCP10-qRGGACGGTGTAAACTTTGCCAqRT-PCR
WCP5-qFGCAGCCCCTTTGATTCAACAqRT-PCR
WCP5-qRCGTGTTGGGACTTGTGATCGqRT-PCR
WCP4-qFAGTCCACGAGGCTTCTTCqRT-PCR
WCP4-qRCCTTGCGGAATGAACCAqRT-PCR
Wnt1-qFCAGGGAATTCGTTGATACCGqRT-PCR
Wnt1-qRTCATCCAGCAAGTCTTCACGqRT-PCR
FTZ-F1-qF ATGCGTCGCCGAAAGAGCCTqRT-PCR
FTZ-F1-qRATTGCGACCACCGCGCATACqRT-PCR
USP-qFACACTTCGGGCAGCTAGAAqRT-PCR
USP-qRTCCGCGAGTCTACGTTCTCTqRT-PCR
E74-qF GCACAAGAACAAGCCAGACAqRT-PCR
E74-qR GTCGATCTCGACGATGTCCTqRT-PCR
BRC-qF AAAGGCCTCCCTGAAGAGACqRT-PCR
BRC-qRCGCGACTTGTGGTAGGTGTAqRT-PCR

Share and Cite

MDPI and ACS Style

Bi, H.; Xu, X.; Li, X.; Zhang, Y.; Huang, Y.; Li, K.; Xu, J. CRISPR Disruption of BmOvo Resulted in the Failure of Emergence and Affected the Wing and Gonad Development in the Silkworm Bombyx mori. Insects 2019, 10, 254. https://doi.org/10.3390/insects10080254

AMA Style

Bi H, Xu X, Li X, Zhang Y, Huang Y, Li K, Xu J. CRISPR Disruption of BmOvo Resulted in the Failure of Emergence and Affected the Wing and Gonad Development in the Silkworm Bombyx mori. Insects. 2019; 10(8):254. https://doi.org/10.3390/insects10080254

Chicago/Turabian Style

Bi, Honglun, Xia Xu, Xiaowei Li, Yong Zhang, Yongping Huang, Kai Li, and Jun Xu. 2019. "CRISPR Disruption of BmOvo Resulted in the Failure of Emergence and Affected the Wing and Gonad Development in the Silkworm Bombyx mori" Insects 10, no. 8: 254. https://doi.org/10.3390/insects10080254

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop