Foodborne Transmission of Deformed Wing Virus to Ants (Myrmica rubra)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Set-up
2.2. Preparation of DWV-Infected Honeybee Pupae
2.3. Feeding Regime
2.4. RNA Extraction
2.5. Reverse Transcription
2.6. Quantitative PCR
2.7. DWV Negative-Sense Strand Analyses
2.8. Statistical Analyses
3. Results
3.1. DWV Genomic Copies
3.2. Negative-Sense Strand Specific PCR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Daszak, P.; Cunningham, A.A.; Hyatt, A.D. Emerging infectious diseases of wildlife—Threats to biodiversity and human health. Science 2000, 287, 443–449. [Google Scholar] [CrossRef] [PubMed]
- Morens, D.M.; Folkers, G.K.; Fauci, A.S. The challenge of emerging and re-emerging infectious diseases. Nature 2004, 430. [Google Scholar] [CrossRef] [PubMed]
- Jones, K.E.; Patel, N.G.; Levy, M.A.; Storeygard, A.; Balk, D.; Gittleman, J.L.; Daszak, P. Global trends in emerging infectious diseases. Nature 2008, 451. [Google Scholar] [CrossRef] [PubMed]
- Longdon, B.; Brockhurst, M.A.; Russell, C.A.; Welch, J.J.; Jiggins, F.M. The evolution and genetics of virus host shifts. PLoS Pathog. 2014, 10, e1004395. [Google Scholar] [CrossRef] [PubMed]
- Hahn, B.H.; Shaw, G.M.; De, K.M.; Sharp, P.M. AIDS as a zoonosis: Scientific and public health implications. Science 2000, 287, 607–614. [Google Scholar] [CrossRef] [PubMed]
- Woolhouse, M.E.; Webster, J.P.; Domingo, E.; Charlesworth, B.; Levin, B.R. Biological and biomedical implications of the co-evolution of pathogens and their hosts. Nat. Genet. 2002, 32, 569. [Google Scholar] [CrossRef]
- Wolfe, N.D.; Dunavan, C.P.; Diamond, J. Origins of major human infectious diseases. Nature 2007, 447, 279. [Google Scholar] [CrossRef]
- Moya, A.; Holmes, E.C.; González-Candelas, F. The population genetics and evolutionary epidemiology of RNA viruses. Nat. Rev. Microbiol. 2004, 2, 279. [Google Scholar] [CrossRef]
- Woolhouse, M.E.; Haydon, D.T.; Antia, R. Emerging pathogens: The epidemiology and evolution of species jumps. Trends Ecol. Evol. 2005, 20, 238–244. [Google Scholar] [CrossRef]
- Potts, S.G.; Biesmeijer, J.C.; Kremen, C.; Neumann, P.; Schweiger, O.; Kunin, W.E. Global pollinator declines: Trends, impacts and drivers. Trends Ecol. Evol. 2010, 25, 345–353. [Google Scholar] [CrossRef]
- Neumann, P.; Carreck, N.L. Honey bee colony losses. J. Aic. Res. 2010, 49, 1–6. [Google Scholar] [CrossRef] [Green Version]
- Manley, R.; Boots, M.; Wilfert, L. Emerging viral disease risk to pollinating insects: Ecological, evolutionary and anthropogenic factors. J. Appl. Ecol. 2015, 52, 331–340. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Bayo, F.; Wyckhuys, K.A. Worldwide decline of the entomofauna: A review of its drivers. Biol. Conserv. 2019, 232, 8–27. [Google Scholar] [CrossRef]
- Fürst, M.; McMahon, D.P.; Osborne, J.; Paxton, R.; Brown, M. Disease associations between honeybees and bumblebees as a threat to wild pollinators. Nature 2014, 506, 364. [Google Scholar] [CrossRef] [PubMed]
- McMahon, D.P.; Fürst, M.A.; Caspar, J.; Theodorou, P.; Brown, M.J.; Paxton, R.J. A sting in the spit: Widespread cross-infection of multiple RNA viruses across wild and managed bees. J. Anim. Ecol. 2015, 84, 615–624. [Google Scholar] [CrossRef]
- Losey, J.E.; Vaughan, M. The economic value of ecological services provided by insects. Bioscience 2006, 56, 311–323. [Google Scholar] [CrossRef]
- Genersch, E.; Yue, C.; Fries, I.; de Miranda, J.R. Detection of deformed wing virus, a honey bee viral pathogen, in bumble bees (Bombus terrestris and Bombus pascuorum) with wing deformities. J. Invertebr. Pathol. 2006, 91, 61–63. [Google Scholar] [CrossRef]
- Zhang, X.; He, S.; Evans, J.; Pettis, J.; Yin, G.; Chen, Y. New evidence that deformed wing virus and black queen cell virus are multi-host pathogens. J. Invertebr. Pathol. 2012, 109, 156–159. [Google Scholar] [CrossRef]
- Levitt, A.L.; Singh, R.; Cox-Foster, D.L.; Rajotte, E.; Hoover, K.; Ostiguy, N.; Holmes, E.C. Cross-species transmission of honey bee viruses in associated arthropods. Virus Res. 2013, 176, 232–240. [Google Scholar] [CrossRef]
- Ravoet, J.; De Smet, L.; Meeus, I.; Smagghe, G.; Wenseleers, T.; de Graaf, D.C. Widespread occurrence of honey bee pathogens in solitary bees. J. Invertebr. Pathol. 2014, 122, 55–58. [Google Scholar] [CrossRef]
- Martin, S.J.; Brettell, L.E. Deformed wing virus in Honeybees and other Insects. Ann. Rev. Virol. 2019, 6. [Google Scholar] [CrossRef] [PubMed]
- De Miranda, J.R.; Genersch, E. Deformed wing virus. J. Invertebr. Pathol. 2010, 103, 48–61. [Google Scholar] [CrossRef] [PubMed]
- Dainat, B.; Evans, J.D.; Chen, Y.P.; Gauthier, L.; Neumann, P. Predictive markers of honey bee colony collapse. PLoS ONE 2012, 7, e32151. [Google Scholar] [CrossRef] [PubMed]
- Dainat, B.; Neumann, P. Clinical signs of deformed wing virus infection are predictive markers for honey bee colony losses. J. Invertebr. Pathol. 2013, 112, 278–280. [Google Scholar] [CrossRef] [PubMed]
- Martin, S.J.; Highfield, A.C.; Brettell, L.; Villalobos, E.M.; Budge, G.E.; Powell, M.; Nikaido, S.; Schroeder, D.C. Global honey bee viral landscape altered by a parasitic mite. Science 2012, 336, 1304–1306. [Google Scholar] [CrossRef] [PubMed]
- Neumann, P.; Yañez, O.; Fries, I.; de Miranda, J.R. Varroa invasion and virus adaptation. Trends Parasitol. 2012, 28, 353–354. [Google Scholar] [CrossRef]
- Wilfert, L.; Long, G.; Leggett, H.; Schmid-Hempel, P.; Butlin, R.; Martin, S.; Boots, M. Deformed wing virus is a recent global epidemic in honeybees driven by Varroa mites. Science 2016, 351, 594–597. [Google Scholar] [CrossRef]
- Manley, R.; Temperton, B.; Doyle, T.; Gates, D.; Hedges, S.; Boots, M.; Wilfert, L. Knock-on community impacts of a novel vector: Spillover of emerging DWV-B from Varroa-infested honeybees to wild bumblebees. Ecol. Lett. 2019. [Google Scholar] [CrossRef]
- Celle, O.; Blanchard, P.; Olivier, V.; Schurr, F.; Cougoule, N.; Faucon, J.-P.; Ribière, M. Detection of Chronic bee paralysis virus (CBPV) genome and its replicative RNA form in various hosts and possible ways of spread. Virus Res. 2008, 133, 280–284. [Google Scholar] [CrossRef] [Green Version]
- Yañez, O.; Zheng, H.-Q.; Hu, F.-L.; Neumann, P.; Dietemann, V. A scientific note on Israeli acute paralysis virus infection of Eastern honeybee Apis cerana and vespine predator Vespa velutina. Apidologie 2012, 43, 587–589. [Google Scholar] [CrossRef]
- Forzan, M.; Sagona, S.; Mazzei, M.; Felicioli, A. Detection of deformed wing virus in Vespa crabro. Bull. Insect. 2017, 70, 261–265. [Google Scholar]
- Mazzei, M.; Forzan, M.; Cilia, G.; Sagona, S.; Bortolotti, L.; Felicioli, A. First detection of replicative deformed wing virus (DWV) in Vespa velutina nigrithorax. Bull. Insect 2018, 71, 211–216. [Google Scholar]
- Evans, J.D.; Spivak, M. Socialized medicine: Individual and communal disease barriers in honey bees. J. Invertebr. Pathol. 2010, 103, 62–72. [Google Scholar] [CrossRef] [PubMed]
- Spivak, M.; Downey, D.L. Field assays for hygienic behavior in honey bees (Hymenoptera: Apidae). J. Econ. Entom. 1998, 91, 64–70. [Google Scholar] [CrossRef]
- Spivak, M.; Gilliam, M. Hygienic behaviour of honey bees and its application for control of brood diseases and Varroa: Part I. Hygienic behaviour and resistance to American foulbrood. Bee World 1998, 79, 124–134. [Google Scholar] [CrossRef]
- Baracchi, D.; Fadda, A.; Turillazzi, S. Evidence for antiseptic behaviour towards sick adult bees in honey bee colonies. J. Insect Physiol. 2012, 58, 1589–1596. [Google Scholar] [CrossRef] [Green Version]
- Sébastien, A.; Lester, P.J.; Hall, R.J.; Wang, J.; Moore, N.E.; Gruber, M.A. Invasive ants carry novel viruses in their new range and form reservoirs for a honeybee pathogen. Biol. Lett. 2015, 11, 20150610. [Google Scholar] [CrossRef]
- Cooling, M.; Gruber, M.; Hoffmann, B.; Sébastien, A.; Lester, P. A metatranscriptomic survey of the invasive yellow crazy ant, Anoplolepis gracilipes, identifies several potential viral and bacterial pathogens and mutualists. Insectes Sociaux 2017, 64, 197–207. [Google Scholar] [CrossRef]
- Gruber, M.A.; Cooling, M.; Baty, J.W.; Buckley, K.; Friedlander, A.; Quinn, O.; Russell, J.F.; Sébastien, A.; Lester, P.J. Single-stranded RNA viruses infecting the invasive Argentine ant, Linepithema humile. Sci. Rep. 2017, 7. [Google Scholar] [CrossRef]
- Lavelle, P.; Decaens, T.; Aubert, M.; Barot, S.; Blouin, M.; Bureau, F.; Margerie, P.; Mora, P.; Rossi, J.P. Soil invertebrates and ecosystem services. Eur. J. Soil. Biol. 2006, 42, 3–15. [Google Scholar] [CrossRef]
- Sanders, D.; van Veen, F.J.F. Ecosystem engineering and predation: The multi-trophic impact of two ant species. J. Anim. Ecol. 2011, 80, 569–576. [Google Scholar] [CrossRef] [PubMed]
- Del Toro, I.; Ribbons, R.R.; Pelini, S.L. The little things that run the world revisited: A review of ant-mediated ecosystem services and disservices (Hymenoptera: Formicidae). Myrmecol. News 2012, 17, 133–146. [Google Scholar]
- Folgarait, P.J. Ant biodiversity and its relationship to ecosystem functioning: A review. Biodivers Conserv. 1998, 7, 1221–1244. [Google Scholar] [CrossRef]
- Simberloff, D.; Gibbons, L. Now you see them, now you don’t!–population crashes of established introduced species. Biol. Invasions 2004, 6, 161–172. [Google Scholar] [CrossRef]
- Nelson, M.I.; Holmes, E.C. The evolution of epidemic influenza. Nat. Rev. Genet. 2007, 8, 196. [Google Scholar] [CrossRef] [PubMed]
- Seifert, B. Die Ameisen Mittel—und Nordeuropas; Lutra Verlags und Vertriebsgesellschaft: Tauer, Germany, 2007; p. 368. [Google Scholar]
- Groden, E.; Drummond, F.A.; Garnas, J.; Francoeur, A. Distribution of an invasive ant, Myrmica rubra (Hymenoptera: Formicidae), in Maine. J. Econ. Entom. 2005, 98, 1774–1784. [Google Scholar] [CrossRef] [PubMed]
- Craggs, J.K.; Ball, J.K.; Thomson, B.J.; Irving, W.L.; Grabowska, A.M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J. Virol. Methods 2001, 94, 111–120. [Google Scholar] [CrossRef]
- Yue, C.; Genersch, E. RT-PCR analysis of Deformed wing virus in honeybees (Apis mellifera) and mites (Varroa destructor). J. Gen. Virol. 2005, 86, 3419–3424. [Google Scholar] [CrossRef]
- Antstore. Ameisenshop. Available online: https://www.antstore.net/shop/de/Ameisen/Ameisen-aus-Mitteleuropa/Myrmica-rubra.html (accessed on 15 August 2019).
- Depickère, S.; Fresneau, D.; Deneubourg, J.-L. The influence of red light on the aggregation of two castes of the ant, Lasius niger. J. Insect Physiol. 2004, 50, 629–635. [Google Scholar] [CrossRef]
- De Miranda, J.R.; Bailey, L.; Ball, B.V.; Blanchard, P.; Budge, G.E.; Chejanovsky, N.; Chen, Y.-P.; Gauthier, L.; Genersch, E.; De Graaf, D.C. Standard methods for virus research in Apis mellifera. J. Apic. Res. 2013, 52, 1–56. [Google Scholar] [CrossRef]
- Williams, G.R.; Alaux, C.; Costa, C.; Csaki, T.; Doublet, V.; Eisenhardt, D.; Fries, I.; Kuhn, R.; McMahon, D.P.; Medrzycki, P.; et al. Standard methods for maintaining adult Apis mellifera in cages under in vitro laboratory conditions. J. Apic. Res. 2013, 52, 1–36. [Google Scholar] [CrossRef]
- Tritschler, M.; Vollmann, J.J.; Yañez, O.; Chejanovsky, N.; Crailsheim, K.; Neumann, P. Protein nutrition governs within-host race of honey bee pathogens. Sci. Rep. 2017, 7, 14988. [Google Scholar] [CrossRef] [PubMed]
- Hölldobler, B.; Wilson, E.O. The multiple recruitment systems of the African weaver ant Oecophylla longinoda (Latreille) (Hymenoptera: Formicidae). Behav. Ecol. Sociob. 1978, 3, 19–60. [Google Scholar] [CrossRef]
- Czaczkes, T.J.; Heinze, J.; Ruther, J. Nest etiquette—where ants go when nature calls. PLoS ONE 2015, 10, e0118376. [Google Scholar] [CrossRef]
- Evans, J.D.; Schwarz, R.S.; Chen, Y.P.; Budge, G.; Cornman, R.S.; De la Rua, P.; de Miranda, J.R.; Foret, S.; Foster, L.; Gauthier, L. Standard methods for molecular research in Apis mellifera. J. Apic. Res. 2013, 52, 1–54. [Google Scholar] [CrossRef]
- Tentcheva, D.; Gauthier, L.; Bagny, L.; Fievet, J.; Dainat, B.; Cousserans, F.; Colin, M.E.; Bergoin, M. Comparative analysis of deformed wing virus (DWV) RNA in Apis mellifera and Varroa destructor. Apidologie 2006, 37, 41–50. [Google Scholar] [CrossRef]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
- Yañez, O.; Jaffé, R.; Jarosch, A.; Fries, I.; Moritz, R.F.; Paxton, R.J.; de Miranda, J.R. Deformed wing virus and drone mating flights in the honey bee (Apis mellifera): Implications for sexual transmission of a major honey bee virus. Apidologie 2012, 43, 17–30. [Google Scholar] [CrossRef]
- Mondet, F.; de Miranda, J.R.; Kretzschmar, A.; Le Conte, Y.; Mercer, A.R. On the front line: Quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 2014, 10, e1004323. [Google Scholar] [CrossRef]
- Kevill, J.; Highfield, A.; Mordecai, G.; Martin, S.; Schroeder, D. ABC assay: Method development and application to quantify the role of three DWV master variants in overwinter colony losses of European honey bees. Viruses 2017, 9, 314. [Google Scholar] [CrossRef]
- Gauthier, L.; Tentcheva, D.; Tournaire, M.; Dainat, B.; Cousserans, F.; Colin, M.E.; Bergoin, M. Viral load estimation in asymptomatic honey bee colonies using the quantitative RT-PCR technique. Apidologie 2007, 38, 426–435. [Google Scholar] [CrossRef] [Green Version]
- R Core Team. R: A Language and Environment for Statistical Computing, R version 3.5.1 (2018-07-02); R Foundation for Statistical Computing: Vienna, Austria, 2018. [Google Scholar]
- RStudio Team. RStudio: Integrated Development Environment for R; RStudio, Inc.: Boston, MA, USA, 2016. [Google Scholar]
- Bates, D.; Mächler, M.; Bolker, B.; Walker, S. Fitting linear mixed-effects models using lme4. arXiv 2014, arXiv:1406.5823. [Google Scholar] [CrossRef]
- Zioni, N.; Soroker, V.; Chejanovsky, N. Replication of Varroa destructor virus 1 (VDV-1) and a Varroa destructor virus 1–deformed wing virus recombinant (VDV-1–DWV) in the head of the honey bee. Virology 2011, 417, 106–112. [Google Scholar] [CrossRef] [PubMed]
- Zółtowska, K.; Fraczek, R.; Lipinski, Z. Hydrolases of developing worker brood and newly emerged worker of Apis mellifera carnica. J. Apic. Sci. 2011, 51, 27–37. [Google Scholar] [CrossRef]
- Brian, M. Feeding and growth in the ant Myrmica. J. Anim. Ecol. 1973, 37–53. [Google Scholar] [CrossRef]
- Shorter, J.; Rueppell, O. A review on self-destructive defense behaviors in social insects. Insectes Sociaux 2012, 59, 1–10. [Google Scholar] [CrossRef]
- Hölldobler, B.; Wilson, E.O. The Ants; Springer: Berlin, Germany, 1990; p. 732. [Google Scholar]
- Posada-Florez, F.; Childers, A.K.; Heerman, M.C.; Egekwu, N.I.; Cook, S.C.; Chen, Y.; Evans, J.D.; Ryabov, E.V. Deformed wing virus type A, a major honey bee pathogen, is vectored by the mite Varroa destructor in a non-propagative manner. bioRxiv 2019. [Google Scholar] [CrossRef]
- Stroeymeyt, N.; Casillas-Pérez, B.; Cremer, S. Organisational immunity in social insects. Curr. Opin. Insect Sci. 2014, 5, 1–15. [Google Scholar] [CrossRef]
Target | Primer | Sequence (5′–3′) | Size [bp] | Reference |
---|---|---|---|---|
DWV | DWV-F8668 | TTCATTAAAGCCACCTGGAACATC | 136 | [60] |
DWV-B8757 | TTTCCTCATTAACTGTGTCGTTGA | 136 | ||
DWV | DWVnew-F1 | TACTAGTGCTGGTTTTCCTTT | [62] | |
DWV-A | DWVA-R1 | CTCATTAACTGTGTCGTTGAT | 155 | [62] |
DWV-B | DWVB-R1 | CTCATTAACTGAGTTGTTGTC | 155 | [62] |
DWV-C | DWVC-R1 | ATAAGTTGCGTGGTTGAC | 152 | [62] |
TMV | TMVQ1-fwd | TGTAGCGCAATGGCGTACAC | 55 | [58] |
TMVQ1-rev | CATGCGAACATCAGCC AATG | 55 | ||
DWV minus-strand | DWV 3F-Tag | AGCCTGCGCACCGTGG–GGATGTTATCTCCTGCGTGGAA | 221 | [63] |
Tag | AGCCTGCGCACCGTGG | 221 | [49] | |
DWV4-R1 | TGTCGAAACGGTATGGTAAACT | 221 | This study |
Viral Titer (Log Mean ± sd) | ||||
---|---|---|---|---|
Treatment | Week 13 | Week 14 | Week 15 | Week 16 |
Control | 4.77 ± 1.42 [3] | 4.26 ± 0.12 [3] | 3.44 ± 0.29 [3] | 4.27 [1] |
Treatment 1 | 8.32 ± 0.41 [6] | 8.48 ± 0.77 [6] | 7.52 ± 0.58 [6] | 7.37 ± 0.41 [5] |
Treatment 2 | 9.47 ± 0.51 [6] | 8.47 ± 0.48 [6] | 8.01 ± 0.65 [6] | 7.12 ± 0.65 [6] |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schläppi, D.; Lattrell, P.; Yañez, O.; Chejanovsky, N.; Neumann, P. Foodborne Transmission of Deformed Wing Virus to Ants (Myrmica rubra). Insects 2019, 10, 394. https://doi.org/10.3390/insects10110394
Schläppi D, Lattrell P, Yañez O, Chejanovsky N, Neumann P. Foodborne Transmission of Deformed Wing Virus to Ants (Myrmica rubra). Insects. 2019; 10(11):394. https://doi.org/10.3390/insects10110394
Chicago/Turabian StyleSchläppi, Daniel, Patrick Lattrell, Orlando Yañez, Nor Chejanovsky, and Peter Neumann. 2019. "Foodborne Transmission of Deformed Wing Virus to Ants (Myrmica rubra)" Insects 10, no. 11: 394. https://doi.org/10.3390/insects10110394
APA StyleSchläppi, D., Lattrell, P., Yañez, O., Chejanovsky, N., & Neumann, P. (2019). Foodborne Transmission of Deformed Wing Virus to Ants (Myrmica rubra). Insects, 10(11), 394. https://doi.org/10.3390/insects10110394