Microparticles as Viral RNA Carriers from Stool for Stable and Sensitive Surveillance
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. Stool Sample Collection and Preparation
2.3. Primer and Taqman Probe Design
2.4. Fabrication of PIN Particles
2.5. Synthetic RNA Template and Virus Stock Preparation
2.6. Extraction of Control Viral RNA
2.7. Heat Treatment for Viral Lysis
2.8. PIN-cDNA Pool Generation and Conventional cDNA Synthesis
2.9. Conventional and PIN RT-qPCR
2.10. Viral RNA Delivery for qPCR
2.11. Limit of Detection (LoD) and PCR Efficiency
2.12. PIN-cDNA Pool Storage Conditions
2.13. Gel Electrophoresis
2.14. Nucleotide Sequencing
2.15. Data Analysis
3. Results and Discussion
3.1. Principle of the Assay
3.2. Structural Characteristics of PIN
3.3. Heat Treatment for Viral Lysis: The First Step
3.4. Viral RNA Capture and cDNA Synthesis: The Second Step
3.5. The qPCR and Limit of Detection: The Third Step
3.6. Storage Conditions for PIN-cDNA Pools
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yang, S.; Rothman, E.R. PCR-based diagnostics for infectious diseases: Uses, limitations, and future applications in acute-care settings. Lancet Infect. Dis. 2004, 4, 337–348. [Google Scholar] [CrossRef] [Scilit]
- Artika, I.M.; Wiyatno, A.; Ma’Roef, C.N. Pathogenic viruses: Molecular detection and characterization. Infect. Genet. Evol. 2020, 81, 104215. [Google Scholar] [CrossRef] [Scilit]
- Sciuto, E.L.; Leonardi, A.A.; Calabrese, G.; De Luca, G.; Coniglio, M.A.; Irrera, A.; Conoci, S. Nucleic Acids Analytical Methods for Viral Infection Diagnosis: State-of-the-Art and Future Perspectives. Biomolecules 2021, 11, 1585. [Google Scholar] [CrossRef] [Scilit]
- Freije, C.A.; Sabeti, P.C. Detect and destroy: CRISPR-based technologies for the response against viruses. Cell Host Microbe 2021, 29, 689–703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dronina, J.; Samukaite-Bubniene, U.; Ramanavicius, A. Advances and insights in the diagnosis of viral infections. J. Nanobiotechnol. 2021, 19, 1–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lau, A.; Ren, C.L.; Lee, L.P. Critical review on where CRISPR meets molecular diagnostics. Prog. Biomed. Eng. 2020, 3, 012001. [Google Scholar] [CrossRef] [Scilit]
- Holland, N.T.; Smith, M.T.; Eskenazi, B.; Bastaki, M. Biological sample collection and processing for molecular epidemiological studies. Rev. Mutat. Res. 2003, 543, 217–234. [Google Scholar] [CrossRef] [Scilit]
- Cassedy, A.; Parle-McDermott, A.; O’Kennedy, R. Virus Detection: A Review of the Current and Emerging Molecular and Immunological Methods. Front. Mol. Biosci. 2021, 8, 637559. [Google Scholar] [CrossRef] [Scilit]
- Berensmeier, S. Magnetic particles for the separation and purification of nucleic acids. Appl. Microbiol. Biotechnol. 2006, 73, 495–504. [Google Scholar] [CrossRef] [Scilit]
- Wallinger, C.; Staudacher, K.; Sint, D.; Thalinger, B.; Oehm, J.; Juen, A.; Traugott, M. Evaluation of an automated protocol for efficient and reliable DNA extraction of dietary samples. Ecol. Evol. 2017, 7, 6382–6389. [Google Scholar] [CrossRef] [Scilit]
- Abusleme, L.; Hong, B.-Y.; Dupuy, A.K.; Strausbaugh, L.D.; Diaz, P.I. Influence of DNA extraction on oral microbial profiles obtained via 16S rRNA gene sequencing. J. Oral Microbiol. 2014, 6, 23990. [Google Scholar] [CrossRef] [Scilit]
- Steinberg, N.; Kolodkin-Gal, I. The Matrix Reloaded: Probing the Extracellular Matrix Synchronizes Bacterial Communities. J. Bacteriol. 2015, 197, 2092–2103. [Google Scholar] [CrossRef] [Scilit]
- Fidler, G.; Tolnai, E.; Stagel, A.; Remenyik, J.; Stundl, L.; Gal, F.; Biro, S.; Paholcsek, M. Tendentious effects of automated and manual metagenomic DNA purification protocols on broiler gut microbiome taxonomic profiling. Sci. Rep. 2020, 10, 3419. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oldham, A.L.; Drilling, H.S.; Stamps, B.W.; Stevenson, B.S.; Duncan, E.K. Automated DNA extraction platforms offer solutions to challenges of assessing microbial biofouling in oil production facilities. AMB Express 2012, 2, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Nechvatal, J.M.; Ram, J.L.; Basson, M.D.; Namprachan, P.; Niec, S.R.; Badsha, K.Z.; Matherly, L.H.; Majumdar, A.P.; Kato, I. Fecal collection, ambient preservation, and DNA extraction for PCR amplification of bacterial and human markers from human feces. J. Microbiol. Methods 2008, 72, 124–132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bataille, A.; Kwiatek, O.; Belfkhi, S.; Mounier, L.; Parida, S.; Mahapatra, M.; Caron, A.; Chubwa, C.C.; Keyyu, J.; Kock, R.; et al. Optimization and evaluation of a non-invasive tool for peste des petits ruminants surveillance and control. Sci. Rep. 2019, 9, 4742. [Google Scholar] [CrossRef] [Scilit]
- Dhumpa, R.; Handberg, K.J.; Jørgensen, P.H.; Yi, S.; Wolff, A.; Bang, D.D. Rapid detection of avian influenza virus in chicken fecal samples by immunomagnetic capture reverse transcriptase–polymerase chain reaction assay. Diagn. Microbiol. Infect. Dis. 2011, 69, 258–265. [Google Scholar] [CrossRef] [Scilit]
- Knutie, S.A.; Gotanda, K.M. A Non-invasive Method to Collect Fecal Samples from Wild Birds for Microbiome Studies. Microb. Ecol. 2018, 76, 851–855. [Google Scholar] [CrossRef] [Scilit]
- Bjustrom-Kraft, J.; Woodard, K.; Giménez-Lirola, L.; Rotolo, M.; Wang, C.; Sun, Y.; Lasley, P.; Zhang, J.; Baum, D.; Gauger, P.; et al. Porcine epidemic diarrhea virus (PEDV) detection and antibody response in commercial growing pigs. BMC Veter Res. 2016, 12, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Davies, K.; Goatley, L.C.; Guinat, C.; Netherton, C.L.; Gubbins, S.; Dixon, L.K.; Reis, A.L. Survival of African Swine Fever Virus in Excretions from Pigs Experimentally Infected with the Georgia 2007/1 Isolate. Transbound. Emerg. Dis. 2017, 64, 425–431. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Monini, M.; Di Bartolo, I.; Ianiro, G.; Angeloni, G.; Magistrali, C.F.; Ostanello, F.; Ruggeri, F.M. Detection and molecular characterization of zoonotic viruses in swine fecal samples in Italian pig herds. Arch. Virol. 2015, 160, 2547–2556. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Monteiro, L.; Bonnemaison, D.; Vekris, A.; Petry, K.G.; Bonnet, J.; Vidal, R.; Cabrita, J.; Mégraud, F. Complex polysaccharides as PCR inhibitors in feces: Helicobacter pylori model. J. Clin. Microbiol. 1997, 35, 995–998. [Google Scholar] [CrossRef] [Scilit]
- Kumar, J.; Kumar, M.; Gupta, S.; Ahmed, V.; Bhambi, M.; Pandey, R.; Chauhan, N.S. An Improved Methodology to Overcome Key Issues in Human Fecal Metagenomic DNA Extraction. Genom. Proteom. Bioinform. 2016, 14, 371–378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McOrist, A.L.; Jackson, M.; Bird, A.R. A comparison of five methods for extraction of bacterial DNA from human faecal samples. J. Microbiol. Methods 2002, 50, 131–139. [Google Scholar] [CrossRef] [Scilit]
- Oikarinen, S.; Tauriainen, S.; Viskari, H.; Simell, O.; Knip, M.; Virtanen, S.; Hyöty, H. PCR inhibition in stool samples in relation to age of infants. J. Clin. Virol. 2009, 44, 211–214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shulman, L.M.; Hindiyeh, M.; Muhsen, K.; Cohen, D.; Mendelson, E.; Sofer, D. Evaluation of Four Different Systems for Extraction of RNA from Stool Suspensions Using MS-2 Coliphage as an Exogenous Control for RT-PCR Inhibition. PLoS ONE 2012, 7, e39455. [Google Scholar] [CrossRef] [Scilit]
- Das, A.; Spackman, E.; Pantin-Jackwood, M.J.; Suarez, D.L. Removal of real-time reverse transcription polymerase chain reaction (RT-PCR) inhibitors associated with cloacal swab samples and tissues for improved diagnosis of Avian influenza virus by RT-PCR. J. Veter Diagn. Investig. 2009, 21, 771–778. [Google Scholar] [CrossRef] [Scilit]
- Spackman, E.; Senne, D.A.; Myers, T.J.; Bulaga, L.L.; Garber, L.P.; Perdue, M.L.; Lohman, K.; Daum, L.T.; Suarez, D.L. Development of a Real-Time Reverse Transcriptase PCR Assay for Type A Influenza Virus and the Avian H5 and H7 Hemagglutinin Subtypes. J. Clin. Microbiol. 2002, 40, 3256–3260. [Google Scholar] [CrossRef] [Scilit]
- Holmes, D.; Quigley, M. A rapid boiling method for the preparation of bacterial plasmids. Anal. Biochem. 1981, 114, 193–197. [Google Scholar] [CrossRef] [Scilit]
- Islam, M.S.; Aryasomayajula, A.; Selvaganapathy, P.R. A Review on Macroscale and Microscale Cell Lysis Methods. Micromachines 2017, 8, 83. [Google Scholar] [CrossRef] [Scilit]
- Xing, N.; Guan, X.; An, B.; Cui, B.; Wang, Z.; Wang, X.; Zhang, X.; Du, Q.; Zhao, X.; Huang, Y.; et al. Ultrasensitive Detection of Porcine Epidemic Diarrhea Virus from Fecal Samples Using Functionalized Nanoparticles. PLoS ONE 2016, 11, e0167325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, L.; Chen, J.; Li, X.; Qiao, D.; Wang, Z.; Wu, X.; Du, Q.; Tong, D.; Huang, Y. Establishment of method for dual simultaneous detection of PEDV and TGEV by combination of magnetic micro-particles and nanoparticles. J. Infect. Chemother. 2020, 26, 523–526. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fomsgaard, A.S.; Rosenstierne, M.W. An alternative workflow for molecular detection of SARS-CoV-2—Escape from the NA extraction kit-shortage, Copenhagen, Denmark, March 2020. Eurosurveillance 2020, 25, 2000398. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mancini, F.; Barbanti, F.; Scaturro, M.; Errico, G.; Iacobino, A.; Bella, A.; Riccardo, F.; Marsili, G.; Stefanelli, P.; Pezzotti, P.; et al. Laboratory management for SARS-CoV-2 detection: A user-friendly combination of the heat treatment approach and rt-Real-time PCR testing. Emerg. Microbes Infect. 2020, 9, 1393–1396. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Species | Type | Sequence Information (5′–3′) | Size |
|---|---|---|---|
| IAV H1N1, M gene | F: | Acrydite-AGATGAGTCTTCTAACCGAGGTCG | 101 bp |
| R: | TGCAAAAACATCTTCAAGTCTCTG | ||
| P: | 6-FAM-TCAGGCCCCCTCAAAGCCGA-BHQ_1 | ||
| T: | TGCAAACACATCTTCAAGTCTCTGCGCGATCTCGGCTTTGCGGGGGCCTGACGGGACGATAGAGAGAACGTACGTTTCGTCCTCGGTTAGAAGACTCATCT |
| Average Ct Values | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Temperature | 60 °C | SD | 80 °C | SD | 100 °C | SD | 120 °C | SD | |
| Time in minutes | 1 | 30.11 | 1.97 | 28.75 | 2.01 | 25.54 | 0.62 | 22.74 | 0.24 |
| 3 | 27.83 | 0.56 | 25.36 | 0.07 | 22.39 | 0.72 | 21.50 | 0.87 | |
| 5 | 30.67 | 2.33 | 25.18 | 0.40 | 22.62 | 0.82 | 21.46 | 0.70 | |
| 10 | 27.76 | 1.26 | 24.69 | 0.67 | 22.23 | 0.16 | - | - | |
| Control; No heat treatment Ct = 27.79 SD, 0.50 | |||||||||
| Average Ct Values | ||||
|---|---|---|---|---|
| Number of PIN Particles | 1 g of Stool/10 mL | SD | 5 g of Stool/10 mL | SD |
| 1 PIN | 23.25 | 0.20 | 24.32 | 0.33 |
| 3 PINs | 20.90 | 0.06 | 22.22 | 0.20 |
| 5 PINs | 20.41 | 0.09 | 21.53 | 0.43 |
| 10 PINs | 19.20 | 0.09 | 20.47 | 0.30 |
| 50 PINs | 17.88 | 0.04 | 18.60 | 0.35 |
| Dilution | 100 | 10−1 | 10−2 | 10−3 | 10−4 | 10−5 | |
|---|---|---|---|---|---|---|---|
| Ct values | PIN-cDNA pool | 18.48 | 21.64 | 25.44 | 28.69 | 32.66 | 36.05 |
| QIAamp | 16.93 | 20.54 | 24.32 | 28.02 | 35.64 | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kifaro, E.G.; Kim, M.J.; Jung, S.; Jang, Y.-h.; Moon, S.; Lee, D.-H.; Song, C.-S.; Misinzo, G.; Kim, S.K. Microparticles as Viral RNA Carriers from Stool for Stable and Sensitive Surveillance. Diagnostics 2023, 13, 261. https://doi.org/10.3390/diagnostics13020261
Kifaro EG, Kim MJ, Jung S, Jang Y-h, Moon S, Lee D-H, Song C-S, Misinzo G, Kim SK. Microparticles as Viral RNA Carriers from Stool for Stable and Sensitive Surveillance. Diagnostics. 2023; 13(2):261. https://doi.org/10.3390/diagnostics13020261
Chicago/Turabian StyleKifaro, Emmanuel George, Mi Jung Kim, Seungwon Jung, Yoon-ha Jang, Sungyeon Moon, Dong-Hun Lee, Chang-Seon Song, Gerald Misinzo, and Sang Kyung Kim. 2023. "Microparticles as Viral RNA Carriers from Stool for Stable and Sensitive Surveillance" Diagnostics 13, no. 2: 261. https://doi.org/10.3390/diagnostics13020261
APA StyleKifaro, E. G., Kim, M. J., Jung, S., Jang, Y.-h., Moon, S., Lee, D.-H., Song, C.-S., Misinzo, G., & Kim, S. K. (2023). Microparticles as Viral RNA Carriers from Stool for Stable and Sensitive Surveillance. Diagnostics, 13(2), 261. https://doi.org/10.3390/diagnostics13020261

