Sample Adequacy Control (SAC) Lowers False Negatives and Increases the Quality of Screening: Introduction of “Non-Competitive” SAC for qPCR Assays
Abstract
:1. Introduction
2. Methods
3. Results and Discussion
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Brukner, I.; Eintracht, S.; Papadakis, A.I.; Faucher, D.; Lamontagne, B.; Spatz, A.; Oughton, M. Maximizing confidence in a negative result: Quantitative sample adequacy control. J. Infect. Public Health 2020, 13, 991–993. [Google Scholar] [CrossRef] [PubMed]
- Deviaene, M.; Weigel, K.M.; Wood, R.C.; Luabeya, A.K.K.; Jones-Engel, L.; Hatherill, M.; Cangelosi, G.A. Sample adequacy controls for infectious disease diagnosis by oral swabbing. PLoS ONE 2020, 15, e0241542. [Google Scholar] [CrossRef] [PubMed]
- Glisovic, S.; Eintracht, S.; Longtin, Y.; Oughton, M.; Brukner, I. Rectal swab screening assays of public health importance in molecular diagnostics: Sample adequacy control. J. Infect. Public Health 2018, 11, 234–237. [Google Scholar] [CrossRef]
- Jordan, S.J.; Van Der Pol, B.; Hook, E.W.I.M. Utilization of the Cepheid Xpert(R) CT/NG Sample Adequacy Control to Determine the Influence of the Urethral Swab on Cellular Content in Post-Swab versus Pre-Swab Urine. Sex. Transm. Dis. 2017, 44, 67–68. [Google Scholar] [CrossRef] [Green Version]
- Cuschieri, K.; Wilson, A.; Palmer, T.; Stanczuk, G.; Bhatia, R.; Ejegod, D.; Bonde, J. The challenges of defining sample adequacy in an era of HPV based cervical screening. J. Clin. Virol. 2021, 137, 104756. [Google Scholar] [CrossRef] [PubMed]
- Rota, S.; Yildiz, A.; Kustimur, S.; Akbas, E.; Gunay, A.; Guner, H. Sample adequacy in detecting Chlamydia trachomatis. Int. J. Gynaecol. Obstet. 1995, 51, 225–228. [Google Scholar] [CrossRef]
- Alcoba-Florez, J.; Gil-Campesino, H.; Artola, D.G.; Gonzalez-Montelongo, R.; Valenzuela-Fernandez, A.; Ciuffreda, L.; Flores, C. Sensitivity of different RT-qPCR solutions for SARS-CoV-2 detection. Int. J. Infect. Dis. 2020, 99, 190–192. [Google Scholar] [CrossRef]
- Bullimore, M.A. The true and false negatives of screening. Optom. Vis. Sci. 1998, 75, 461. [Google Scholar] [CrossRef]
- Burt, T.; Button, K.S.; Thom, H.; Noveck, R.J.; Munafo, M.R. The Burden of the “False-Negatives” in Clinical Development: Analyses of Current and Alternative Scenarios and Corrective Measures. Clin. Transl. Sci. 2017, 10, 470–479. [Google Scholar] [CrossRef] [Green Version]
- Chen, W.; Cai, B.; Geng, Z.; Chen, F.; Wang, Z.; Wang, L.; Chen, X. Reducing False Negatives in COVID-19 Testing by Using Microneedle-Based Oropharyngeal Swabs. Matter 2020, 3, 1589–1600. [Google Scholar] [CrossRef]
- Curran-Everett, D. CORP: Minimizing the chances of false positives and false negatives. J. Appl. Physiol. 2017, 122, 91–95. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Freire-Paspuel, B.; Garcia-Bereguiain, M.A. Analytical sensitivity and clinical performance of a triplex RT-qPCR assay using CDC N1, N2, and RP targets for SARS-CoV-2 diagnosis. Int. J. Infect. Dis. 2021, 102, 14–16. [Google Scholar] [CrossRef] [PubMed]
- Freire-Paspuel, B.; Vega-Marino, P.; Velez, A.; Castillo, P.; Cruz, M.; Garcia-Bereguiain, M.A. Evaluation of nCoV-QS (MiCo BioMed) for RT-qPCR detection of SARS-CoV-2 from nasopharyngeal samples using CDC FDA EUA qPCR kit as a gold standard: An example of the need of validation studies. J. Clin. Virol. 2020, 128, 104454. [Google Scholar] [CrossRef]
- Jaafar, R.; Aherfi, S.; Wurtz, N.; Grimaldier, C.; Hoang, V.T.; Colson, P.; Raoult, D.; La Scola, B. Correlation between 3790 qPCR positives samples and positive cell cultures including 1941 SARS-CoV-2 isolates. Clin. Infect. Dis. 2021, 72, e921. [Google Scholar] [CrossRef] [PubMed]
- Khiabani, K.; Amirzade-Iranaq, M.H. Are saliva and deep throat sputum as reliable as common respiratory specimens for SARS-CoV-2 detection? A systematic review and meta-analysis. Am. J. Infect. Control 2021. [Google Scholar] [CrossRef] [PubMed]
- Leung, E.C.; Chow, V.C.; Lee, M.K.; Tang, K.P.; Li, D.K.; Lai, R.W. Evaluation of the Xpert Xpress SARS-CoV-2/Flu/RSV Assay for Simultaneous Detection of SARS-CoV-2, Influenza A and B Viruses, and Respiratory Syncytial Virus in Nasopharyngeal Specimens. J. Clin. Microbiol. 2021, 59. [Google Scholar] [CrossRef]
- Lieberman, J.A.; Pepper, G.; Naccache, S.N.; Huang, M.L.; Jerome, K.R.; Greninger, A.L. Comparison of Commercially Available and Laboratory-Developed Assays for In Vitro Detection of SARS-CoV-2 in Clinical Laboratories. J. Clin. Microbiol. 2020, 58, 58. [Google Scholar] [CrossRef]
- Mallett, S.; Allen, A.J.; Graziadio, S.; Taylor, S.A.; Sakai, N.S.; Green, K.; Suklan, J.; Hyde, C.; Shinkins, B.; Zhelev, Z.; et al. At what times during infection is SARS-CoV-2 detectable and no longer detectable using RT-PCR-based tests? A systematic review of individual participant data. BMC Med. 2020, 18, 346. [Google Scholar] [CrossRef]
- Premraj, A.; Aleyas, A.G.; Nautiyal, B.; Rasool, T.J. Nucleic Acid and Immunological Diagnostics for SARS-CoV-2: Processes, Platforms and Pitfalls. Diagnostics 2020, 10, 866. [Google Scholar] [CrossRef]
- Sonnleitner, S.T.; Dorighi, J.; Jansen, B.; Schonegger, C.; Gietl, S.; Koblmuller, S.; Sturmbauer, C.; Posch, W.; Walder, G. An in vitro model for assessment of SARS-CoV-2 infectivity by defining the correlation between virus isolation and quantitative PCR value: Isolation success of SARS-CoV-2 from oropharyngeal swabs correlates negatively with Cq value. Virol. J. 2021, 18, 71. [Google Scholar] [CrossRef]
- Bustin, S.; Coward, A.; Sadler, G.; Teare, L.; Nolan, T. CoV2-ID, a MIQE-compliant sub-20-min 5-plex RT-PCR assay targeting SARS-CoV-2 for the diagnosis of COVID-19. Sci. Rep. 2020, 10, 22214. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.; Mueller, R.; Shipley, G.; Nolan, T. COVID-19 and Diagnostic Testing for SARS-CoV-2 by RT-qPCR-Facts and Fallacies. Int. J. Mol. Sci. 2021, 22, 2459. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Green Version]
- Bustin, S.A.; Nolan, T. RT-qPCR Testing of SARS-CoV-2: A Primer. Int. J. Mol. Sci. 2020, 21, 3004. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Ji, D.; Cai, W.; Hu, Y.; Bai, Y.; Wu, J.; Xu, J. Clinical characteristics, cause analysis and infectivity of COVID-19 nucleic acid repositive patients: A literature review. J. Med. Virol. 2021, 93, 1288–1295. [Google Scholar] [CrossRef]
- Lopez de la Iglesia, J.; Fernandez-Villa, T.; Rivero, A.; Carvajal, A.; Bay Simon, E.; Martinez Martinez, M.; Arguello, H.; Puente, H.; Fernandez Vazquez, J.P. Predictive factors of COVID-19 in patients with negative RT-qPCR. Semergen 2020, 46 (Suppl. 1), 6–11. [Google Scholar] [CrossRef]
- Lorentzen, H.F.; Schmidt, S.A.; Sandholdt, H.; Benfield, T. Estimation of the diagnostic accuracy of real-time reverse transcription quantitative polymerase chain reaction for SARS-CoV-2 using re-analysis of published data. Dan. Med. J. 2020, 67, A04200237. [Google Scholar] [PubMed]
- Maricic, T.; Nickel, O.; Aximu-Petri, A.; Essel, E.; Gansauge, M.; Kanis, P.; Macak, D.; Richter, J.; Riesenberg, S.; Bokelmann, L.; et al. A direct RT-qPCR approach to test large numbers of individuals for SARS-CoV-2. PLoS ONE 2020, 15, e0244824. [Google Scholar] [CrossRef]
- Qian, S.S.; Refsnider, J.M.; Moore, J.A.; Kramer, G.R.; Streby, H.M. All tests are imperfect: Accounting for false positives and false negatives using Bayesian statistics. Heliyon 2020, 6, e03571. [Google Scholar] [CrossRef]
- Stocher, M.; Holzl, G.; Stekel, H.; Berg, J. Automated detection of five human herpes virus DNAs by a set of LightCycler PCRs complemented with a single multiple internal control. J. Clin. Virol. 2004, 29, 171–178. [Google Scholar] [CrossRef]
- Brukner, I.; Longtin, Y.; Oughton, M.; Forgetta, V.; Dascal, A. Assay for estimating total bacterial load: Relative qPCR normalisation of bacterial load with associated clinical implications. Diagn. Microbiol. Infect. Dis. 2015, 83, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Akmatov, M.K.; Gatzemeier, A.; Schughart, K.; Pessler, F. Equivalence of self- and staff-collected nasal swabs for the detection of viral respiratory pathogens. PLoS ONE 2012, 7, e48508. [Google Scholar] [CrossRef] [PubMed]
- Castillo, M.; Astudillo, A.; Clavero, O.; Velasco, J.; Ibanez, R.; de Sanjose, S. Poor Cervical Cancer Screening Attendance and False Negatives. A Call for Organized Screening. PLoS ONE 2016, 11, e0161403. [Google Scholar] [CrossRef] [PubMed]
- Tavares, S.B.; de Souza, N.L.; Manrique, E.J.; Azara, C.Z.; da Silveira, E.A.; Amaral, R.G. Internal quality control for cervical cytopathology: Comparison of potential false-negatives detected at rapid prescreening and at 100% rapid review. Acta Cytol. 2014, 58, 439–445. [Google Scholar] [CrossRef] [PubMed]
- Dahdouh, E.; Lazaro-Perona, F.; Romero-Gomez, M.P.; Mingorance, J.; Garcia-Rodriguez, J. Ct values from SARS-CoV-2 diagnostic PCR assays should not be used as direct estimates of viral load. J. Infect. 2021, 82, 414–451. [Google Scholar] [CrossRef] [PubMed]
- Karlen, Y.; McNair, A.; Perseguers, S.; Mazza, C.; Mermod, N. Statistical significance of quantitative PCR. BMC Bioinform. 2007, 8, 131. [Google Scholar] [CrossRef] [Green Version]
- Morone, G.; Palomba, A.; Iosa, M.; Caporaso, T.; De Angelis, D.; Venturiero, V.; Savo, A.; Coiro, P.; Carbone, D.; Gimigliano, F.; et al. Incidence and Persistence of Viral Shedding in COVID-19 Post-acute Patients With Negativized Pharyngeal Swab: A Systematic Review. Front. Med. 2020, 7, 562. [Google Scholar] [CrossRef]
- Green, M.R.; Sambrook, J. Touchdown Polymerase Chain Reaction (PCR). Cold Spring Harb. Protoc. 2018, 2018. [Google Scholar] [CrossRef]
- Hecker, K.H.; Roux, K.H. High and low annealing temperatures increase both specificity and yield in touchdown and stepdown PCR. Biotechniques 1996, 20, 478–485. [Google Scholar] [CrossRef]
- Montgomery, J.L.; Rejali, N.; Wittwer, C.T. The influence of nucleotide sequence and temperature on the activity of thermostable DNA polymerases. J. Mol. Diagn. 2014, 16, 305–313. [Google Scholar] [CrossRef]
- Wilhelm, J.; Hahn, M.; Pingoud, A. Influence of DNA target melting behavior on real-time PCR quantification. Clin. Chem. 2000, 46, 1738–1743. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pierce, K.E.; Sanchez, J.A.; Rice, J.E.; Wangh, L.J. Linear-After-The-Exponential (LATE)-PCR: Primer design criteria for high yields of specific single-stranded DNA and improved real-time detection. Proc. Natl. Acad. Sci. USA 2005, 102, 8609–8614. [Google Scholar] [CrossRef] [Green Version]
- Rychlik, W. Selection of primers for polymerase chain reaction. Mol. Biotechnol. 1995, 3, 129–134. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Ruff, D.; Halsey, J. Asynchronous PCR. Methods Mol. Biol. 2011, 687, 231–243. [Google Scholar] [CrossRef] [PubMed]
Average (n = 3) | |||
---|---|---|---|
Number of Human GE | Cq (Classical) | Cq (Non-Competitive #A) | Cq (Non-Competitive #B) |
10,000–100,000 | 25.3 | 29.2 | 33.2 |
1000–10,000 | 28.7 | 32.4 | 35.5 |
100–1000 | 31.5 | 36.1 | 37.5 |
10–100 | 35.2 | 39.4 | n.d. |
1–10 | 38.1 | n.d. | n.d. |
Ribonuclease P (SAC) | Classical Assay | Non-Competitive #A | Non-Competitive #B |
---|---|---|---|
Forward primer | 5′AGATTTGGACCTGCGAGCG3′ | 5’GGACCTGCGAGCG3’ | 5’GACCTGCGAGCG3’ |
Reverse primer | 5′GAGCGGCTGTCTCCACCAGT3′ | ||
TaqMan probe | 5′FAMTTCTGACCTGAAGGCTCTGCGCG3′BQH |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Brukner, I.; Resendes, A.; Eintracht, S.; Papadakis, A.I.; Oughton, M. Sample Adequacy Control (SAC) Lowers False Negatives and Increases the Quality of Screening: Introduction of “Non-Competitive” SAC for qPCR Assays. Diagnostics 2021, 11, 1133. https://doi.org/10.3390/diagnostics11071133
Brukner I, Resendes A, Eintracht S, Papadakis AI, Oughton M. Sample Adequacy Control (SAC) Lowers False Negatives and Increases the Quality of Screening: Introduction of “Non-Competitive” SAC for qPCR Assays. Diagnostics. 2021; 11(7):1133. https://doi.org/10.3390/diagnostics11071133
Chicago/Turabian StyleBrukner, Ivan, Alex Resendes, Shaun Eintracht, Andreas I. Papadakis, and Matthew Oughton. 2021. "Sample Adequacy Control (SAC) Lowers False Negatives and Increases the Quality of Screening: Introduction of “Non-Competitive” SAC for qPCR Assays" Diagnostics 11, no. 7: 1133. https://doi.org/10.3390/diagnostics11071133
APA StyleBrukner, I., Resendes, A., Eintracht, S., Papadakis, A. I., & Oughton, M. (2021). Sample Adequacy Control (SAC) Lowers False Negatives and Increases the Quality of Screening: Introduction of “Non-Competitive” SAC for qPCR Assays. Diagnostics, 11(7), 1133. https://doi.org/10.3390/diagnostics11071133