Pneumococcal Serotype Identification by Capsular Sequence Typing (CST): A Modified Novel Approach for Serotyping Directly in Clinical Samples
Abstract
1. Introduction
2. Materials and Methods
2.1. Source of Specimens
2.2. DNA Isolation
2.3. Capsular Sequence Typing (CST)
2.4. PCR Product Purification and Sequencing
2.5. Sequencing Analysis
2.6. Additional PCR Protocols
2.7. Specificity
3. Results
Capsular Sequence Typing (CST)
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Advisory Committee on Immunization Practices. Preventing pneumococcal disease among infants and young children. Recommendations of the Advisory Committee onImmunization Practices (ACIP). MMWR Recomm. Rep. 2000, 49, 1–35. [Google Scholar]
- De Velasco, E.A.; Verheul, A.F.; Verhoef, J.; Snippe, H. Streptococcus pneumoniae: Virulence factors, pathogenesis, and vaccines. Microbiol. Rev. 1995, 59, 591–603. [Google Scholar]
- Greenberg, D.; Hoover, P.A.; Vesikari, T.; Peltier, C.; Hurley, D.C.; McFetridge, R.D.; Dallas, M.; Hartzel, J.; Marchese, R.D.; Coller, B.-A.G.; et al. Safety and immunogenicity of 15-valent pneumococcal conjugate vaccine (PCV15) in healthy infants. Vaccine 2018, 36, 6883–6891. [Google Scholar] [CrossRef] [Scilit]
- Richter, S.S.; Heilmann, K.P.; Dohrn, C.L.; Riahi, F.; Diekema, D.; Doern, G.V. Pneumococcal serotypes before and after introduction of conjugate vaccines, United States, 1999–2011. Emerg. Infect. Dis. 2013, 19, 1074–1083. [Google Scholar] [CrossRef] [Scilit]
- Maraki, S.; Samonis, G.; Galanakis, E. Serotypes and susceptibilities of paediatric clinical isolates of Streptococcus pneumoniae in Crete, Greece, before and after the heptavalent pneumococcal conjugate vaccine. Eur. J. Clin. Microbiol. Infect. Dis. 2010, 29, 1449–1451. [Google Scholar]
- Johnson, H.L.; Deloria-Knoll, M.; Levine, O.S.; Stoszek, S.K.; Freimanis Hance, L.; Reithinger, R.; Muenz, L.R.; O’Brien, K.L. Systematic evaluation of serotypes causing invasive pneumococcal disease among children under five: The pneumococcal globalserotype project. PLoS Med. 2010, 7, e1000348. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van der Linden, M.; Perniciaro, S.; Imöhl, M. Increase of serotypes 15A and 23B in IPD in Germany in the PCV13 vaccination era. BMC Infect Dis. 2015, 15, 207. [Google Scholar] [CrossRef] [Scilit]
- Amin-Chowdhury, Z.; Collins, S.; Sheppard, C.; Litt, D.; Fry, N.K.; Andrews, N.; Ladhani, S.N. Characteristics of Invasive Pneumococcal Disease Caused by Emerging Serotypes After the Introduction of the 13-Valent Pneumococcal Conjugate Vaccine in England: A Prospective Observational Cohort Study, 2014–2018. Clin. Infect. Dis. 2020, 71, e235–e243. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garcia Quesada, M.; Yang, Y.; Bennett, J.C.; Hayford, K.; Zeger, S.L.; Feikin, D.R.; Peterson, M.E.; Cohen, A.L.; Almeida, S.C.G.; Ampofo, K.; et al. Serotype Distribution of Remaining Pneumococcal Meningitis in the Mature PCV10/13 Period: Findings from the PSERENADE Project. Microorganisms 2021, 9, 738. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Austrian, R. The quellung reaction, a neglected microbiologic technique. Mt. Sinai J. Med. 1976, 43, 699–709. [Google Scholar] [PubMed]
- Lund, E. Laboratory diagnosis of Pneumococcus infections. Bull. World Health Organ. 1960, 23, 5–13. [Google Scholar] [PubMed]
- Brito, D.A.; Ramirez, M.; de Lencastre, H. Serotyping Streptococcus pneumoniae by Multiplex PCR. J. Clin. Microbiol. 2003, 41, 2378–2384. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kong, F.; Gilbert, G.L. Using cpsA–cpsB sequence polymorphisms and serotype-/group-specific PCR to predict 51 Streptococcus pneumoniae capsular serotypes. J. Med. Microbiol. 2003, 52, 1047–1058. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kong, F.; Wang, W.; Tao, J.; Wang, L.; Wang, Q.; Sabananthan, A.; Gilbert, G.L. A molecular-capsular-type prediction system for 90 Streptococcus pneumoniae serotypes using partial cpsA–cpsB sequencing and wzy- or wzx-specific PCR. J. Med. Microbiol. 2005, 54, 351–356. [Google Scholar] [CrossRef] [Scilit]
- Dias, C.; Teixeira, L.M.; Carvalho, M.D.G.; Beall, B. Sequential multiplex PCR for determining capsular serotypes of pneumococci recovered from Brazilian children. J. Med. Microbiol. 2007, 56, 1185–1188. [Google Scholar] [CrossRef] [Scilit]
- Morais, L.; Carvalho, M.D.G.; Roca, A.; Flannery, B.; Mandomando, I.; Soriano-Gabarró, M.; Sigauque, B.; Alonso, P.L.; Beall, B. Sequential multiplex PCR for identifying pneumococcal capsular serotypes from South-Saharan African clinical isolates. J. Med. Microbiol. 2007, 56 Pt. 9, 1181–1184. [Google Scholar] [CrossRef] [Scilit]
- Geno, K.A.; Gilbert, G.L.; Song, J.Y.; Skovsted, I.C.; Klugman, K.P.; Jones, C.; Konradsen, H.B.; Nahm, M.H. Pneumococcal Capsules and Their Types: Past, Present, and Future. Clin. Microbiol. Rev. 2015, 28, 871–899. [Google Scholar] [CrossRef] [Scilit]
- Elberse, K.E.; van de Pol, I.; Witteveen, S.; van der Heide, H.G.; Schot, C.S.; van Dijk, A.; van der Ende, A.; Schouls, L.M. Population structure of invasive Streptococcus pneumoniae in The Netherlands in the pre-vaccination era assessed by MLVA and Capsular Sequence Typing. PLoS ONE 2011, 6, e20390. [Google Scholar] [CrossRef] [Scilit]
- Bentley, S.D.; Aanensen, D.M.; Mavroidi, A.; Saunders, D.; Rabbinowitsch, E.; Collins, M.; Donohoe, K.; Harris, D.; Murphy, L.; A Quail, M.; et al. Genetic analysis of the capsular biosynthetic locus from all 90 pneumococcal serotypes. PLoS Genet. 2006, 2, e31. [Google Scholar] [CrossRef] [Scilit]
- Tzanakaki, G.; Tsopanomichalou, M.; Kesanopoulos, K.; Matzourani, R.; Sioumala, M.; Tabaki, A.; Kremastinou, J. Simultaneous single-tube PCR assay for the detection of Neisseria meningitis, Haemophilus influenzae type b and Streptococcus pneumoniae. Clin. Microb. Infect. 2005, 11, 386–390. [Google Scholar] [CrossRef] [Scilit]
- Pai, R.; Gertz, R.E.; Beall, B. Sequential multiplex PCR approach for determining capsular serotypes of Streptococcus pneumoniae isolates. J. Clin. Microbiol. 2006, 44, 124–131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Velusamy, S.; Tran, T.; Mongkolrattanothai, T.; Walker, H.; McGee, L.; Beall, B. Expanded sequential quadriplex real-time polymerase chain reaction (PCR) for identifying pneumococcal serotypes, penicillin susceptibility, and resistance markers. Diagn. Microbiol. Infect Dis. 2020, 97, 115037. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lawrence, E.R.; Griffiths, D.B.; Martin, S.A.; George, R.C.; Hall, L.M. Evaluation of semi-automated multiplex PCR assay for determination of Streptococcus pneumoniae serotypes and serogroups. J. Clin. Microbiol. 2003, 41, 601–607. [Google Scholar] [CrossRef] [Scilit]
- Carvalho, M.D.G.; Pimenta, F.C.; Jackson, D.; Roundtree, A.; Ahmad, Y.; Millar, E.V.; O’Brien, K.; Whitney, C.G.; Cohen, A.L.; Beall, B.W. Revisiting pneumococcal carriage by use of broth enrichment and PCR techniques for enhanced detection of carriage and serotypes. J. Clin. Microbiol. 2010, 48, 1611–1618. [Google Scholar] [CrossRef] [Scilit]
- Azzari, C.; Moriondo, M.; Indolfi, G.; Massai, C.; Becciolini, L.; de Martino, M.; Resti, M. Molecular detection methods and serotyping performed directly on clinical samples improve diagnostic sensitivity and reveal increased incidence of invasive disease by Streptococcus pneumoniae in Italian children. J. Med. Microbiol. 2008, 57, 1205–1212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Azzari, C.; Moriondo, M.; Indolfi, G.; Cortimiglia, M.; Canessa, C.; Becciolini, L.; Lippi, F.; de Martino, M.; Resti, M. Realtime PCR is more sensitive than multiplex PCR for diagnosis and serotyping in children with culture negative pneumococcal invasive disease. PLoS ONE. 2010, 5, e9282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marchese, A.; Esposito, S.; Coppo, E.; Rossi, G.A.; Tozzi, A.; Romano, L.; da Dalt, G.; Schito, C.; Principi, N. Detection of Streptococcus pneumoniae and identification of pneumococcal serotypes by real-time polymerase chain reaction using blood samples from Italian children ≤ 5 years of age with community-acquired pneumonia. Microb. Drug Resist. 2011, 17, 419–424. [Google Scholar] [CrossRef] [Scilit]
- Blaschke, A.J.; Heyrend, C.; Byington, C.; Obando, I.; Vazquez-Barba, I.; Doby, E.H.; Korgenski, E.K.; Sheng, X.; Poritz, M.A.; Daly, J.A.; et al. Molecular analysis improves pathogen identification and epidemiologic study of pediatric parapneumonic empyema. Pediatr. Infect. Dis. J. 2011, 30, 289–294. [Google Scholar] [CrossRef] [Scilit]
- Magomani, V.; Wolter, N.; Tempia, S.; du Plessis, M.; de Gouveia, L.; von Gottberg, A. Challenges of using molecular serotyping for surveillance of pneumococcal disease. J. Clin. Microbiol. 2014, 52, 3271–3276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tin Tin Htar, M.; Christopoulou, D.; Schmitt, H.J. Pneumococcal serotype evolution in Western Europe. BMC Infect. Dis. 2015, 15, 419. [Google Scholar] [CrossRef] [Scilit]
- Amin-Chowdhury, Z.; Groves, N.; Sheppard, C.L.; Litt, D.; Fry, N.K.; Andrews, N.; Ladhani, S.N. Invasive pneumococcal disease due to 22F and 33F in England: A tail of two serotypes. Vaccine 2021, 39, 1997–2004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
| Primer | Primer Sequence | Publication | |
|---|---|---|---|
| Primers used for the first PCR | CST_1F | CATTCGCATATCGTTTTTG | Modified from Elberse et al. [18] (without M-tails) |
| CST_2F | CATTCTCACATTATTTTTGATGT | ||
| CST_3F | CATTCGCACATCGTCTTTG | ||
| CST_1R | CTGAGCTCTTTTTTTCATGA | ||
| CST_2R | GTGAACTCGTTTCTTCATGA | ||
| CST_3R | CCGAGCTCTCTTTTTCATAA | ||
| CST_4R | CCGAGCTCTCTTTTTCATGA | ||
| Primers used for the second PCR | CST_01-M13F | GTAAAACGACGGCCAGCATTCGCATATCGTTTTTG | Elberse et al. [18] |
| CST_02-M13F | GTAAAACGACGGCCAGCATTCTCACATTATTTTTGATGT | ||
| CST_03-M13F | GTAAAACGACGGCCAGCATTCGCACATCGTCTTTG | ||
| CST_01-M13R | CAGGAAACAGCTATGACCTGAGCTCTTTTTTTCATGA | ||
| CST_02-M13R | CAGGAAACAGCTATGACGTGAACTCGTTTCTTCATGA | ||
| CST_03-M13R | CAGGAAACAGCTATGACCCGAGCTCTCTTTTTCATAA | ||
| CST_04-M13R | CAGGAAACAGCTATGACCCGAGCTCTCTTTTTCATGA | ||
| CST sequencing | M13F(-20) | GTAAAACGACGGCCAG | |
| M13R | CAGGAAACAGCTATGAC |
| CST-Assigned Serotype | Additional PCR Assays | |||
|---|---|---|---|---|
| Serotype | Primer | Product (bp) | Publication | |
| 11A/D, 18F | 11A/D | 11A-F- GGACATGTTCAGGTGATTTCCCAATATAGTG | 463 bp | Pai et al. [21] |
| 11A-R- GATTATGAGTGTAATTTATTCCAACTTCTCCC | ||||
| 18 | 18-F- GCATCTGTACAGTGTGCTAATTGGATTGAAG | 354 bp | Brito et al. [12] | |
| 18-R- CTTTAACATCTGACTTTTTCTGTTCCCAAC | ||||
| 22A/F, 15B/C | 22A/F | 22A/F-F- GAGTAT AGC CAG ATTATGGCAGTT TTATTGTC | 643 bp | Pai et al. [21] |
| 22A/F-R- CTCCAGCACTTGCGCTGGAAACAACAGACAAC | ||||
| 22F | 22F-F- CTTGTCAAGTATGCTGAGGATTTG | 82 bp | Velusamy et al. [22] | |
| 22F-R- AGATTTCTCCTGGATATAATGCGAT | ||||
| 22A | 22A-F- CCCAGGACAATCACAAGAACTA | 84 bp | ||
| 22A-R- TGATGCTTGGCCAAATTGGAG | ||||
| 15B/C, 23F | 15B/C | 15B/C-F-TTGGAATTTTTTAATTAGTGGCTTACCTA | 496 bp | Pai et al. [21] |
| 15B/C-R-CATCCGCTTATTAATTGAAGTAATCTGAACC | ||||
| 23F | 23F-F- TGGTAGTGACAGCAACGA | 177 bp | Lawrence et al. [23] | |
| 23F-R- CAAAGGCTAATTCAGCATC | ||||
| 12F/B | 12F/44 | 12F/44-F- TTCGGAGGGTCCGATTATATTT | 149 bp | Velusamy et al. [22] |
| 12F/44-R- CTTTGGTAATCCACTGTTCTGG | ||||
| 20,13 | 20 | 20-F- GAG CAA GAG TTT TTC ACC TGA CAG CGA GAA G | 514 bp | Pai et al. [21] |
| 20-R- CTA AAT TCC TGT AAT TTA GCT AAA ACT CTTATC | ||||
| 13 | 13-F- TACTAA GGTAAT CTCTGG AAATCGAAAGG | 655 bp | Da Gloria Carvalho [24] | |
| 13-R- CTCATGCATTTTAT AACCGCTTT TTG TTC | ||||
| CST-Assigned Serotype | Final Serotype Identified | Number of Cases |
|---|---|---|
| 3 | 3 | 45 |
| 8 | 8 | 18 |
| 10A | 10A | 2 |
| 10B | 10B | 1 |
| 14 | 14 | 3 |
| 15A | 15A | 11 |
| 16F | 16F | 2 |
| 18A | 18A | 1 |
| 19A | 19A | 15 |
| 21 | 21 | 8 |
| 23A | 23A | 15 |
| 23B | 23B | 5 |
| 31 | 31 | 2 |
| 37 | 37 | 2 |
| 42 | 42 | 2 |
| 7A/F | 7A/F | 2 |
| 9N/L | 9N/L | 4 |
| 10F/C | 10F/C | 1 |
| TOTAL | 139 (49.12%) |
| CST-Assigned Serotype | Single PCR Assays | Final Serotype Identified | Number of Cases | |
|---|---|---|---|---|
| 11A/D, 18F | 11A/D | 11A/D | 18 | |
| 18 | ||||
| 12F/B | 12F/44 | 12F | 14 | |
| 15B/C, 23F | 15B/C | 15B/C | 28 | |
| 23F | ||||
| 20,13 | 20 | 20 | 7 | |
| 13 | ||||
| 22A/F, 15B/C | 22A/F | 22F | 22 | |
| 22A | ||||
| 22F | ||||
| 15B/C | ||||
| 23F | ||||
| TOTAL | 89 (31.44%) | |||
| CST-Assigned Serotype | Single PCR Assays | Final Serotype Identified | Number of Cases |
|---|---|---|---|
| 24F/40 | NA * | 24F/40 | 18 |
| 25A/F, 38 | NA | 25A/F, 38 | 7 |
| 33A/F, 35A | NA | 33A/F, 35A | 3 |
| 34/17A | NA | 34, 17A | 5 |
| 35F/47F | NA | 35F/47F | 7 |
| TOTAL | 55 (19.4%) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marmaras, N.; Xirogianni, A.; Papandreou, A.; Petinaki, E.; Papaevangelou, V.; Tsolia, M.; Tzanakaki, G. Pneumococcal Serotype Identification by Capsular Sequence Typing (CST): A Modified Novel Approach for Serotyping Directly in Clinical Samples. Diagnostics 2021, 11, 2353. https://doi.org/10.3390/diagnostics11122353
Marmaras N, Xirogianni A, Papandreou A, Petinaki E, Papaevangelou V, Tsolia M, Tzanakaki G. Pneumococcal Serotype Identification by Capsular Sequence Typing (CST): A Modified Novel Approach for Serotyping Directly in Clinical Samples. Diagnostics. 2021; 11(12):2353. https://doi.org/10.3390/diagnostics11122353
Chicago/Turabian StyleMarmaras, Nektarios, Athanasia Xirogianni, Anastasia Papandreou, Efthymia Petinaki, Vana Papaevangelou, Maria Tsolia, and Georgina Tzanakaki. 2021. "Pneumococcal Serotype Identification by Capsular Sequence Typing (CST): A Modified Novel Approach for Serotyping Directly in Clinical Samples" Diagnostics 11, no. 12: 2353. https://doi.org/10.3390/diagnostics11122353
APA StyleMarmaras, N., Xirogianni, A., Papandreou, A., Petinaki, E., Papaevangelou, V., Tsolia, M., & Tzanakaki, G. (2021). Pneumococcal Serotype Identification by Capsular Sequence Typing (CST): A Modified Novel Approach for Serotyping Directly in Clinical Samples. Diagnostics, 11(12), 2353. https://doi.org/10.3390/diagnostics11122353

