Inverse Shifting-PCR Modified by Capillary Electrophoresis for Detecting F8 int22h and int1h Inversions in Severe Hemophilia A Patients and Probable Carriers
Abstract
1. Introduction
2. Materials and Methods
2.1. Characteristics of Participants and Description of Materials
2.2. Processes, Interventions, and Comparisons
2.3. Statistical Analysis
3. Results
- Int22-h1, WT_FAM 485 bp; LIZ 450 bp.
- Inv22-1 SHA patient_FAM 333 bp; LIZ 300 bp.
- Inv22-1 carrier_FAM 333 bp; LIZ 300 bp/FAM 485 bp; LIZ 450 bp.
- Inv22-2 SHA patient_FAM 378 bp; LIZ 400 bp.
- Inv22-2 carrier_FAM 378 bp; LIZ 400 bp/FAM 485 bp; LIZ 500 bp.
- Int1-h1, WT_FAM 304 bp; LIZ 340/350 bp.
- Inv1 SHA patient, FAM 224 bp; LIZ 250 bp.
- Inv1 carrier, FAM 224 bp; LIZ 250 bp/FAM 304 bp; LIZ 340/350 bp.
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hoyer, L.W. Hemophilia A. Engl. J. Med. 1994, 330, 38–47. [Google Scholar] [CrossRef] [PubMed]
- Lakich, D.; Kazazian, H.H.; Antonarakis, S.E.; Gitschier, J. Inversions disrupting the factor VIII gene are a common cause of severe haemophilia A. Nat. Genet. 1993, 5, 236–241. [Google Scholar] [CrossRef] [PubMed]
- Bagnall, R.D.; Waseem, N.; Green, P.M.; Giannelli, F. Recurrent inversion breaking intron 1 of the factor VIII gene is a frequent cause of severe hemophilia A. Blood 2002, 99, 168–174. [Google Scholar] [CrossRef] [PubMed]
- Rossiter, J.P.; Young, M.; Kimberland, M.L.; Hutter, P.; Ketterling, R.P.; Gitschier, J.; Horst, J.; Morris, M.A.; Schaid, D.J.; de Moerloose, P.; et al. Factor VIII gene inversions causing severe hemophilia A originate almost exclusively in male germ cells. Hum. Mol. Genet. 1994, 3, 1035–1039. [Google Scholar] [CrossRef] [PubMed]
- Naylor, J.A.; Buck, D.; Green, P.; Williamson, H.; Bentley, D.; Gianelli, F. Investigation of the factor VIII intron 22 repeated region (int22h) and the associated inversion junctions. Hum. Mol. Genet. 1995, 4, 1217–1224. [Google Scholar] [CrossRef] [PubMed]
- Rossetti, L.C.; Radic, C.P.; Abelleyro, M.M.; Larripa, I.B.; De Brasi, C.D. Eighteen years of molecular genotyping the hemophilia inversion hotspot: From southern blot to inverse shifting-PCR. Int. J. Mol. Sci. 2011, 12, 7271–7285. [Google Scholar] [CrossRef] [PubMed]
- Luna-Záizar, H.; González-Alcázar, J.; Evangelista-Castro, N.; Aguilar-López, L.B.; Ruiz-Quezada, S.L.; Beltrán-Miranda, C.P.; Jaloma-Cruz, A.R. F8 inversions of introns 22 and 1 confer a moderate risk of inhibitors in Mexican patients with severe hemophilia A. Concordance analysis and literature review. Blood Cells. Mol. Dis. 2018, 71, 45–52. [Google Scholar] [CrossRef] [PubMed]
- Pan, T.-Y.; Chiou, S.-S.; Wang, C.-C.; Wu, S.-M. Separation of intron 22 inversion type 1 and 2 of hemophilia A by modified inverse-shifting polymerase chain reaction and capillary gel electrophoresis. Talanta 2014, 130, 328–335. [Google Scholar] [CrossRef] [PubMed]
- Rossetti, L.C.; Radic, C.P.; Larripa, I.B.; DE Brasi, C.D. Developing a new generation of tests for genotyping hemophilia-causative rearrangements involving int22h and int1h hotspots in the factor VIII gene. J. Thromb. Haemost. 2008, 6, 830–836. [Google Scholar] [CrossRef] [PubMed]
- Miller, S.A.; Dykes, D.D.; Polesky, H.F. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988, 16, 1215. [Google Scholar] [CrossRef] [PubMed]
- Rossetti, L.C.; Radic, C.P.; Larripa, I.B.; De Brasi, C.D. Genotyping the hemophilia inversion hotspot by use of inverse PCR. Clin. Chem. 2005, 51, 1154–1158. [Google Scholar] [CrossRef] [PubMed]
- González-Ramos, I.; Mantilla-Capacho, J.; Luna-Záizar, H.; Mundo-Ayala, J.; Lara-Navarro, I.; Ornelas-Ricardo, D.; Alcázar, J.G.; Evangelista-Castro, N.; Jaloma-Cruz, A.R. Genetic analysis for carrier diagnosis in hemophilia A and B in the Mexican population: 25 years of experience. Am. J. Med. Genet. C Semin. Med. Genet. 2020, 184, 939–954. [Google Scholar] [CrossRef] [PubMed]
- Villarreal-Martínez, L.; Ibarra-Ramirez, M.; Calvo-Anguiano, G.; Lugo-Trampe, J.d.J.; Luna-Záizar, H.; Martínez-De-Villarreal, L.E.; Meléndez-Aranda, L.; Jaloma-Cruz, A.-R. Molecular genetic diagnosis by next-generation sequencing in a cohort of Mexican patients with haemophilia and report of novel variants. Blood Cells Mol. Dis. 2020, 83, 102423. [Google Scholar] [CrossRef] [PubMed]
- Radic, C.P.; Rossetti, L.C.; Zuccoli, J.R.; Abelleyro, M.M.; Larripa, I.B.; De Brasi, C.D. Inverse shifting PCR based prenatal diagnosis of hemophilia-causative inversions involving int22h and int1h hotspots from chorionic villus samples. Prenat. Diagn. 2009, 29, 1183–1185. [Google Scholar] [CrossRef] [PubMed]
- GeneScan®. Reference Guide. Chemistry Reference for the ABI PRISM® 310 Genetic Analyzer. cms_041158.pdf. © Copyright 2001, 2010 Applied Biosystems. Available online: https://assets.thermofisher.com/TFS-Assets/LSG/manuals/cms_041158.pdf (accessed on 1 December 2023).
Protocol Step | Rossetti et al, 2005 [11]; 2008 [9] | Pan et al, 2014 [8] | This Study |
---|---|---|---|
BclI Digestion | Genomic DNA, 2 µg, is digested with 20 U of Bcll enzyme (Promega, Madison, WI, USA). Incubation at 50 °C for 4 h, volume reaction of 50 µL | Genomic DNA, 5 µg, is digested with 20 U of BclІ enzyme (New England Biolabs, Beverly, MA, USA), incubation at 50 °C for 2 h, volume reaction of 50 µL | Genomic DNA, 2 µg, is digested with 20 U of BclІ enzyme (Jena Bioscience, Jena, Germany), incubation at 50 °C for 10 min, volume reaction of 50 µL |
1st. Purification | Phenol–chloroform Ethanol precipitation: NaCl 3M, 0.11 volumes, final concentration of 0.3 mol/L with 2 volumes of ethanol. Digested DNA is resuspended in 50 µL of distilled water | Ethanol precipitation. Two washes with ethanol 75% Digested DNA is resuspended in 10 µL of distilled water | Ethanol precipitation One wash with ethanol 70% Digested DNA is resuspended in 10 µL of HPLC water |
Ligation | DNA fragments are self-circularized with 3 U of T4 DNA Ligase (Invitrogen, Buenos Aires, Argentina) in 400 µL of volume reaction at 15 °C, overnight | DNA fragments are self-circularized with 3U of T4 DNA ligase (Takara Biotechnology, Japan) in 100 µL of volume reaction at 15 °C for 12 h | DNA fragments are self-circularized with 3U of T4 DNA ligase, (Jena Bioscience, Jena, Germany) in 200 µL of volume reaction at 16 °C for 30 min |
2nd. Purification | Phenol–chloroform Ethanol precipitation or alternatively: GFXTM Spin chromatography columns (Amersham, Buenos Aires, Argentina). Ligated DNA is recovered in 30 µL of distilled water | Ethanol precipitation Two washes with ethanol 75% Ligated DNA is recovered in 10 μL of sterile water | Ethanol precipitation One wash with ethanol 70% Ligated DNA is recovered in 20 μL of HPLC water |
Multiplex PCR | PCR is performed with 3 µL and 6 µL of circularized DNA for the analysis of Inv1 and Inv22, respectively, in the presence of 0.6 µM of each primer, 0.5 U of Taq DNA Polymerase (PromegaTM, Buenos Aires, Argentina), and additional standard PCR reagents in a total volume of 25μL. (1) Inv22-diagnostic for a pattern-sensitive detection of deleterious mutations (Inv22 and Del22) from non-deleterious variants (Dup22 and normal); (2) Inv1-diagnostic; and (3) Inv22-complementary for discrimination between Inv22 and Del22, and between Dup22 and normal. Thermocycling: 94 °C for 2 min Denaturation at 94 °C, 30 s Primer annealing at 56 °C, 1 min Extension at 72 °C for 90 s, 30 cycles 5 min at 72 °C | PCR is performed with 200 ng of circularized DNA, 1U of Takara rTaq, and additional standard PCR reagent in a total volume of 25 µL. Five primers were used at 0.6 µM of each primer to perform the diagnostic and complementary test for genotyping all the possible rearrangements of Inv22, including two modified primers* from Rossetti et al., 2008 The final reaction volume was 25µL containing 2. DMD amplification as internal standard (IS). Thermocycling: 95 °C for 10 min Denaturation at 95 °C, 30 s Primer annealing at 57 °C, 1 min Extension at 72 °C, for 90 s, 30 cycles 5 min at 72 °C | PCR is performed with 3 µL and 6 µL of circularized DNA for the diagnostic test for Inv1 and Inv22, respectively. We used the primers described by Rossetti et al. [9] but modified with 5’-end label of fluorescent dyes. Maxima Hot-Start Polymerase (Thermo Fisher Scientific Inc, Waltham, MA, USA), was used to enhance the specifity, sensitivity and yield of the PCR products. The PCR program was modified to activate the enzyme according to the manufacturer’ recommendations: Thermocycling: 95 °C for 4 min Denaturation at 95 °C, 30 s Primer annealing at 56 °C, 1 min Extension at 72 °C for 90 s, 30 cycles 5 min at 72 °C |
Primers | Inv22 | ||
22-IU CCTTTCAACTCCATCTCCAT | 22h-1U AACTCCCTTCCTTGTCAGCA | 22-IU CCTTTCAACTCCATCTCCAT | |
22-2U ACGTGTCTTTTGGAGAAGTC | 22h-2U ACGTGTCTTTTGGAGAAGTC | 22-2U ACGTGTCTTTTGGAGAAGTC | |
22-3U CTCACATTGTGTTCTTGTAGTC | 22h-3U CTCACATTGTGTTCTTGTAGTC | 22-3U CTCACATTGTGTTCTTGTAGTC | |
22-ID ACATACGGTTTAGTCACAAGT | IPCR-ID ACATACGGTTTAGTCACAAGT | 22-ID FAM ACATACGGTTTAGTCACAAGT * | |
22-ED TCCAGTCACTTAGGCTCAG | IPCR-ED TCCAGTCACTTAGGCTCAG | ||
Inv1 | |||
1-IU GCCGATTGCTTATTTATATC | -- | 1-IU FAM GCCGATTGCTTATTTATATC* | |
1-ID TCTGCAACTGGTACTCATC | -- | 1-ID TCTGCAACTGGTACTCATC | |
1-ED GCCTTTACAATCCAACACT | -- | 1-ED GCCTTTACAATCCAACACT | |
Amplified products | Inv22/Diagnostic test | Inv22/Diagnostic and complementary tests | Inv22/Diagnostic test |
487 bp, Int22-h1 WT 333 bp, Inv22-1 385 pb, Inv22-2 | Wildtype alleles: 512 bp, Int22-h1; 457 bp, Int22-h2; 405 bp, Int22-h3 Inv22-1 related alleles: 333 bp, Inv22-1; 457 bp, Int22-h2 WT; 584 bp, Dup22-1 Inv22-2 related alleles: 385 bp, Inv22-2; 405 pb, Int22-h3 WT; 584 bp, Dup22-2 | FAM 485 bp, Int22-h1, WT FAM 333 bp, Inv22-1 FAM 378 bp, Inv22-2 | |
Inv22/Complementary test | Inv22/Complementary test | ||
Wildtype alleles and duplications 559 bp, Benign Dup22-1 or Dup22-2 457 bp, Int22-h2 WT, related to Inv22-1, Del22-1 405 bp, Int22-h3 WT, related to Inv22-2, Del22-2 | Not done | ||
Inv1/Diagnostic test | Inv1/Diagnostic test | ||
304 bp, Int1-h1 WT 224 bp, Inv1 | FAM 304 bp, Int1-h1 WT FAM 224 bp, Inv1 | ||
Visualization of amplified products | Electrophoresis on 1.5–2% agarose gels stained by ethidium bromide | PCR products and IS are 1/5 and 1/10 diluted, respectively. Short-end capillary gel electrophoresis, Polymer prepared with intercalating dye, YO-PROs-1 Iodide, Molecular Probes (InvitrogenTM, Eugene, OR, USA) | Fluorescent capillary electrophoresis performing the GeneScan™ application with the ABI PRISM® 310 Genetic Analyzer, and 500 LIZ™ was used as molecular marker |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martínez-Contreras, R.M.; García-López, S.S.; Luna-Záizar, H.; Jaloma-Cruz, A.R. Inverse Shifting-PCR Modified by Capillary Electrophoresis for Detecting F8 int22h and int1h Inversions in Severe Hemophilia A Patients and Probable Carriers. Life 2024, 14, 1332. https://doi.org/10.3390/life14101332
Martínez-Contreras RM, García-López SS, Luna-Záizar H, Jaloma-Cruz AR. Inverse Shifting-PCR Modified by Capillary Electrophoresis for Detecting F8 int22h and int1h Inversions in Severe Hemophilia A Patients and Probable Carriers. Life. 2024; 14(10):1332. https://doi.org/10.3390/life14101332
Chicago/Turabian StyleMartínez-Contreras, Rosa Michel, Silvia Sofía García-López, Hilda Luna-Záizar, and Ana Rebeca Jaloma-Cruz. 2024. "Inverse Shifting-PCR Modified by Capillary Electrophoresis for Detecting F8 int22h and int1h Inversions in Severe Hemophilia A Patients and Probable Carriers" Life 14, no. 10: 1332. https://doi.org/10.3390/life14101332
APA StyleMartínez-Contreras, R. M., García-López, S. S., Luna-Záizar, H., & Jaloma-Cruz, A. R. (2024). Inverse Shifting-PCR Modified by Capillary Electrophoresis for Detecting F8 int22h and int1h Inversions in Severe Hemophilia A Patients and Probable Carriers. Life, 14(10), 1332. https://doi.org/10.3390/life14101332