Association of the DNA Methyltransferase and Folate Cycle Enzymes’ Gene Polymorphisms with Coronary Restenosis
Abstract
:1. Introduction
2. Materials and Methods
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Moussa, I.D.; Mohananey, D.; Saucedo, J.; Stone, G.W.; Yeh, R.W.; Kennedy, K.F.; Waksman, R.; Teirstein, P.; Moses, J.W.; Simonton, C. Trends and Outcomes of Restenosis After Coronary Stent Implantation in the United States. J. Am. Coll. Cardiol. 2020, 76, 1521–1531. [Google Scholar] [CrossRef] [PubMed]
- Bønaa, K.H.; Mannsverk, J.; Wiseth, R.; Aaberge, L.; Myreng, Y.; Nygård, O.; Nilsen, D.W.; Kløw, N.E. Drug-Eluting or Bare-Metal Stents for Coronary Artery Disease. N. Engl. J. Med. 2016, 375, 1242–1252. [Google Scholar] [CrossRef]
- Buccheri, D.; Piraino, D.; Andolina, G.; Cortese. Understanding and managing in-stent restenosis: A review of clinical data, from pathogenesis to treatment. J. Thorac. Dis. 2016, 8, E1150–E1162. [Google Scholar] [CrossRef] [Green Version]
- Omeh, D.J.; Shlofmitz, E. Restenosis; StatPearls [Internet]; StatPearls Publishing LLC: Treasure Island, FL, USA, 2021. [Google Scholar] [PubMed]
- Li, S.; Luo, C.; Chen, H. Risk factors of in-stent restenosis in patients with diabetes mellitus after percutaneous coronary intervention: A protocol for systematic review and meta-analysis. Medicine 2021, 100, e25484. [Google Scholar] [CrossRef] [PubMed]
- Zotz, R.J.; Dietz, U.; Lindemann, S.; Genth-Zotz, S. Koronare Restenose [Coronary restenosis]. J. Herz. 2019, 44, 35–39. [Google Scholar] [CrossRef]
- Aoki, J.; Tanabe, K. Mechanisms of drug-eluting stent restenosis. Cardiovasc. Interv Ther. 2020, 36, 23–29. [Google Scholar] [CrossRef] [PubMed]
- Ma, S.C.; Hao, Y.J.; Jiao, Y.; Wang, Y.H.; Xu, L.B.; Mao, C.Y.; Yang, X.L.; Yang, A.N.; Tian, J.; Zhang, M.H.; et al. Homocysteine-induced oxidative stress through TLR4/NF-κB/DNMT1-mediated LOX-1 DNA methylation in endothelial cells. Mol. Med. Rep. 2017, 16, 9181–9188. [Google Scholar] [CrossRef] [Green Version]
- Lai, W.K.; Kan, M.Y. Homocysteine-Induced Endothelial Dysfunction. Ann. Nutr. Metab. 2015, 67, 1–12. [Google Scholar] [CrossRef]
- Zhang, Z.; Xiao, S.; Yang, C.; Ye, R.; Hu, X.; Chen, X. Association of Elevated Plasma Homocysteine Level with Restenosis and Clinical Outcomes After Percutaneous Coronary Interventions: A Systemic Review and Meta-analysis. Cardiovasc. Drugs Ther. 2019, 33, 353–361. [Google Scholar] [CrossRef]
- Chrysant, S.G.; Chrysant, G.S. The current status of homocysteine as a risk factor for cardiovascular disease: A mini review. Expert Rev. Cardiovasc. Ther. 2018, 16, 559–565. [Google Scholar] [CrossRef]
- Petrossian, T.C.; Clarke, S.G. Uncovering the human methyltransferasome. Mol. Cell Proteomics. 2011, 10, 976. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, A.; Sun, Y.; Gao, Y.; Yang, S.; Mao, C.; Ding, N.; Deng, M.; Wang, Y.; Yang, X.; Jia, Y.; et al. Reciprocal Regulation Between miR-148a/152 and DNA Methyltransferase 1 Is Associated with Hyperhomocysteinemia-Accelerated Atherosclerosis. DNA Cell Biol. 2017, 36, 462–474. [Google Scholar] [CrossRef]
- Singh, P.R.; Lele, S.S. Folate gene polymorphisms MTR A2756G, MTRR A66G, and BHMT G742A and risk for coronary artery disease: A meta-analysis. Genet. Test Mol. Biomark. 2012, 16, 471–475. [Google Scholar] [CrossRef] [PubMed]
- Kim, A.K.; Kim, M.H.; Kim, D.H.; Go, H.N.; Cho, S.W.; Um, S.H.; Kim, D.I. Inhibitory effects of mesenchymal stem cells in intimal hyperplasia after balloon angioplasty. J. Vasc. Surg. 2016, 63, 510–517. [Google Scholar] [CrossRef] [Green Version]
- Liu, Y.; Tian, X.; Liu, S. DNA hypermethylation: A novel mechanism of CREG gene suppression and atherosclerogenic endothelial dysfunction. Redox Biol. 2020, 32, 101444. [Google Scholar] [CrossRef]
- Leclerc, D.; Sibani, S.; Rozen, R. Molecular Biology of Methylenetetrahydrofolate Reductase (MTHFR) and Overview of Mutations/Polymorphisms. In Madame Curie Bioscience Database; Landes Bioscience: Austin, TX, USA, 2000–2013. Available online: https://www.ncbi.nlm.nih.gov/books/NBK6561/ (accessed on 28 December 2021).
- Frosst, P.; Blom, H.J.; Milos, R. A candidate genetic risk factor for vascular disease: A common mutation in methylenetetrahydrofolate reductase. Nature Genet. 1995, 10, 111–113. [Google Scholar] [CrossRef]
- Jamaluddin, M.S.; Yang, X.; Wang, H. Hyperhomocysteinemia, DNA methylation and vascular disease. Clin. Chem. Lab. Med. 2007, 45, 1660–1666. [Google Scholar] [CrossRef]
- Moll, S.; Varga, E.A. Homocysteine and MTHFR Mutations. Circulation 2015, 132, e6–e9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gouveia, L.O.; Canhão, P. MTHFR and the risk for cerebral venous thrombosis—A meta-analysis. Thromb Res. 2010, 125, e153–e158. [Google Scholar] [CrossRef] [PubMed]
- Klerk, M.; Verhoef, P.; Clarke, R. MTHFR 677C—T polymorphism and risk of coronary heart disease: A meta-analysis. JAMA 2002, 288, 2023–2031. [Google Scholar] [CrossRef] [PubMed]
- Miner, S.E.; Hegele, R.A.; Sparkes, J. Homocysteine, lipoprotein(a), and restenosis after percutaneous transluminal coronary angioplasty: A prospective study. Am. Heart J. 2000, 140, 272–278. [Google Scholar] [CrossRef] [PubMed]
- Gu, Y.; Liu, Z.; Li, L. OLR1, PON1 and MTHFR gene polymorphisms, conventional risk factors and the severity of coronary atherosclerosis in a Chinese Han population. Cell Physiol Biochem. 2013, 31, 143–152. [Google Scholar] [CrossRef] [PubMed]
- Sun, K.; Song, J.; Liu, K. Associations between homocysteine metabolism related SNPs and carotid intima-media thickness: A Chinese sib pair study. J. Thromb. Thrombolysis 2017, 43, 401–410. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smolkov, I.V.; Tuguz, A.R.; Shumilov, D.S.; Kushu, L.T.; Muzhenya, D.V.; Ashkanova, T.M.; Tatarkova, E.A. The role of folate cycle gene polymorphisms in the development of complications of peripheral atherosclerosis. Eurasian J. Cardiol. 2016, 3, 156. [Google Scholar]
- Sherbak, S.G.; Sarana, A.M.; Makarenko, S.V.; Kamiliva, T.A.; Maximov, A.G. Some genetical peculiarities of metabolism of homocysteine, folate and nitric oxide as risk factors of ishemic heart disease. Her. Northwestern State Med. Univ. Named After I.I. Mechnikov. 2016, 8, 123–130. [Google Scholar]
- Ahmed, A.A.M.; Azova, M.M.; Ramazanova, F.U.; Gigani, O.B. DNMT1 And DNMT3a gene polymorphisms and early pregnancy loss. Russ. J. Genet. 2020, 56, 379–382. [Google Scholar] [CrossRef]
- Liu, Z.; Wang, L.; Wang, L.E.; Sturgis, E.M.; Wei, Q. Polymorphisms of the DNMT3B gene and risk of squamous cell carcinoma of the head and neck: A case-control study. Cancer Lett. 2008, 268, 158–165. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bao, Q.; He, B.S.; Chen, L.P.; Gu, L.; Nie, Z.L.; Wang, S.K. Correlation between polymorphism in the promoter of DNA methyltransferase-3B and the risk of colorectal cancer. Zhonghua Yu Fang Yi Xue Za Zhi. 2012, 46, 53–57. (In Chinese) [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mostowska, A.; Sajdak, S.; Pawlik, P.; Lianeri, M.; Jagodzinski, P.P. DNMT1, DNMT3A and DNMT3B gene variants in relation to ovarian cancer risk in the Polish population. Mol. Biol. Rep. 2013, 40, 4893–4899. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Xu, Y.; Yan, S. Adenosine kinase is critical for neointima formation after vascular injury by inducing aberrant DNA hypermethylation. Cardiovasc. Res. 2020, 117, cvaa040. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Mei, J.; Li, J.; Zhang, Y.; Zhou, Q.; Xu, F. DNA Methylation in Atherosclerosis: A New Perspective. Evid. Based Complement Altern. Med. 2021, 2021, 6623657. [Google Scholar] [CrossRef] [PubMed]
Gene (Symbols, Title) | OMIM Number | Location | Reference Transcript | SNP | Ref SNP ID |
---|---|---|---|---|---|
MTHFR 5,10-Methylenetetrahydrofolate reductase | 607093 | 1p36.22 | NM_005957.5 | C677T | rs1801133 |
A1298C | rs1801131 | ||||
MTR 5-methyltetrahydrofolate-homocysteine S-methyltransferase | 156570 | 1q43 | NM_000254.2 | A2756G | rs1805087 |
MTRR methionine synthase reductase (MSR) | 602568, | 5p15.31 | NM_002454.2 | Ile22Met | rs1801394 |
DNMT1 DNA methyltransferase 1 (DNMT, MCMT, CXXC9) | 126375 | 19p13.2 | NM_001379.2 | A626G | rs8101626 |
DNMT3B DNA methyltransferase 3 beta | 602900 | 20q11.21 | NM_006892.3 | C149T | rs2424913 |
G39179T | rs1569686 |
Gene Polymorphism | Primer Sequences | Annealing Temperature | Restriction Enzymes | DNA Fragments, bp |
---|---|---|---|---|
DNMT3B rs2424913 | F: 5′TGCTGTGACAGGCAGAGCAG3′ R: 5′GGTAGCCGGGAACTCCACGG3′ | 65 °C | ASPA2I | CC: 380 CT:380, 207, 173 TT: 207, 173 |
DNMT3B rs1569686 | F: 5GAGGTCTCATTATGCCTAGG3′ R: 5GGGAGCTCACCTTCTAGAAA3′ | 49 °C | PVuII | TT: 132, 93 TG: 225, 132, 93 GG: 225 |
DNMT1 rs8101626 | F: 5′-CAAATGGGCCACCTAGACAC-3′ R: 5′-GGCAGAGATTGAGCCAGAAG-3′ | 67 °C | BStMAI | AA: 640 AG: 640, 474, 166 GG: 474, 166 |
Characteristics | With ISR | Without ISR |
---|---|---|
Total length of stents, mm (M ± SD) | 52.5 ± 40.2 | 47.0 ± 29.0 |
Minimal stent diameter, mm (M ± SD) | 3.1 ± 0.54 | 2.9 ± 0.45 |
I generation DES, % | 20 | 17 |
II generation DES, % | 66 | 62 |
III generation DES, % | 14 | 21 |
With ISR (n = 54) | Without ISR (n = 59) | p Value | Control (n = 62) | |
---|---|---|---|---|
Age, years (M ± SD) | 60.0 ± 10.1 | 58.8 ± 8.0 | 0.885 | 49.7 ± 10.8 |
Smoking, % | 60 | 58 | 0.774 | 28 |
Obesity, % | 34 | 27 | 0.282 | 21 |
Dyslipidemia, % | 62 | 52 | 0.153 | 14 |
Diabetes mellitus, % | 53 * | 8 | <0.0001 | 0 |
Myocardial infarction, % | 36 | 25 | 0.091 | 0 |
Multifocal atherosclerosis, % | 47 * | 20 | 0.0001 | 0 |
Arterial hypertension, % | 63 | 56 | 0.313 | 52 |
Systolic blood pressure, mm Hg (M ± SD) | 138 ± 7.3 | 137 ± 7.8 | 0.952 | 129 ± 11.2 |
Diastolic blood pressure, mm Hg (M ± SD) | 88 ± 4.9 | 87 ± 7.8 | 0.939 | 79 ± 9.7 |
Glucose, mmol/L (M ± SD) | 4.4 ± 1.0 | 4.3 ± 1.2 | 0.973 | 4.4 ± 0.7 |
Total cholesterol, mmol/L (M ± SD) | 5.2 ± 1.7 | 4.3 ±1.8 | 0.770 | 4.2 ± 0.8 |
Low-density lipoproteins, mmol/L (M ± SD) | 2.3 ± 1.2 | 2.4 ± 0.9 | 0.963 | 2.4 ± 0.5 |
High-density lipoproteins, mmol/L (M ± SD) | 1.4 ± 0.6 | 1.5 ± 0.5 | 0.953 | 1.6 ± 0.5 |
Multivessel coronary artery disease, % | 68 * | 47 | 0.004 | 0 |
Gene Polymorphisms | Genotypes and Alleles | Control (n = 62) | CAD (n = 113) | Restenosis+ (n = 54) | Restenosis– (n = 59) | Restenosis+ | p Value | |||
---|---|---|---|---|---|---|---|---|---|---|
Under 65 Years (n = 36) | Over 65 Years (n = 18) | Before 12 Months (n = 22) | After 12 Months (n = 32) | |||||||
MTHFR rs 1801133 | CC | 50% (31) | 51% (58) | 48% (26) | 54% (32) | 50% (18) | 44% (8) | 50% (11) | 47% (15) | |
CT | 39% (24) | 39% (44) | 41% (22) | 37% (22) | 44% (16) | 34% (6) | 41% (9) | 41% (13) | ||
TT | 11% (7) | 10% (11) | 11% (6) | 9% (5) | 6% (2) 1,* | 22% (4) 4 | 9% (2) | 12% (4) | p = 0.004 1 p = 0.037 4 | |
C | 69.5% | 70.5% | 68.5% | 72.5% | 72% | 61% | 70.5% | 67.5% | ||
T | 30.5% | 29.5% | 31.5% | 27.5% | 28% | 39% | 29.5% | 32.5% | ||
MTHFR rs 1801131 | AA | 34% (21) | 26% (29) | 22% (12) | 29% (17) | 22% (8) | 22% (4) | 18% (4) | 25% (8) | |
AC | 58% (36) | 60% (68) | 65% (35) | 56% (33) | 64% (23) | 67% (12) | 59% (13) | 69% (22) | ||
CC | 8% (5) | 14% (16) | 13% (7) | 15% (9) | 14% (5) | 11% (2) | 23% (5) 2,* | 6% (2) | p = 0.003 2 | |
A | 63% | 56% | 54.5% | 57% | 54% | 55.5% | 47.5% | 59.5% | ||
C | 37% | 44% | 45.5% | 43% | 46% | 44.5% | 52.5% | 40.5% | ||
MTR rs 1805087 | AA | 66% (41) | 55% (63) | 56% (30) | 56% (33) | 53% (19) | 61% (11) | 55% (12) | 56% (18) | |
AG | 28% (17) | 38% (43) | 35% (19) | 41% (24) | 36% (13) | 33% (6) | 41% (9) | 31% (10) | ||
GG | 6% (4) | 7% (7) | 9% (5) | 3% (2) | 11% (4) | 6% (1) | 4% (1) 2 | 13% (4) 4 | p = 0.046 2 p = 0.022 4 | |
A | 80% | 74% | 73.5% | 76.5% | 71% | 77.5% | 75.5% | 71.5% | ||
G | 20% | 26% | 26.5% | 23.5% | 29% | 22.5% | 24.5% | 28.5% | ||
MTRR rs 1801394 | AA | 23% (14) | 22% (25) | 20% (11) | 24% (14) | 14% (5) | 33% (6) | 27% (6) | 16% (5) | |
AG | 42% (26) | 43% (49) | 46% (25) | 41% (24) | 53% (19) 1,* | 34% (6) | 50% (11) | 43% (14) | p = 0.003 1 | |
GG | 35% (22) | 35% (39) | 34% (18) | 35% (21) | 33% (12) | 33% (6) | 23% (5) 2,* | 41% (13) | p = 0.015 2 | |
A | 44% | 43.5% | 43% | 44.5% | 40.5% | 50% | 52% | 37.5% | ||
G | 56% | 56.5% | 57% | 55.5% | 59.5% | 50% | 48% | 62.5% | ||
DNMT1 rs8101626 | AA | 53% (33) | 35% (39) | 35% (19) | 34% (20) | 34% (12) | 39% (7) | 41% (9) | 31% (10) | |
AG | 37% (23) | 51% (58) | 52% (28) | 51% (30) | 50% (18) | 56% (10) | 45% (10) | 56% (18) | ||
GG | 10% (6) | 14% (16) | 13% (7) | 15% (9) | 16% (6) 1 | 5% (1) | 14% (3) | 13% (4) | p = 0.04 1 | |
A | 71.5% | 60.5% | 61% | 59.5% | 59% | 67% | 63.5% | 59% | ||
G | 28.5% | 39.5% | 39% | 40.5% | 41% | 33% | 36.5% | 41% | ||
DNMT3B Rs1569686 | GG | 56% (35) | 49% (55) | 28% (15) | 68% (40) | 30% (11) | 22% (4) | 22% (5) | 31% (10) | |
GT | 20% (12) | 36% (41) 3,*,5,* | 50% (27) | 24% (14) | 42% (15) | 67% (12) | 64% (14) | 41% (13) | p = 0.01 3 p = 0.03 5 | |
TT | 24% (15) | 15% (17) | 22% (12) 4,* | 8% (5) | 28% (10) 1,* | 11% (2) | 14% (3) 2,* | 28% (9) | p = 0.001 1 p = 0.004 2 p < 0.0001 4 | |
G | 66% | 67% | 53% | 80% | 51% | 55.5% | 54% | 51.5% | ||
T | 34% | 33% | 47% | 20% | 49% | 44.5% | 46% | 48.5% | ||
DNMT3B Rs2424913 | CC | 40% (25) | 40% (45) | 35% (19) | 25% (26) | 30% (11) | 44% (8) | 32% (7) | 38% (12) | |
CT | 47% (29) | 50% (56) | 50% (27) | 70% (29) | 53% (19) | 44% (8) | 54% (12) | 47% (15) | ||
TT | 13% (8) | 10% (12) | 15% (8) 4,* | 5% (4) | 17% (6) | 12% (2) | 14% (3) | 15% (5) | p = 0.007 4 | |
C | 63.5% | 65% | 60% | 60% | 56.5% | 66% | 59% | 61.5% | ||
T | 36.5% | 35% | 40% | 40% | 43.5% | 34% | 41% | 38.5% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Timizheva, K.B.; Ahmed, A.A.M.; Ait Aissa, A.; Aghajanyan, A.V.; Tskhovrebova, L.V.; Azova, M.M. Association of the DNA Methyltransferase and Folate Cycle Enzymes’ Gene Polymorphisms with Coronary Restenosis. Life 2022, 12, 245. https://doi.org/10.3390/life12020245
Timizheva KB, Ahmed AAM, Ait Aissa A, Aghajanyan AV, Tskhovrebova LV, Azova MM. Association of the DNA Methyltransferase and Folate Cycle Enzymes’ Gene Polymorphisms with Coronary Restenosis. Life. 2022; 12(2):245. https://doi.org/10.3390/life12020245
Chicago/Turabian StyleTimizheva, Kalima B., Abdulbary A. M. Ahmed, Amira Ait Aissa, Anna V. Aghajanyan, Leyla V. Tskhovrebova, and Madina M. Azova. 2022. "Association of the DNA Methyltransferase and Folate Cycle Enzymes’ Gene Polymorphisms with Coronary Restenosis" Life 12, no. 2: 245. https://doi.org/10.3390/life12020245