TaaI/Cdx-2 AA Variant of VDR Defines the Response to Phototherapy amongst Patients with Psoriasis
Abstract
1. Introduction
2. Materials and Methods
2.1. Subjects
2.2. ELISA
2.3. Genotyping
2.4. Statistical Analysis
3. Results
3.1. Influence of UVB Treatment on Selected Clinical Features
3.2. Genotype Frequencies
3.3. Association of VDR SNPs with Selected Clinical Features
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Boehncke, W.H.; Schön, M.P. Psoriasis. Lancet 2015, 386, 983–994. [Google Scholar] [CrossRef]
- Danielsen, K.; Duvetorp, A.; Iversen, L.; Østergaard, M.; Seifert, O.; Steinar, K.T.; Skov, L. Prevalence of psoriasis and psoriatic arthritis and patient perceptions of severity in Sweden, Norway and Denmark: Results from the nordic patient survey of psoriasis and psoriatic arthritis. Acta Derm. Venereol. 2019, 99, 18–25. [Google Scholar] [CrossRef]
- Parisi, R.; Symmons, D.P.M.; Griffiths, C.E.M.; Ashcroft, D.M. Global epidemiology of psoriasis: A systematic review of incidence and prevalence. J. Investig. Dermatol. 2013, 113, 377–385. [Google Scholar] [CrossRef]
- Borzęcki, A.; Koncewicz, A.; Raszewska-Famielec, M.; Dudra-Jastrzębska, M. Epidemiology of psoriasis in the years 2008–2015 in Poland. Dermatol. Rev. 2018, 105, 693–700. [Google Scholar] [CrossRef]
- Medical Advisory Secretariat, Ontario Health Technology Advisory Committee. Ultraviolet Phototherapy Management of Moderate-to-Severe Plaque Psoriasis: An Evidence-Based Analysis. Ont. Health Technol. Assess. Ser. 2009, 9, 1–66. [Google Scholar] [PubMed]
- Gaffen, S.L.; Jain, R.; Garg, A.V.; Cua, D.J. The IL-23-IL-17 immune axis: From mechanisms to therapeutic testing. Nat. Rev. Immunol. 2014, 14, 585–600. [Google Scholar] [CrossRef] [PubMed]
- Barrea, L.; Nappi, F.; Di Somma, C.; Savanelli, M.C.; Falco, A.; Balato, A.; Balato, N.; Savastano, S. Environmental Risk Factors in Psoriasis: The Point of View of the Nutritionist. Int. J. Environ. Res. Public Health 2016, 13, 743. [Google Scholar] [CrossRef]
- Mrowietz, U.; Kragballe, K.; Reich, K.; Spuls, P.; Griffiths, C.E.M.; Nast, A.; Franke, J.; Antoniou, C.; Arenberger, P.; Balieva, F.; et al. Definition of treatment goals for moderate to severe psoriasis: A European consensus. Arch. Dermatol. Res. 2011, 303, 1–10. [Google Scholar] [CrossRef]
- Sadowska, M.; Lesiak, A.; Narbutt, J. Application of phototherapy in the treatment of psoriasis vulgaris. Dermatol. Rev. 2019, 106, 198–209. [Google Scholar] [CrossRef]
- Menter, A.; Korman, N.J.; Elmets, C.A.; Feldman, S.R.; Gelfand, J.M.; Gordon, K.B.; Gottlieb, A.; Koo, J.Y.M.; Lebwohl, M.; Lim, H.W.; et al. Guidelines of care for the management of psoriasis and psoriatic arthritis: Section 5. Guidelines of care for the treatment of psoriasis with phototherapy and photochemotherapy. J. Am. Acad. Dermatol. 2010, 62, 114–135. [Google Scholar] [CrossRef] [PubMed]
- Almutawa, F.; Alnomair, N.; Wang, Y.; Hamzavi, I.; Lim, H.W. Systematic review of UV-based therapy for psoriasis. Am. J. Clin. Dermatol. 2013, 14, 87–109. [Google Scholar] [CrossRef]
- Pathirana, D.; Ormerod, A.D.; Saiag, P.; Smith, C.; Spuls, P.I.; Nast, A.; Barker, J.; Bos, J.D.; Burmester, G.-R.; Chimenti, S.; et al. European S3-guidelines on the systemic treatment of psoriasis vulgaris. J. Eur. Acad. Dermatol. Venereol. 2009, 23 (Suppl. S2), 5–70. [Google Scholar] [CrossRef]
- Matos, T.R.; Sheth, V. The symbiosis of phototherapy and photoimmunology. Clin. Dermatol. 2016, 34, 538–547. [Google Scholar] [CrossRef] [PubMed]
- Ling, T.C.; Clayton, T.H.; Crawley, J.; Exton, L.S.; Goulden, V.; Ibbotson, S.; McKenna, K.; Mohd Mustapa, M.F.; Rhodes, L.E.; Sarkany, R.; et al. British Association of Dermatologists and British Photodermatology Group guidelines for the safe and effective use of psoralen-ultraviolet A therapy 2015. Br. J. Dermatol. 2016, 174, 24–55. [Google Scholar] [CrossRef]
- Matos, T.R.; Ling, T.C.; Sheth, V. Ultraviolet B radiation therapy for psoriasis: Pursuing the optimal regime. Clin. Dermatol. 2016, 34, 587–593. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, H.; Miyamoto, K.; Li, B.; Taketani, Y.; Kitano, M.; Inoue, Y.; Morita, K.; Pike, W.J.; Takeda, E. The caudal related homeodomain protein Cdx-2 regulates vitamin D receptor gene expression in the small intestine. J. Bone Miner. Res. 1999, 14, 240–247. [Google Scholar] [CrossRef] [PubMed]
- Arai, H.; Miyamoto, K.I.; Yoshida, M.; Yamamoto, H.; Taketani, Y.; Morita, K.; Kubota, M.; Yoshida, S.; Ikeda, M.; Watabe, F.; et al. The polymorphism in the caudal-related homeodomain protein Cdx-2 binding element in the human vitamin D receptor gene. J. Bone Miner. Res. 2001, 16, 1256–1264. [Google Scholar] [CrossRef]
- Sentinelli, F.; Bertoccini, L.; Barchetta, I.; Capoccia, D.; Incani, M.; Pani, M.G.; Loche, S.; Angelico, F.; Arca, M.; Morini, S.; et al. The vitamin D receptor (VDR) gene rs11568820 variant is associated with type 2 diabetes and impaired insulin secretion in Italian adult subjects, and associates with increased cardio-metabolic risk in children. Nutr. Metab. Cardiovasc. Dis. 2016, 26, 407–413. [Google Scholar] [CrossRef]
- Deeb, K.K.; Trump, D.L.; Johnson, C.S. Vitamin D signalling pathways in cancer: Potential for anticancer therapeutics. Nat. Rev. Cancer 2007, 7, 684–700. [Google Scholar] [CrossRef] [PubMed]
- Zmuda, J.M.; Cauley, J.A.; Ferrell, R.E. Molecular epidemiology of vitamin D receptor gene variants. Epidemiol. Rev. 2000, 22, 203–217. [Google Scholar] [CrossRef] [PubMed]
- Köstner, K.; Denzer, N.; Müller, C.S.; Klein, R.; Tilgen, W.; Reichrath, J. The relevance of vitamin D receptor (VDR) gene polymorphisms for cancer: A review of the literature. Anticancer Res. 2009, 29, 3511–3536. [Google Scholar] [PubMed]
- Lee, Y.H. Vitamin D receptor ApaI, TaqI, BsmI, and FokI polymorphisms and psoriasis susceptibility: An updated meta-analysis. Clin. Exp. Dermatol. 2019, 44, 498–505. [Google Scholar] [CrossRef]
- Gallo, E.; Cabaleiro, T.; Roman, M.; Solano-Lopez, G.; Abad-Santos, F.; Garcia-Diez, A.; Daudén, E. The relationship between tumour necrosis factor (TNF)-alpha promoter and IL12B/IL-23R genes polymorphisms and the efficacy of anti-TNF-alpha therapy in psoriasis: A case-control study. Br. J. Dermatol. 2013, 169, 819–829. [Google Scholar] [CrossRef]
- West, J.; Ogston, S.; Berg, J.; Palmer, C.; Fleming, C.; Kumar, V.; Foerster, J. HLA-Cw6-positive patients with psoriasis show improved response to methotrexate treatment. Clin. Exp. Dermatol. 2017, 42, 651–655. [Google Scholar] [CrossRef] [PubMed]
- Talamonti, M.; Galluzzo, M.; van den Reek, J.M.; de Jong, E.M.; Lambert, J.L.W.; Malagoli, P.; Bianchi, L.; Costanzo, A. Role of the HLA-C*06 allele in clinical response to ustekinumab: Evidence from real life in a large cohort of European patients. Br. J. Dermatol. 2017, 177, 489–496. [Google Scholar] [CrossRef] [PubMed]
- Li, K.; Huang, C.C.; Randazzo, B.; Li, S.; Szapary, P.; Curran, M.; Campbell, K.; Brodmerkel, C. HLA-C*06:02 Allele and Response to IL-12/23 Inhibition: Results from the Ustekinumab Phase 3 Psoriasis Program. J. Investig. Dermatol. 2016, 136, 2364–2371. [Google Scholar] [CrossRef]
- Bojko, A.; Ostasz, R.; Białecka, M.; Klimowicz, A.; Malinowski, D.; Budawski, R.; Bojko, P.; Droździk, M.; Kurzawski, M. IL12B, IL23A, IL23R and HLA-C*06 genetic variants in psoriasis susceptibility and response to treatment. Hum. Immunol. 2018, 79, 213–217. [Google Scholar] [CrossRef] [PubMed]
- Reich, A.; Orda, A.; Wiśnicka, B.; Szepietowski, J.C. Plasma neuropeptides and perception of pruritus in psoriasis. Acta Derm. Venereol. 2007, 87, 299–304. [Google Scholar] [CrossRef]
- Reich, A.; Szepietowski, J.C. Mediators of pruritus in psoriasis. Mediat. Inflamm. 2007, 2007, 64727. [Google Scholar] [CrossRef]
- Aydogan, K.; Karadogan, S.K.; Tunali, S.; Adim, S.B.; Ozcelik, T. Narrowband UVB phototherapy for small plaque parapsoriasis. J. Eur. Acad. Dermatol. Venereol. 2006, 20, 573–577. [Google Scholar] [CrossRef]
- Park, B.S.; Park, J.S.; Lee, D.Y.; Youn, J.I.; Kim, I.G. Vitamin D receptor polymorphism is associated with psoriasis. J. Investig. Dermatol. 1999, 112, 113–116. [Google Scholar] [CrossRef]
- Kaya, T.I.; Erdal, M.E.; Tursen, U.; Camdeviren, H.; Gunduz, O.; Soylemez, F.; Ikizoglu, G. Association between vitamin D receptor gene polymorphism and psoriasis among the Turkish population. Arch. Dermatol. Res. 2002, 294, 286–289. [Google Scholar] [CrossRef] [PubMed]
- Dayangac-Erden, D.; Karaduman, A.; Erdem-Yurter, H. Polymorphisms of vitamin D receptor gene in Turkish familial psoriasis patients. Arch. Dermatol. Res. 2007, 299, 487–491. [Google Scholar] [CrossRef] [PubMed]
- Rucevic, I.; Stefanic, M.; Tokic, S.; Vuksic, M.; Glavas-Obrovac, L.; Barisic-Drusko, V. Lack of association of vitamin D receptor gene 3‘-haplotypes with psoriasis in Croatian patients. J. Dermatol. 2012, 39, 58–62. [Google Scholar] [CrossRef]
- Zhu, H.Q.; Xie, K.C.; Chen, L.D.; Zhu, G.D. The Association between vitamin D receptor polymorphism and psoriasis. Chin. J. Dermatol. 2002, 35, 386–388. [Google Scholar]
- Zhou, X.; Xu, L.; Li, Y.Z. The association of polymorphisms of the vitamin D receptor gene with psoriasis in the Han population of northeastern China. J. Dermatol. Sci. 2014, 73, 63–66. [Google Scholar] [CrossRef]
- Shen, H.; Liu, Q.; Huang, P.; Fan, H.; Zang, F.; Liu, M.; Zhuo, L.; Wu, J.; Wu, G.; Yu, R.; et al. Vitamin D receptor genetic polymorphisms are associated with oral lichen planus susceptibility in a Chinese Han population. BMC Oral Health 2020, 20, 26. [Google Scholar] [CrossRef]
- Iwakura, Y.; Ishigame, H.; Saijo, S.; Nakae, S. Functional specialization of interleukin-17 family members. Immunity 2011, 25, 149–162. [Google Scholar] [CrossRef] [PubMed]
- Tollenaere, M.A.X.; Hebsgaard, J.; Ewald, D.A.; Lovato, P.; Garcet, S.; Li, X.; Pilger, S.D.; Tiirikainen, M.L.; Bertelsen, M.; Krueger, G.J.; et al. Signaling of multiple IL-17 family cytokines through IL-17RA drive psoriasis-related inflammatory pathways. Br. J. Dermatol. 2021. [Google Scholar] [CrossRef] [PubMed]
- Di Cesare, A.; Di Meglio, P.; Nestle, F.O. The IL-23/Th17 axis in the immunopathogenesis of psoriasis. J. Investig. Dermatol. 2009, 129, 1339–1350. [Google Scholar] [CrossRef]
- Germán, B.; Wei, R.; Hener, P.; Martins, C.; Ye, T.; Gottwick, C.; Yang, J.; Seneschal, J.; Boniface, K.; Li, M. Disrupting the IL-36 and IL-23/IL-17 loop underlies the efficacy of calcipotriol and corticosteroid therapy for psoriasis. JCI Insight 2019, 24, e123390. [Google Scholar] [CrossRef] [PubMed]
- Chan, J.R.; Blumenschein, W.; Murphy, E.; Diveu, C.; Wiekowski, M.; Abbondanzo, S.; Lucian, L.; Geissler, R.; Brodie, S.; Kimball, A.B.; et al. IL-23 stimulates epidermal hyperplasia via TNF and IL-20R2-dependent mechanisms with implications for psoriasis pathogenesis. J. Exp. Med. 2006, 203, 2577–2587. [Google Scholar] [CrossRef] [PubMed]
Polymorphism | Alleles | PCR Primer | Annealing Temperature | PCR Product (BP) | Restriction Enzyme | RFLP Products (BP) |
---|---|---|---|---|---|---|
rs2228570 (FokI) | 162 T/C (Met1Thr, exon 1) | F: 5′-CACCCTGGAAGTAAAACA-3′ R: 5′-ACCTGAAGAAGCCTTTGC-3′ | 56 °C | 486 | FokI | 486 CC 344/142 TT 486/344/142 TC |
rs7975232 (ApaI) | 64978G/T (intron 8 variant) | F: 5′- GCAAAGATAGCAGAGCAGAGTTCC –3′ R: 5′- AGGTTGGACAGGAGAGAGAATGG -3′ | 56 °C | 781 | ApaI | 781 TT 469/312 GG 781/469/312 GT |
rs1544410 (BsmI) | 63980G/A (intron 8 variant) | F: 5′- GGGGAGTATGAAGGACAAAGAC–3′ R: 5′-TTCTCACCTCTAACCAGCGG-3′ | 56 °C | 429 | HinP1I | 429 AA 282/147 GG 429/282/147 GA |
rs731236 (TaqI) | 1216 C/T (Ile352Ile, exon 9) | F: 5′- CAGAGCATGGACAGGGAGCAAG-3′ R: 5′-GCAACTCCTCATGGCTGAGGTCTC-3′ | 56 °C | 740 | TaqI | 740 TT 495/245 CC 740/495/245 CT |
rs11568820 (TaaI/Cdx-2) | G/A (promoter region) | TaqMan® SNP Genotyping assay C___2880808_10 |
Controls | Patients with Psoriasis | p Value * | ||||
---|---|---|---|---|---|---|
ApaI | N | (%) | N | (%) | ||
GG | 11 | (22) | 11 | (22) | ||
GT | 17 | (34) | 20 | (40) | ||
TT | 22 | (44) | 19 | (38) | ||
FokI | ||||||
CC | 31 | (62) | 12 | (24) | ||
CT | 11 | (22) | 21 | (42) | 0.03 | |
TT | 8 | (16) | 17 | (34) | 0.04 | |
TaqI | ||||||
TT | 17 | (34) | 15 | (30) | ||
TC | 22 | (44) | 20 | (40) | ||
CC | 11 | (22) | 15 | (30) | ||
BsmI | ||||||
AA | 6 | (12) | 17 | (34) | 0.03 | |
AG | 18 | (36) | 20 | (40) | ||
GG | 26 | (52) | 13 | (26) | ||
TaaI/Cdx-2 | ||||||
AA | 23 | (46) | 7 | (14) | ||
AG | 22 | (44) | 17 | (34) | ||
GG | 5 | (10) | 26 | (52) | <0.001 |
PASI 50 Yes | PASI 50 No | PASI 75 Yes | PASI 75 No | PASI 90 Yes | PASI 90 No | BSA Response over Median | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Apal | N | (%) | N | (%) | N | (%) | N | (%) | N | (%) | N | (%) | N (yes) | (%) | |
GG | 8 | (73) | 3 | (27) | 3 | (27) | 8 | (73) | 0 | (0) | 11 | (100) | 5 | (45) | |
GT | 17 | (85) | 3 | (15) | 9 | (45) | 11 | (55) | 2 | (10) | 18 | (90) | 8 | (40) | |
TT | 18 | (95) | 1 | (5) | 10 | (53) | 9 | (47) | 1 | (5) | 18 | (95) | 11 | (58) | |
Fokl | |||||||||||||||
CC | 9 | (75) | 3 | (25) | 5 | (42) | 7 | (58) | 1 | (8) | 11 | (92) | 5 | (42) | |
CT | 19 | (90) | 2 | (10) | 8 | (38) | 13 | (62) | 1 | (5) | 20 | (95) | 10 | (48) | |
TT | 15 | (88) | 2 | (12) | 9 | (53) | 8 | (47) | 1 | (6) | 16 | (94) | 9 | (53) | |
Taql | |||||||||||||||
TT | 14 | (93) | 1 | (7) | 6 | (40) | 9 | (60) | 2 | (13) | 13 | (87) | 7 | (47) | |
TC | 18 | (90) | 2 | (10) | 11 | (55) | 9 | (45) | 1 | (5) | 19 | (95) | 11 | (55) | |
CC | 11 | (73) | 4 | (27) | 5 | (33) | 10 | (67) | 0 | (0) | 15 | (100) | 6 | (40) | |
Bsml | |||||||||||||||
AA | 15 | (88) | 2 | (12) | 10 | (59) | 7 | (41) | 1 | (6) | 16 | (94) | 8 | (47) | |
AG | 16 | (80) | 4 | (20) | 7 | (35) | 13 | (65) | 2 | (10) | 18 | (90) | 8 | (40) | |
GG | 12 | (92) | 1 | (8) | 5 | (38) | 8 | (62) | 0 | (0) | 13 | (100) | 8 | (62) | |
Taal/Cdx-2 | |||||||||||||||
AA | 4 | (57) | 3 | (43) | 2 | (29) | 5 | (71) | 0 | (0) | 7 | (100) | 1 | (14) | |
AG | 15 | (88) | 2 | (12) | 6 | (35) | 11 | (65) | 0 | (0) | 17 | (100) | 7 | (41) | |
GG | 24 | (92) | 2 | (8) | 14 | (54) | 12 | (46) | 3 | (12) | 23 | (88) | 16 | (62) |
Before UV (Mean) | After UV (Mean) | p | ||
---|---|---|---|---|
FokI | TT | 15.77 | 2.96 | 0.0130 * |
CT | 10.03 | 2.75 | 0.0021 * | |
CC | 8.87 | 2.12 | 0.0404 * | |
ApaI | TT | 11.43 | 3.58 | 0.0475 * |
TG | 10.73 | 2.67 | 0.0006 * | |
GG | 11.14 | 2.64 | 0.0203 * | |
TaqI | TT | 12.75 | 3.34 | 0.0742 |
TC | 10.96 | 2.24 | 0.0001 * | |
CC | 9.14 | 3.68 | 0.0013 * | |
BsmI | AA | 16.09 | 2.89 | 0.0178 * |
GA | 9.55 | 3.22 | <0.0001 * | |
GG | 8.99 | 2.83 | 0.0214 * | |
TaaI/Cdx-2 | GG | 12.94 | 2.98 | 0.0066 * |
AG | 9.09 | 2.59 | <0.0001 * | |
AA | 11.51 | 4.11 | 0.1720 |
Before UV (Mean) | After UV (Mean) | p | ||
---|---|---|---|---|
FokI | TT | 28.33 | 24.11 | 0.1177 |
CT | 28.32 | 22.89 | 0.0376 * | |
CC | 20.31 | 22.81 | 0.4713 | |
ApaI | TT | 23.52 | 23.41 | 0.9674 |
TG | 25.63 | 23.85 | 0.5515 | |
GG | 27.57 | 22.04 | 0.1329 | |
TaqI | TT | 22.55 | 22.53 | 0.9958 |
TC | 25.26 | 23.72 | 0.5784 | |
CC | 28.43 | 23.46 | 0.0726 | |
BsmI | AA | 28.48 | 22.21 | 0.0365 * |
GA | 25.68 | 23.41 | 0.3910 | |
GG | 22.06 | 24.49 | 0.4772 | |
TaaI/Cdx-2 | GG | 28.76 | 23.79 | 0.0076 * |
AG | 24.99 | 22.37 | 0.4618 | |
AA | 19.82 | 23.62 | 0.3281 |
Before UV (Mean) | After UV (Mean) | p | ||
---|---|---|---|---|
Fokl | TT | 95.35 | 75.53 | <0.0001 * |
CT | 94.24 | 88.24 | 0.3329 | |
CC | 86.95 | 75.51 | 0.2028 | |
Apal | TT | 83.50 | 81.85 | 0.7814 |
TG | 88.40 | 85.30 | 0.6725 | |
GG | 92.15 | 83.58 | 0.2697 | |
Taql | TT | 82.03 | 89.32 | 0.3626 |
TC | 89.18 | 83.31 | 0.3796 | |
CC | 90.70 | 78.31 | 0.0320 * | |
Bsml | AA | 88.16 | 79.23 | 0.1717 |
GA | 91.97 | 83.87 | 0.1134 | |
GG | 81.25 | 88.94 | 0.4187 | |
TaaI/Cdx-2 | GG | 96.16 | 86.13 | 0.0114 * |
AG | 88.18 | 81.05 | 0.2374 | |
AA | 71.55 | 80.46 | 0.5445 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lesiak, A.; Wódz, K.; Ciążyńska, M.; Skibinska, M.; Waszczykowski, M.; Ciążyński, K.; Olejniczak-Staruch, I.; Sobolewska-Sztychny, D.; Narbutt, J. TaaI/Cdx-2 AA Variant of VDR Defines the Response to Phototherapy amongst Patients with Psoriasis. Life 2021, 11, 567. https://doi.org/10.3390/life11060567
Lesiak A, Wódz K, Ciążyńska M, Skibinska M, Waszczykowski M, Ciążyński K, Olejniczak-Staruch I, Sobolewska-Sztychny D, Narbutt J. TaaI/Cdx-2 AA Variant of VDR Defines the Response to Phototherapy amongst Patients with Psoriasis. Life. 2021; 11(6):567. https://doi.org/10.3390/life11060567
Chicago/Turabian StyleLesiak, Aleksandra, Karolina Wódz, Magdalena Ciążyńska, Małgorzata Skibinska, Michał Waszczykowski, Karol Ciążyński, Irmina Olejniczak-Staruch, Dorota Sobolewska-Sztychny, and Joanna Narbutt. 2021. "TaaI/Cdx-2 AA Variant of VDR Defines the Response to Phototherapy amongst Patients with Psoriasis" Life 11, no. 6: 567. https://doi.org/10.3390/life11060567
APA StyleLesiak, A., Wódz, K., Ciążyńska, M., Skibinska, M., Waszczykowski, M., Ciążyński, K., Olejniczak-Staruch, I., Sobolewska-Sztychny, D., & Narbutt, J. (2021). TaaI/Cdx-2 AA Variant of VDR Defines the Response to Phototherapy amongst Patients with Psoriasis. Life, 11(6), 567. https://doi.org/10.3390/life11060567