Next Article in Journal
Effect of Gabapentin in a Neuropathic Pain Model in Mice Overexpressing Human Wild-Type or Human Mutated Torsin A
Next Article in Special Issue
Chronological Incongruences between Mitochondrial and Nuclear Phylogenies of Aedes Mosquitoes
Previous Article in Journal
LDL-Cholesterol and Platelets: Insights into Their Interactions in Atherosclerosis
Previous Article in Special Issue
Unique Mitochondrial Single Nucleotide Polymorphisms Demonstrate Resolution Potential to Discriminate Theileria parva Vaccine and Buffalo-Derived Strains
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Inferring the Phylogenetic Positions of Two Fig Wasp Subfamilies of Epichrysomallinae and Sycophaginae Using Transcriptomes and Mitochondrial Data

Institute of Entomology, College of Life Sciences, Nankai University, Tianjin 300071, China
*
Authors to whom correspondence should be addressed.
Life 2021, 11(1), 40; https://doi.org/10.3390/life11010040
Submission received: 18 December 2020 / Revised: 8 January 2021 / Accepted: 9 January 2021 / Published: 11 January 2021
(This article belongs to the Special Issue Molecular Phylogenetics and Mitochondrial Evolution)

Abstract

Fig wasps are a group of insects (Hymenoptera: Chalcidoidea) that live in the compact syconia of fig trees (Moraceae: Ficus). Accurate classification and phylogenetic results are very important for studies of fig wasps, but the taxonomic statuses of some fig wasps, especially the non-pollinating subfamilies are difficult to determine, such as Epichrysomallinae and Sycophaginae. To resolve the taxonomic statuses of Epichrysomallinae and Sycophaginae, we obtained transcriptomes and mitochondrial genome (mitogenome) data for four species of fig wasps. These newly added data were combined with the data of 13 wasps (data on 11 fig wasp species were from our laboratory and two wasp species were download from NCBI). Based on the transcriptome and genome data, we obtained 145 single-copy orthologous (SCO) genes in 17 wasp species, and based on mitogenome data, we obtained 13 mitochondrial protein-coding genes (PCGs) for each of the 17 wasp species. Ultimately, we used 145 SCO genes, 13 mitochondrial PCGs and combined SCO genes and mitochondrial genes data to reconstruct the phylogenies of fig wasps using both maximum likelihood (ML) and Bayesian inference (BI) analyses. Our results suggest that both Epichrysomallinae and Sycophaginae are more closely related to Agaonidae with a high statistical support.

Graphical Abstract

1. Introduction

Fig wasps (Hymenoptera: Chalcidoidea) refer to all wasps that must rely on the syconia of fig trees (Moraceae: Ficus) to complete their life histories. According to whether they pollinate the figs, fig wasps are broadly classified into two categories of pollinating fig wasps and non-pollinating fig wasps [1]. Among them, the symbiosis of figs–pollinating fig wasps is a classical model of the mutualistic system, which originated about 75 million years ago [2]. The plant–insect interaction system between figs and fig wasps provides an ideal model for the study of the co-evolution of species and symbiotic relationship among organisms [3], and these studies are inseparable from the correct identification and phylogenetic history reconstruction of fig wasps.
The current taxonomic information listed on the fig web (http://www.figweb.org/Fig_wasps/Classification/index.htm) is mainly based on the taxonomy system proposed by Heraty [4], in which the fig wasps are classified into five families (Agaonidae, Eurytomidae, Ormyridae, Pteromalidae, Torymidae) and ten subfamilies (Agaoninae, Kradibiinae, Sycophaginae, Tetrapusiinae, Colotrechinae, Pteromalinae, Epichrysomallinae, Otitesellinae, Sycoecinae, and Sycoryctinae) [4]. The taxonomic statuses of some subfamilies are difficult to determine, such as the non-pollinating wasps of Epichrysomallinae and Sycophaginae [5,6,7,8].
The taxonomic history of Epichrysomallinae and Sycophaginae has undergone multiple changes since the beginning of the taxonomy of fig wasps in the 19th century. Sycophaginae was founded by Walker in 1875 [9], then it was included in the family of Torymidae based on cleptoparasitic habits by Joseph in 1964 [10]. Epichrysomallinae was established and classified in Torymidae by Hill in 1967, who also agreed to classify Sycophaginae in Torymidae [5]. In 1981, Bouček revised and adjusted Epichrysomallinae into Pteromalidae on the basis of morphological characteristics [6]. In 1988, Bouček further considered the whole Agaonidae as a monophyletic group based on the reproductive characteristics, of which the Agaoninae was only the most specific group with the behaviors of pollination, and thus both Epichrysomallinae and Sycophaginae were classified in Agaonidae [7]. In 1998, Rasplus et al. used the D1 and D2 domains of nuclear 28S rRNA to infer the phylogenetic relationships of six subfamilies proposed by Bouček, and they indicated that Agaonidae that Bouček (1988) referred to was not a monophyletic group [8]; they further revised Agaonidae and pointed out that Agaonidae only contained the subfamily of Agaoninae, and the taxonomic statuses of Epichrysomallinae and Sycophaginae in Chalcidoidea were undetermined. In 2013, Heraty et al. used 233 morphological and two molecular datasets (nuclear ribosomal 18S and 28S D2-D5 expansion regions) to make phylogenetic inference of a variety of wasps in Chalcidoidea and the results showed that the two subfamilies of Epichrysomallinae and Sycophaginae previously undetermined were included in Pteromalidae and Agaonidae, respectively [4]. In 2018, Peters et al. constructed a phylogenetic tree using 3239 homologous genes based on transcriptomic data from 62 species of Chalcidoidea, which showed that Epichrysomallinae was more closely related to Agaonidae than Pteromalidae, but Sycophaginae was not involved in their studies [11]. Therefore, due to different sources of taxonomic evidences (morphology, biological characteristics or molecular evidences), the taxonomy and phylogenetic positions of the two subfamilies of Epichrysomallinae and Sycophaginae, especially the latter, are still unclear, and more data are needed to clarify whether they belong to Agaonidae or Pteromalidae.
The second-generation high-throughput sequencing technology represented by transcriptome RNA sequencing (RNA-seq) can obtain a large-scale sequencing of the transcripts of specific tissues of a certain species. By using bioinformatics tools for splicing assembly, we can quickly obtain almost all the gene coding sequences (CDS) of the specific tissue of the species at a time point. With the advantages of low cost, large data volume, high efficiency and high accuracy, RNA-seq has shown great potential in the field of molecular phylogenetic research and become an effective means for molecular biology research of non-model animals [12,13,14]. The mitochondrial genome (mitogenome) sequences are also widely used in molecular evolution, phylogeny, phylogeography and population genetics because of their advantages, such as small genome size, maternal inheritance, no intron, relatively high evolutionary rate, simple structure, conserved gene content, and rare recombination [15,16,17].
In this study, we obtained conserved single-copy orthologous (SCO) genes in the nucleus based on transcriptomes (Odontofroggatia galili, Walkerella microcarpae, Micranisa ralianga, Platyneura mayri and Encarisa Formosa) and genomes (another 12 wasp species) from 17 wasp species and mitogenome sequences based on second-generation genome sequencing. Phylogenies of fig wasps were reconstructed based on three different molecular datasets, conserved SCO genes in the nucleus, 13 mitochondrial protein-coding genes (PCGs) and combined genes (SCO genes combined with 13 mitochondrial PCGs) to obtain new evidences to explore the taxonomic status of Epichrysomallinae and Sycophaginae.

2. Materials and Methods

2.1. Taxon Sampling and Data Collection

A total of 17 wasp species were included in this study (Table 1), including 15 fig wasp species (representing three families and six subfamilies). Four fig wasp species (O. galili, W. microcarpae, M. ralianga and P. mayri) were newly sequenced in this study. Data on 11 fig wasp species were from our laboratory and 2 wasp species were download from NCBI. Among the four species, O. galili, W. microcarpae, and M. ralianga were collected from Qinzhou, Guangxi, China (N21°57′, E108°37′), and P. mayri was collected from Xishuangbanna, Yunnan, China (N21°41′, E101°25′). The information on the host fig trees was as follows: O. galili and W. microcarpae were associated to Ficus microcarpa, P. mayri was associated to Ficus racemosa, and M. ralianga was associated to Ficus altissima. We collected the figs in their natural state of maturity (but fig wasps have not left the fig yet) in the wild. All the fig wasps were collected after they came out from the figs, and then identified by using the SMZ-168 microscope (Motic, China). The identification of fig wasps was based mainly on descriptions and pictures in the literatures [7,18], and also combined with photographs of fig wasps left by Rasplus in Yunnan province. The alive fig wasps were immediately stored in RNA Hold (TransGen, Beijing, China) at −80 °C (for RNA extraction) or in 95% ethanol at −20 °C (for DNA extraction).

2.2. RNA Extraction, Transcriptome Sequencing and Assembly

For the RNA extraction of the four fig wasps, we set up two sequencing samples (one female and one male, with 20 to 30 wasps included in each sample) for each wasp species. We picked well-preserved fig wasps in RNA hold and washed them with RNase-free water. We used TransZolUp Plus RNA Kit (TransGen, Beijing, China) to extract RNA for each sample according to the manufacturer’s instructions and finally dissolved the RNA into 40 uL RNase-free water. The concentration and purity of RNA were examined according to the OD values by Thermo Scientific NanoDrop One (ThermoFisher, Waltham, MA, USA). The sequencing libraries were constructed with NEBNext® Ultra™ RNA Library Prep Kit (NEB, Ipswich, MA, USA) and sequenced by second-generation Illumina HiSeq TM2000 platform (Novogen, Tianjin, China).
We obtained at least 6 Gb of raw data for each sample (at least 12 Gb of total data per species). The raw reads were quality controlled by Fastp software [19] and yielded clean reads. For each species, all clean reads were used for de novo assembly by using Trinity v2.5.1 [20], with a spliced result file called “Trinity. fasta” generated. Based on the Trinity splicing, Corset program [21] (with default parameters) was employed to cluster the transcripts to obtain the “cluster _all. fasta” file. We selected the longest transcript of each gene in the file of “cluster _all. fasta” as the unique sequence of that gene (also called Unigene).

2.3. Prediction of CDS and Identification of SCO Genes

For wasps with non-reference transcriptomes (O. galili, W. microcarpae, M. ralianga, P. mayri, and Encarisa Formosa), TransDecoder v5.5.0 was used to identify the open reading frames (ORFs) of the unigene to obtain the CDS sequences [22]. They were subsequently translated into amino acid sequences (https://web.expasy.org/cgi-bin/translate/dna2aa.cgi), while the CDS and protein sequences of the other species used for analysis were from NCBI or our laboratory.
OrthoMCL v2.0 [23] (with default parameters) was used to construct a local protein database of protein sequences of all species and to perform all-vs-all BLASTP matching to obtain similarity results between protein sequences. The best matched pairs between species (Orthologous pairs) were found via the OrthoMCL Pairs module in OrthoMCL. Finally, all the orthologous homologous proteins were classified and numbered by using Markov Cluster algorithm (MCL) [23]. Eventually, we removed multi-copy homologous proteins and selected families of orthologous proteins with one-to-one relationships (SCO proteins) for subsequent phylogenetic analysis.

2.4. DNA Extraction, Library Construction and Sequencing; Mitogenome Assembly and Annotation of 13 PCGs

We picked well-preserved wasps in 95% ethanol and washed them with sterile double distilled water. For each species, we used 30–40 female wasps to extract DNA by using the LiCl/KAc method and dissolved the DNA into 25 uL sterile double distilled water. The concentration and purity of DNA were examined according to the OD values by Thermo Scientific Nano Drop One (ThermoFisher, USA) and DNA integrity was monitored by 1% agarose electrophoresis. Sequencing libraries with an average of insert size of 350 bp were constructed with NEBNext® Ultra™ DNA Library Prep Kit (NEB, USA) and sequenced by second-generation Illumina HiSeq TM2000 platform (Novogen, Tianjin, China). The amount of sequencing data per species was set up at least 4 Gb. Fastp software [19] was used to quality-filtered to obtain the high-quality clean reads.
Mira v4.0.2 [24] and MITObim v1.9.1 [25] were used to assemble the mitogenomes of the four fig wasps, each with a reference mitogenome. The reference species used for P. mayri was Sycophaga agreansis; the reference species used for O. galili was Sycobia sp. 2; the reference species used for W. microcarpae and M. ralianga was Apocrypta bakeri. We used Mira v4.0.2 [24] to map clean reads to the reference genome, and MITObim v1.9.1 [25] to assemble the clean reads according to the overlapping regions between the sequences. Then the Mitos web server (http://mitos.bioinf.uni-leipzig.de/index.py) and NCBI ORFfinder (https://www.ncbi.nlm.nih.gov/orffinder/) were used to view and annotate the assembly results. Geneious v2020 [26] was used to assist the poorly assembled fragments of MITObim. For the poorly assembled genomes of P. mayri and M. ralianga, specific primers were designed to fill the gap regions of the CDS by PCR amplification (Table 2).

2.5. Multiple Sequences Alignment, Model Selection and Construction of Phylogeny

For each species, the SCO gene sequences, 13 mitochondrial PCGs sequences, or the combination of these sequences (SCO + mitochondrial PCGs sequences) were respectively concatenated in a specific order into a supergene sequence. The supergene sequences were translated into amino acid sequences using translation software (https://web.expasy.org/cgi-bin/translate/dna2aa.cgi). MAFFT v7.313 [27] was used for multiple sequence alignment. Gblocks v0.91b [28] was used to identify conserved regions and remove unreliably aligned sequences within the datasets. The processed sequences were then used to select the best amino acid substitution model according to the Akaike information criterion with ProtTest v3.4.2 [29]. Setting Encarisa formosa as an outgroup, we then performed a phylogeny reconstruction using both Maximum Likelihood (ML) and Bayesian Inference (BI) methods. ML analyses were performed with raxmlGUI v1.5b2 [30], with statistical support for each node estimated using bootstrap, and the rapid bootstrap replicates set to 1000. BI analyses were performed with MrBayes v3.2.6 [31] under the following conditions: 100,000,000 generations, sampled every 1000 generations, a burn-in step for the first 5000 generations. Convergence was deduced for BI phylogenetic tree based on the following metrics: on the one hand, the median standard deviation of split frequencies value was less than 0.01; on the other hand, Tracer v1.7.1 [32] was used to ensure that the effective sample sizes (ESS) value was more than 200. The resulting phylogenetic trees were visualized in FigTree v1.4.4.

3. Results

3.1. Transcriptomes and Mitogenomes of the Four Newly Sequenced Fig Wasp Species Obtained from High-Throughput Sequencing

In the transcriptome sequencing of P. mayri, O. galili, W. microcarpae and M. ralianga, we obtained 103,205,280, 110,176,152, 88,651,962, and 93,048,384 clean reads, respectively. The sequence length distribution of the transcripts and unigenes were showed in Table 3. By using second-generation genome sequencing, for the four species of P. mayri, O. galili, W. microcarpae and M. ralianga, we obtained 14,546,375, 25,413,085, 19,783,035, and 19,625,937 clean reads, respectively. Based on these data, we assembled and annotated the mitogenome of the four fig wasps (see Supplementary Tables S1–S4 for detailed annotation).

3.2. Identification of SCO Genes and Phylogenetic Analysis

The most important challenges of phylogenomic studies involve different methods for phylogenetic tree reconstruction that can influence the validity of phylogenetic trees [33]. In this study, we identified a total of 145 SCO genes in 17 wasp species. Then we used different molecular datasets including 145 SCO genes, 13 mitochondrial PCGs and combination of these sequences (SCO + mitochondrial PCGs sequences) to reconstruct the phylogenies of fig wasps based on two phylogenetic tree reconstruction methods of ML and BI. In the selection of the model, for the data of the SCO genes and the combined genes, the best-fit model for the amino acid sequences was the JTT + I + G + F model, and the closest substitution model (LG + I + G + F) was selected because the best-fit model was not available in MrBayes v3.2.6. For the 13 mitochondrial PCGs, the MtArt + I + G + F model was the best-fit model for the amino acid sequences, and the closest substitution model (MtREV + I + G + F) was selected because the best-fit model was not available in MrBayes v3.2.6.
The ML and BI phylogenetic trees constructed with 145 SCO genes were shown in Figure 1; the ML and BI phylogenetic trees constructed with combined genes (the nuclear genes combined with the mitochondrial genes) were shown in Figure 2; the BI tree constructed with 13 mitochondrial PCGs was shown in Figure 3; the ML tree constructed with 13 mitochondrial PCGs was shown in Figure 4. Further analyzing the topology of phylogenetic trees, we are convinced that with the addition of the four newly sequenced species data in this study, the genus affiliations of fig wasps were very clear in all phylogenetic trees we have constructed. O. galili and Sycobia sp.2 were clustered in one clade of the phylogenetic trees with high node support values (Bayesian posterior probability = 1, Bootstrap value = 100), and these two species belonged to Epichrysomallinae. Similarly, P. mayri and S. agreansis were clustered in one clade with high nodal support values (Bayesian posterior probability = 1, Bootstrap value = 100), and they belonged to Sycophaginae; W. microcarpae and M. ralianga belonged to Otitesellinae were clustered in one clade with high nodal support values (Bayesian posterior probability = 1, Bootstrap values = 100 and 94).
When considering the relationships between the subfamilies, our results showed that the ML and BI trees constructed with 145 SCO genes (Figure 1), the ML and BI trees constructed with the combined genes (Figure 2), and the BI tree constructed with 13 mitochondrial PCGs (Figure 3) all displayed the same topology: Epichrysomallinae and Agaonidae formed a clade, which subsequently clustered with Sycophaginae with high statistical support. However, the topology of the ML tree constructed with 13 mitochondrial PCGs (Figure 4) was somewhat divergent, Epichrysomallinae and Sycophaginae clustered together (Bootstrap value = 53), and then this clade was clustered with Agaonidae (Bootstrap value = 70), which was not necessarily reliable given its low statistical support.

4. Discussion

Transcriptome sequencing technology can economically and rapidly obtain all RNA information of organisms at a time point and plays an important role in finding molecular datasets for biological research [34]. Mitogenome sequences are also ideal molecular datasets for solving biological phylogeny due to their characteristics of genes without introns, and high evolutionary rate [35]. In this study of fig wasps, focusing on the undetermined taxonomic statuses of Epichrysomallinae and Sycophaginae, we used the SCO genes and mitochondrial PCGs of 17 species based on transcriptome, genome, and mitogenome data to construct phylogenetic trees using ML and BI methods. The final results suggested that both Epichrysomallinae and Sycophaginae were more closely related to Agaonidae, which updated information on the previously unclear phylogenetic statuses of both subfamilies. Compared with previous studies, this is the first time to use transcriptomes, genomes and mitogenome datasets to study the phylogenetic relationship reconstruction of the fig wasps.
Before the emergence of molecular data, the study of taxonomic statuses and phylogenetic relationships primarily relied on morphological characteristics. However, the evolutionary change of morphological characteristics is extremely complicated (even for a short evolutionary time) and phylogenetic trees derived from morphological data are often controversial [36]. Molecular phylogeny is the study of the interrelationships among various groups of organisms in their genealogical and evolutionary processes, by evolutionary study of the structure and function of biological macromolecules (proteins and nucleic acids) [37]. Since the evolutionary changes of DNA and amino acids follow a traceable pattern, it is possible to use a model to compare DNA or protein sequences among different organisms, so molecular phylogeny is expected to clarify problems that has been difficult to be resolved by the classical morphological approaches [38].
However, the incongruences of molecular data have also been frequently observed in phylogenetic trees, possibly due to lack of sufficient phylogenetic information from a single or a few genes [39]. Taking the phylogeny of the two subfamilies (Epichrysomallinae and Sycophaginae) of fig wasps studied in this study as an example, previous results for phylogenetic trees constructed with morphological data indicated that the taxonomic statuses of these two subfamilies had been changing, with Epichrysomallinae firstly being classified to Torymidae, then to Pteromalidae, and finally to Agaonidae by Bouček in 1988 [5,6,7], while Sycophaginae firstly being classified to Torymidae and finally to Agaonidae by Bouček in 1988 [7,8,9,10]. With the use of molecular data, the taxonomic statuses of these two subfamilies became clearer gradually. Initially, the phylogenetic tree constructed with D1 and D2 domains of nuclear 28S rRNA by Rasplus was not able to clarify the taxonomic statuses of these two subfamilies [8]. Subsequently, Heraty et al.’s results based on nucleotide sequences of nuclear ribosomal 18S and 28S D2-D5 expansion regions and 233 morphological data supported that Epichrysomallinae was closely related to Pteromalidae and Sycophaginae was closely related to Agaonidae [4]. Recently, Peters and his colleagues used transcriptomic data to show that Epichrysomallinae are closely related to Agaonidae, but the study did not include data for Sycophaginae [11]. In our study, we construct phylogenetic trees based on 145 SCO genes and 13 mitochondrial PCGs. Compared to the studies of Peters et al. [11], our results not only support their conclusions about Epichrysomallinae that it is closely related to Agaonidae, but our newly added species data about Sycophaginae further confirm that Sycophaginae is closely related to Agaonidae. Our results of Sycophaginae closely related to Agaonidae is consistent with the phylogenetic tree constructed by Heraty [4], even though our conclusions about the status of Epichrysomallinae is inconsistent. Therefore, according to the results of the above analyses, our study supports that both Epichrysomallinae and Sycophaginae are more closely related to Agaonidae. Our results suggest that the phylogenetic relationships of fig wasps cannot be well resolved by mitochondrial data alone, and the combination of nuclear genes, mitogenomes and morphological data will promote the reliability of fig wasp phylogeny. In the future, the addition of more species data will enable us to better understand the phylogenetic relationships of fig wasps.

5. Conclusions

In the taxonomic and phylogenetic studies of fig wasps, the taxonomic statuses of the two non-pollinating fig wasp subfamilies of Epichrysomallinae and Sycophaginae are still unclear. We here construct phylogenetic trees with nuclear conserved SCO genes and 13 mitochondrial PCGs genes from 17 wasp species by using the ML and BI methods. Our results show that both Epichrysomallinae and Sycophaginae are closely related to Agaonidae.

Supplementary Materials

The following are available online at https://www.mdpi.com/2075-1729/11/1/40/s1, Table S1: Summary of the mitogenome of Platyneura mayri. Table S2: Summary of the mitogenome of Odontofroggatia galili. Table S3: Summary of the mitogenome of Walkerella microcarpae. Table S4: Summary of the mitogenome of Micranisa ralianga.

Author Contributions

Conceptualization, J.X. and D.H.; methodology, D.Z., Z.X., H.H., and J.W.; validation, D.Z., Z.X., and Y.Z.; formal analysis, D.Z.; investigation, D.Z.; resources, D.Z. and H.H.; data curation, D.Z., Z.X., and Y.Z.; writing—original draft preparation, D.Z.; writing—review and editing, Z.X., H.H., Y.Z., J.X., and D.H.; visualization, D.Z.; supervision, J.X. and D.H.; project administration, J.X. and D.H.; funding acquisition, J.X. and D.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (Nos. of 31830084, 31970440 & 32070466), and also supported by the construction funds for the “Double First-Class” initiative for Nankai University (Nos. 96172158, 96173250 & 91822294).

Acknowledgments

We thank Wenquan Zhen for help in collecting fig wasps.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Weiblen, G.D. How to be a fig wasp. Annu. Rev. Entomol. 2002, 47, 299–330. [Google Scholar] [CrossRef] [PubMed]
  2. Machado, C.A.; Jousselin, E.; Kjellberg, F.; Compton, S.G.; Herre, E.A. Phylogenetic relationships, historical biogeography and character evolution of fig-pollinating wasps. Proc. Biol. Sci. 2001, 268, 685–694. [Google Scholar] [CrossRef] [PubMed]
  3. Machado, C.A.; Robbins, N.; Gilbert, M.T.P.; Herre, E.A. Critical review of host specificity and its coevolutionary implications in the fig/fig-wasp mutualism. Proc. Natl. Acad. Sci. USA 2005, 102 (Suppl. S1), 6558–6565. [Google Scholar] [CrossRef]
  4. Heraty, J.M.; Burks, R.A.; Cruaud, A.; Gibson, G.A.P.; Liljeblad, J.; Munro, J.; Rasplus, J.-Y.; Delvare, G.; Janšta, P.; Gumovsky, A.; et al. A phylogenetic analysis of the megadiverse chalcidoida. Cladistics 2013, 29, 466–542. [Google Scholar] [CrossRef]
  5. Hill, D.S. Figs (Ficus spp.) and fig-wasps (Chalcidoidea). J. Nat. Hist. 1967, 1, 413–434. [Google Scholar] [CrossRef]
  6. Bouček, Z.; Watsham, A.; Wiebes, J.T. The fig wasp fauna of the receptacles of Ficus thonningii (Hymenoptera, Chalcidoidea). Tijdschr. Entomol. 1981, 124, 149–233. [Google Scholar]
  7. Bouček, Z. Australasian Chalcidoidea (Hymenoptera): A Biosystematic Revision of Genera of Fourteen Families, with a Reclassification of Species; CAB International: Wallingford, UK, 1988. [Google Scholar]
  8. Rasplus, J.-Y.; Kerdelhue, C.; Le Clainche, I.; Mondor, G. Molecular phylogeny of fig wasps. Agaonidae are not monophyletic. C. R. Acad. Sci. III 1998, 321, 517–526. [Google Scholar] [CrossRef]
  9. Walker, F. Descriptions of new gengera and species of parasites, belonging to the families Proctotrupidae and Chalcididae, which attack insects destructive to the fig in India. Entomologist 1875, 8, 15–18. [Google Scholar]
  10. Joseph, K.J. A proposed revision of the classification of the fig insects of the families Agaonidae and Torymidae (Hymenoptera). Proc. R. Entomol. Soc. Lon. B 1964, 33, 63–66. [Google Scholar]
  11. Peters, R.S.; Niehuis, O.; Gunkel, S.; Blaser, M.; Mayer, C.; Podsiadlowski, L.; Kozlov, A.; Donath, A.; van Noort, S.; Liu, S.; et al. Transcriptome sequence-based phylogeny of chalcidoid wasps (Hymenoptera: Chalcidoidea) reveals a history of rapid radiations, convergence, and evolutionary success. Mol. Phylogenet. Evol. 2018, 120, 286–296. [Google Scholar] [CrossRef]
  12. Delsuc, F.; Brinkmann, H.; Philippe, H. Phylogenomics and the reconstruction of the tree of life. Nat. Rev. Genet. 2005, 6, 361–375. [Google Scholar] [CrossRef] [PubMed]
  13. Jeffroy, O.; Brinkmann, H.; Delsuc, F.; Philippe, H. Phylogenomics: The beginning of incongruence? Trends Genet. 2006, 22, 225–231. [Google Scholar] [CrossRef] [PubMed]
  14. Zhao, Y.J.; Cao, Y.; Wang, J.; Xiong, Z. Transcriptome sequencing of Pinus kesiya var. langbianensis and comparative analysis in the Pinus phylogeny. BMC Genom. 2018, 19, 725. [Google Scholar] [CrossRef] [PubMed]
  15. Cameron, S.L. Insect mitochondrial genomics: Implications for evolution and phylogeny. Annu. Rev. Entomol. 2014, 59, 95–117. [Google Scholar] [CrossRef]
  16. Simon, C.; Buckley, T.R.; Frati, F.; Stewart, J.B.; Beckenbach, A.T. Incorporating molecular evolution into phylogenetic analysis, and a new compilation of conserved polymerase chain reaction primers for animal mitochondrial DNA. Annu. Rev. Ecol. Evol. Syst. 2006, 37, 545–579. [Google Scholar] [CrossRef]
  17. Wang, R.Q.; Wang, D.Z.; Li, C.T.; Yang, X.R. Mitochondrial genome of the shorthead catfish (Pelteobagrus eupogon): Structure, phylogeny, and intraspecific variation. Genet. Mol. Res. 2016, 15. [Google Scholar] [CrossRef]
  18. Bouček, Z. The genera of chalcidoid wasps from Ficus fruit in the New World. J. Nat. Hist. 1993, 27, 173–217. [Google Scholar] [CrossRef]
  19. Yan, L.; Yang, M.; Guo, H.; Yang, L.; Wu, J.; Li, R.; Liu, P.; Lian, Y.; Zheng, X.; Yan, J.; et al. Single-cell RNA-Seq profiling of human preimplantation embryos and embryonic stem cells. Nat. Struct. Mol. Biol. 2013, 20, 1131–1139. [Google Scholar] [CrossRef]
  20. Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef]
  21. Davidson, N.M.; Oshlack, A. Corset: Enabling differential gene expression analysis for de novo assembled transcriptomes. Genome Biol. 2014, 15, 410. [Google Scholar] [CrossRef]
  22. Haas, B.J.; Papanicolaou, A.; Yassour, M.; Grabherr, M.; Blood, P.D.; Bowden, J.; Couger, M.B.; Eccles, D.; Li, B.; Lieber, M.; et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat. Protoc. 2013, 8, 1494–1512. [Google Scholar] [CrossRef] [PubMed]
  23. Li, L.; Stoeckert, C.J., Jr.; Roos, D.S. OrthoMCL: Identification of ortholog groups for eukaryotic genomes. Genome Res. 2003, 13, 2178–2189. [Google Scholar] [CrossRef] [PubMed]
  24. Chevreux, B.; Wetter, T.; Suhai, S. Genome sequence assembly using Trace signals and additional sequence Information. J. Comput. Sci. Syst. Biol. 1999, 99, 45–56. [Google Scholar]
  25. Hahn, C.; Bachmann, L.; Chevreux, B. Reconstructing mitochondrial genomes directly from genomic next-generation sequencing reads-a baiting and iterative mapping approach. Nucleic Acids Res. 2013, 41, e129. [Google Scholar] [CrossRef] [PubMed]
  26. Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef]
  27. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
  28. Talavera, G.; Castresana, J. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol. 2007, 56, 564–577. [Google Scholar] [CrossRef]
  29. Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. ProtTest 3: Fast selection of best-fit models of protein evolution. Bioinformatics 2011, 27, 1164–1165. [Google Scholar] [CrossRef]
  30. Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
  31. Altekar, G.; Dwarkadas, S.; Huelsenbeck, J.P.; Ronquist, F. Parallel Metropolis coupled Markov chain Monte Carlo for Bayesian phylogenetic inference. Bioinformatics 2004, 20, 407–415. [Google Scholar] [CrossRef]
  32. Rambaut, A.; Drummond, A.J. Tracer v1.4. Encyclopedia Atmos. Sci. 2007, 141, 2297–2305. [Google Scholar] [CrossRef]
  33. Philippe, H.; Delsuc, F.; Brinkmann, H.; Lartillot, N. Phylogenomics. Annu. Rev. Ecol. Evol. S. 2005, 36, 541–562. [Google Scholar] [CrossRef]
  34. Dong, S.; Xiao, Y.; Kong, H.; Feng, C.; Harris, A.J.; Yan, Y.; Kang, M. Nuclear loci developed from multiple transcriptomes yield high resolution in phylogeny of scaly tree ferns (Cyatheaceae) from China and Vietnam. Mol. Phylogenet. Evol. 2019, 139, 106567. [Google Scholar] [CrossRef]
  35. Wang, G.; Lin, J.; Shi, Y.; Chang, X.; Wang, Y.; Guo, L.; Wang, W.; Dou, M.; Deng, Y.; Ming, R.; et al. Mitochondrial genome in Hypsizygus marmoreus and its evolution in Dikarya. BMC Genom. 2019, 20, 765. [Google Scholar] [CrossRef]
  36. Nei, M.; Kumar, S. Molecular Evolution and Phylogenetics; Oxford University Press: New York, NY, USA, 2000. [Google Scholar]
  37. Maddison, W.P. Molecular approaches and the growth of phylogenetic biology. In Molecular Zoology: Advances, Strategies, and Protocols; Ferraris, J.D., Palumbi, S.R., Eds.; Wiley-Liss: New York, NY, USA, 1996; pp. 47–63. [Google Scholar]
  38. Lin, G.-H.; Wang, K.; Deng, X.-G.; Nevo, E.; Zhao, F.; Su, J.-P.; Guo, S.-C.; Zhang, T.-Z.; Zhao, H. Transcriptome sequencing and phylogenomic resolution within Spalacidae (Rodentia). BMC Genom. 2014, 15, 32. [Google Scholar] [CrossRef] [PubMed]
  39. Wang, K.; Hong, W.; Jiao, H.; Zhao, H. Transcriptome sequencing and phylogenetic analysis of four species of luminescent beetles. Sci. Rep. 2017, 7, 1814. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Inferred phylogenetic relationships of 17 chalcidoids based on amino acid (AA) datasets of 145 nuclear SCO genes using ML and BI analyses. Encarisa Formosa was used as the outgroup. Bayesian posterior probabilities (BPP) and ML bootstrap values (BP) for each node are shown as: BPP based on AA dataset/BP based on AA dataset, with maxima of 1.00/100.
Figure 1. Inferred phylogenetic relationships of 17 chalcidoids based on amino acid (AA) datasets of 145 nuclear SCO genes using ML and BI analyses. Encarisa Formosa was used as the outgroup. Bayesian posterior probabilities (BPP) and ML bootstrap values (BP) for each node are shown as: BPP based on AA dataset/BP based on AA dataset, with maxima of 1.00/100.
Life 11 00040 g001
Figure 2. Inferred phylogenetic relationships of 17 chalcidoids based on amino acid (AA) datasets of combined genes (the 145 nuclear SCO genes combined with the 13 mitochondrial PCGs) using ML and BI analyses. Encarisa Formosa was used as the outgroup. Bayesian posterior probabilities (BPP) and ML bootstrap values (BP) for each node are shown as: BPP based on AA dataset/BP based on AA dataset, with maxima of 1.00/100.
Figure 2. Inferred phylogenetic relationships of 17 chalcidoids based on amino acid (AA) datasets of combined genes (the 145 nuclear SCO genes combined with the 13 mitochondrial PCGs) using ML and BI analyses. Encarisa Formosa was used as the outgroup. Bayesian posterior probabilities (BPP) and ML bootstrap values (BP) for each node are shown as: BPP based on AA dataset/BP based on AA dataset, with maxima of 1.00/100.
Life 11 00040 g002
Figure 3. Inferred phylogenetic relationships of 17 chalcidoids based on amino acid (AA) datasets of 13 mitochondrial PCGs using BI analyses. Encarisa Formosa was used as the outgroup. Bayesian posterior probabilities (BPP) of each node are shown as BPP based on AA dataset 1.00.
Figure 3. Inferred phylogenetic relationships of 17 chalcidoids based on amino acid (AA) datasets of 13 mitochondrial PCGs using BI analyses. Encarisa Formosa was used as the outgroup. Bayesian posterior probabilities (BPP) of each node are shown as BPP based on AA dataset 1.00.
Life 11 00040 g003
Figure 4. Inferred phylogenetic relationships of 17 chalcidoids based on amino acid (AA) datasets of 13 mitochondrial PCGs using ML analyses. Encarisa Formosa was used as the outgroup. Bootstrap values (BP) of each node are shown as BP based on AA dataset 100.
Figure 4. Inferred phylogenetic relationships of 17 chalcidoids based on amino acid (AA) datasets of 13 mitochondrial PCGs using ML analyses. Encarisa Formosa was used as the outgroup. Bootstrap values (BP) of each node are shown as BP based on AA dataset 100.
Life 11 00040 g004
Table 1. List of the 17 species analyzed in this study.
Table 1. List of the 17 species analyzed in this study.
SpeciesSubfamilyFamilyAccession No.
(Mitochondrial Genome)
Accession No.
(Genomes or Transcriptomes)
Platyneura mayri *Sycophaginae * MW167114PRJNA672045
Odontofroggatia galili *Epichrysomallinae * MW167113PRJNA671819
Walkerella microcarpae *Otitesellinae *PteromalidaeMW167116PRJNA672219
Micranisa ralianga *Otitesellinae *PteromalidaeMW167115PRJNA672141
Euprisitina koningsbergeri #Agaoninae #AgaonidaeMT947597PRJNA641212
Platyscapa corneri #Agaoninae #AgaonidaeMT947604PRJNA641212
Dolichoris vasculosae #Agaoninae #AgaonidaeMT947596PRJNA641212
Wiebesia pumilae #Agaoninae #AgaonidaeMT947601PRJNA641212
Kradibia gibbosae #Kradibiinae #AgaonidaeMT947598PRJNA641212
Ceratosolen fusciceps #Kradibiinae #AgaonidaeMT916179PRJNA494992
Sycophaga agreansis *Sycophaginae * MT947599PRJNA641212
Sycophila sp.2 *-EurytomidaeMT947603PRJNA641212
Sycobia sp.2 *Epichrysomallinae * MT947600PRJNA641212
Apocrypta bakeri *Sycoryctinae *PteromalidaeMT906648PRJNA641212
Philotrypesis tridentata *Sycoryctinae *PteromalidaeMT947602PRJNA641212
Nasonia vitripennisPteromalinaePteromalidaeEU746609.1, EU746613.1PRJNA594415
Encarisa formosaCoccophaginaeAphelinidaeMG813797.1PRJNA252167
The species in bold represent the fig wasps sequenced in this study. * non-pollinating fig wasps. # pollinating fig wasps.
Table 2. Specific primers used for PCR amplification of partial mitochondrial regions in this study.
Table 2. Specific primers used for PCR amplification of partial mitochondrial regions in this study.
SpeciesPrimersSequence (5′–3’)Annealing TemperatureTargeted CDS Region
Platyneura mayriPF1ctatataaatttatgaaactatgattaatatctactaatcataaatatattgg54 °CThe middle part of the cox1
PR1gataatctaggaggtaataatcaaaatcttatattatttattcgtgg
Micranisa raliangaMF1caattaaagttaaacaaattaataagtaaataattgaaattaatattg50 °CThe middle part of the nad6
MR1caatttaataataatcattgattttcttatattatatttttaatcatagtag
Table 3. Length distribution of the transcripts and unigenes clustered from the de novo assembly.
Table 3. Length distribution of the transcripts and unigenes clustered from the de novo assembly.
Platyneura MayriOdontofroggatia GaliliWalkerella MicrocarpaeMicranisa Ralianga
Length Range TranscriptUnigeneTranscriptUnigeneTranscriptUnigeneTranscriptUnigene
200 bp–500 bp14,720495038,31513,10421,455624924,1877148
500 bp–1000 bp11,155601527,82214,86813,405839313,6598435
1000 bp–2000 bp9368379920,849821111,040471695174391
>2000 bp16,581570519,191650122,073654119,9226411
Total Number51,82420,469106,17742,68467,97325,89967,28526,385
Total Length99,849,09635,330,681130,935,63849,857,034133,605,39042,636,711127,749,95842,751,535
Mean Length19271726123311681966164618991620
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhao, D.; Xin, Z.; Hou, H.; Zhou, Y.; Wang, J.; Xiao, J.; Huang, D. Inferring the Phylogenetic Positions of Two Fig Wasp Subfamilies of Epichrysomallinae and Sycophaginae Using Transcriptomes and Mitochondrial Data. Life 2021, 11, 40. https://doi.org/10.3390/life11010040

AMA Style

Zhao D, Xin Z, Hou H, Zhou Y, Wang J, Xiao J, Huang D. Inferring the Phylogenetic Positions of Two Fig Wasp Subfamilies of Epichrysomallinae and Sycophaginae Using Transcriptomes and Mitochondrial Data. Life. 2021; 11(1):40. https://doi.org/10.3390/life11010040

Chicago/Turabian Style

Zhao, Dan, Zhaozhe Xin, Hongxia Hou, Yi Zhou, Jianxia Wang, Jinhua Xiao, and Dawei Huang. 2021. "Inferring the Phylogenetic Positions of Two Fig Wasp Subfamilies of Epichrysomallinae and Sycophaginae Using Transcriptomes and Mitochondrial Data" Life 11, no. 1: 40. https://doi.org/10.3390/life11010040

APA Style

Zhao, D., Xin, Z., Hou, H., Zhou, Y., Wang, J., Xiao, J., & Huang, D. (2021). Inferring the Phylogenetic Positions of Two Fig Wasp Subfamilies of Epichrysomallinae and Sycophaginae Using Transcriptomes and Mitochondrial Data. Life, 11(1), 40. https://doi.org/10.3390/life11010040

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop