Parental Selenium Nutrition Affects the One-Carbon Metabolism and the Hepatic DNA Methylation Pattern of Rainbow Trout (Oncorhynchus mykiss) in the Progeny
Abstract
1. Introduction
2. Results
2.1. Parental Selenium Affects Transsulfuration Metabolites in Swim-up Fry
2.2. Parental Selenium Nutrition Affects the Methionine Metabolism in Swim-up Fry
2.3. Parental Selenium Affects mRNA Levels of Genes Related to the One-Carbon Metabolism in Swim-up Fry
2.4. Parental Selenium Resulted in a Weak Group-Wise DNA Methylation Clustering
2.5. Data Alignment Gives a Balanced Hepatic Methylation Pattern between Groups
2.6. Parental Selenium Affects the DNA Methylation Pattern in Several Metabolic Pathways
2.7. Parental Selenium also Affects Methylation in Genes Related to the 1C Metabolism
3. Discussion
3.1. Parental Selenium Nutrition and the Transsulfuration Pathway in the Progeny
3.2. Parental Selenium Nutrition and the Methionine Cycle in the Progeny
3.3. Parental Selenium Nutrition Affects the DNA Methylation Pattern of Genes Related to Several Metabolic Pathways
4. Materials and Methods
4.1. Experimental Set up
4.2. Experimental Diets
4.3. Sampling
4.4. Metabolite Analysis
4.5. RNA Extraction and RT-qPCR
4.6. Statistical Analysis on Metabolic Analysis and Gene Expression Data
4.7. DNA Extraction, RRBS Library Preparation and Sequencing
4.8. Rainbow Trout Genome and Genomic Annotation
4.9. RRBS Data Processing
4.10. Functional Annotation and Statistical Analysis of DMGs
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
amd | Adenosylmethionine decarboxylase |
bhmt | Betaine-homocysteine S-methyltransferase |
cbs | Cystathionine beta-synthase |
cgl | Cystathionine gamma-lyase |
CpG | Cytosine phosphate guanine |
DMCs | Differentially methylated cytosines |
DMGs | Differentially methylated genes |
DNMT | DNA methyltransferase |
gnmt | Glycine N-methyltransferase |
mtr | Methionine synthase |
NC | Non-supplemented control treatment |
OH-SeMet | Hydroxy-selenomethionine |
RRBS | Representation bisulfite sequencing |
SAH | S-adenosylhomocysteine |
sahh | Adenosylhomocystenase |
SAM | S-adenosylmethionine |
SO | OH-SeMet treatment |
SS | Sodium selenite treatment |
Appendix A
No | Name | Diet | Total Reads | Uniquely Mapped | (%) | Multi-Mapped | (%) | Non-Mapped | (%) |
---|---|---|---|---|---|---|---|---|---|
1 | PSL1 | NC | 53 987 762 | 26 310 305 | 48.7 | 19 820 505 | 36.7 | 7 856 952 | 14.6 |
2 | PSL2 | NC | 39 364 790 | 19 543 117 | 49.6 | 14 534 198 | 36.9 | 5 287 475 | 13.4 |
3 | PSL3 | NC | 54 833 812 | 27 173 708 | 49.6 | 20 233 149 | 36.9 | 7 426 955 | 13.5 |
4 | PSL4 | NC | 63 481 758 | 30 305 331 | 47.7 | 24 622 757 | 38.8 | 8 553 670 | 13.5 |
5 | PSL5 | SS | 59 570 698 | 27 527 855 | 46.2 | 23 489 555 | 39.4 | 8 553 288 | 14.4 |
6 | PSL6 | SS | 45 143 094 | 21 814 078 | 48.3 | 17 312 386 | 38.4 | 6 016 630 | 13.3 |
7 | PSL7 | SS | 67 495 806 | 31 151 354 | 46.2 | 27 389 024 | 40.6 | 8 955 428 | 13.3 |
8 | PSL8 | SO | 54 472 443 | 25 214 607 | 46.3 | 22 345 586 | 41.0 | 6 912 250 | 12.7 |
9 | PSL9 | SO | 69 558 057 | 33 562 782 | 48.3 | 26 840 717 | 38.6 | 9 154 558 | 13.2 |
10 | PSL10 | SO | 79 827 373 | 38 293 256 | 48.0 | 31 322 516 | 39.2 | 10 211 601 | 12.8 |
11 | PSL11 | SO | 55 391 941 | 25 516 081 | 46.1 | 21 796 848 | 39.4 | 8 079 012 | 14.6 |
12 | PSL12 | SS | 51 950 394 | 23 789 256 | 45.8 | 20 152 309 | 38.8 | 8 008 829 | 15.4 |
Appendix B
Appendix C
Gene Symbol | Gene ID | Gene Name | Total DMC | DMC in the Region | Hyper-/Hypomethylated CpG | |
---|---|---|---|---|---|---|
Exon | LOC110496419 | 110496419 | Glycoprotein endo-alpha-1,2-mannosidase-like protein | 10 | 10 | 0/10 |
LOC110503414 | 110503414 | TCDD-inducible poly [ADP-ribose] polymerase-like | 10 | 8 | 8/0 | |
LOC110497587 | 110497587 | SAM and SH3 domain-containing protein 1-like, transcript variant X2 | 10 | 7 | 0/7 | |
LOC110520294 | 110520294 | Von Willebrand factor C domain-containing protein 2-like, transcript variant X1 | 7 | 7 | 5/2 | |
LOC110529233 | 110529233 | MAM domain—containing glycosylphosphatidylinositol anchor protein 2-like | 6 | 5 | 5/0 | |
Intron | CTNNA2 | 110534326 | Catenin alpha-2 | 18 | 18 | 11/7 |
alk | 110506268 | ALK receptor tyrosine kinase | 17 | 17 | 13/4 | |
lsamp | 110507545 | Limbic system-associated membrane protein, transcript variant X5 | 15 | 15 | 9/6 | |
NRXN2-like | 110531840 | Neurexin-2-like | 16 | 12 | 5/7 | |
CDH4-like | 110532012 | Cadherin-4-like | 13 | 12 | 5/7 | |
P250 | LOC110498119 | 110498119 | Radical S-adenosyl methionine domain-containing protein 2-like | 5 | 5 | 0/5 |
LOC110493563 | 110493563 | Septin-9-like | 4 | 2 | 0/2 | |
COX6A2 | 100335037 | Cytochrome c oxidase subunit VIa | 3 | 2 | 0/2 | |
TIMP2-like | 110487076 | Metalloproteinase inhibitor 2-like | 2 | 2 | 0/2 | |
LOC110490026 | 110490026 | Mitogen-activated protein kinase kinase kinase 8-like | 2 | 2 | 2/0 | |
P1K | LOC110534101 | 110534101 | Matrin-3-like | 4 | 4 | 4/0 |
LOC110489756 | 110489756 | Transmembrane protein 14C-like | 4 | 3 | 0/3 | |
LOC110486159 | 110486159 | Proline-rich protein 15-like protein A | 3 | 3 | 2/1 | |
TNFR11B-like | 110506163 | Tumor necrosis factor receptor superfamily member 11B-like | 3 | 3 | 0/3 | |
TPPP3X2-like | 110518569 | Tubulin polymerization-promoting protein family Member 3-like, transcript variant X2 | 3 | 3 | 0/3 | |
P6K | COX4I2-like | 110492636 | Cytochrome c oxidase subunit 4 isoform 2, mitochondrial-like | 8 | 8 | 8/0 |
LOC110523211 | 110523211 | Oocyte zinc finger protein XlCOF6-like, transcript Variant X2 | 8 | 8 | 0/8 | |
LOC110498688 | 110498688 | Fatty acid-binding protein, liver-type-like | 7 | 7 | 7/0 | |
LOC110505815 | 110505815 | Gamma-aminobutyric acid receptor subunit rho-2- like | 6 | 5 | 0/5 | |
LOC110503024 | 110503024 | Ras-related C3 botulinum toxin substrate 3-like | 5 | 4 | 0/4 |
Gene Symbol | Gene ID | Gene Name | Total DMC | DMC in the Region | Hyper-/Hypomethylated CpG | |
---|---|---|---|---|---|---|
Exon | LOC110490066 | 110490066 | E3 ubiquitin-protein ligase rififylin-like, transcript variant X2 | 6 | 6 | 5/1 |
LOC110520294 | 110520294 | von Willebrand factor C domain-containing protein 2-like, transcript variant X1 | 6 | 6 | 3/3 | |
LOC110531157 | 110531157 | Serine/threonine-protein kinase WNK2-like | 7 | 5 | 0/5 | |
LOC110497587 | 110497587 | SAM and SH3 domain-containing protein 1-like, transcript variant X2 | 6 | 5 | 1/4 | |
LOC110506316 | 110506316 | Muscarinic acetylcholine receptor M4-like, transcript variant X1 | 6 | 5 | 0/5 | |
Intron | lsamp | 110507545 | Limbic system-associated membrane protein, transcript variant X5 | 24 | 24 | 9/15 |
LOC110505581 | 110505581 | Placenta growth factor-like | 15 | 15 | 9/6 | |
LOC110501635 | 110501635 | Serine/threonine-protein kinase BRSK2-like | 14 | 14 | 10/4 | |
LOC110506270 | 110506270 | Protein kinase C-binding protein NELL1-like, transcript variant X1 | 13 | 13 | 5/8 | |
Catenin alpha-2 | 110534326 | Catenin alpha-2 | 13 | 13 | 6/7 | |
P250 | LOC110501919 | 110501919 | Alkyldihydroxyacetonephosphatesynthase,peroxisomal-like, transcript variant X2 | 5 | 3 | 2/1 |
LOC110494831 | 110494831 | Complement C1q-like protein 2 | 4 | 3 | 0/3 | |
LOC110508922 | 110508922 | MARVEL domain-containing protein 2-like, transcript variant X2 | 4 | 3 | 3/0 | |
CRIP2-like | 110505831 | Cysteine-rich protein 2-like | 3 | 3 | 3/0 | |
LOC110497531 | 110497531 | Uncharacterized LOC110497531, transcript variant X2 | 4 | 2 | 2/0 | |
P1K | LOC110493345 | 110493345 | Gastrula zinc finger protein XlCGF17.1-like, transcript variant X1 | 4 | 4 | 4/0 |
LOC110521247 | 110521247 | Lactadherin-like, transcript variant X1 | 4 | 4 | 4/0 | |
LOC110533598 | 110533598 | Ras-related protein Rab-24-like, transcript variant X1 | 4 | 4 | 0/4 | |
LOC110498119 | 110498119 | Radical S-adenosyl methionine domain-containing protein 2-like | 3 | 3 | 3/0 | |
NFATC3-like | 110506757 | Nuclear factor of activated T-cells, cytoplasmic 3-like | 3 | 2 | 0/2 | |
P6K | LOC110505815 | 110505815 | Gamma-aminobutyric acid receptor subunit rho-2-like | 8 | 5 | 4/1 |
LOC110519930 | 110519930 | Uncharacterized LOC110519930, transcript variant X2 | 6 | 5 | 0/5 | |
LOC110520086 | 110520086 | Collagen alpha-1(XXVIII) chain-like | 5 | 5 | 3/2 | |
taf6l | 110531860 | TATA-box binding protein associated Factor 6 like, transcript variant X1 | 5 | 5 | 5/0 | |
LOC110537362 | 110537362 | Glutamate receptor 3, transcript variant X3 | 5 | 5 | 5/0 |
Gene Symbol | Gene ID | Gene Name | Total DMC | DMC in the Region | Hyper-/Hypomethylated CpG | |
---|---|---|---|---|---|---|
Exon | CDH2-like | 110506386 | Neural-cadherin-like | 10 | 10 | 7/3 |
PLEKHG7-like | 110497700 | Pleckstrin homology domain-Containing family G member 7-like | 9 | 9 | 0/9 | |
NRXN2-like | 110531840 | Neurexin-2-like | 21 | 8 | 2/6 | |
LOC110496419 | 110496419 | Glycoprotein endo-alpha-1,2-mannosidase-like protein | 8 | 8 | 8/0 | |
LOC110496815 | 110496815 | Glutamate receptor ionotropic, kainate5-like | 8 | 7 | 7/0 | |
Intron | lsamp | 110507545 | Limbic system-associated membrane protein, transcript variant X5 | 22 | 22 | 9/13 |
LOC110500600 | 110500600 | Adhesion G protein-coupled receptor L3-like, transcript variant X5 | 23 | 20 | 17/3 | |
FBXL17X1 | 110525966 | F-box and leucine rich repeat protein 17, transcript variant X2 | 18 | 16 | 13/3 | |
LOC110535694 | 110535694 | Glutamate receptor ionotropic, delta-2, transcript variant X3 | 17 | 15 | 5/10 | |
ZNF407-like | 110501552 | Zinc finger protein 407-like | 16 | 15 | 3/12 | |
P250 | LOC110488021 | 110488021 | Calcitonin gene-related peptide type 1 receptor-like | 8 | 7 | 7/5 |
GATA 2-like | 110494514 | GATA-binding factor 2-like | 7 | 6 | 6/0 | |
LOC110498119 | 110498119 | Radical S-adenosyl methionine domain-containing protein 2-like | 4 | 3 | 3/0 | |
LOC110508922 | 110508922 | MARVEL domain-containing protein 2-like, transcript variant X2 | 3 | 3 | 3/0 | |
CRIP2-like | 110505831 | Cysteine-rich protein 2-like | 4 | 2 | 2/0 | |
P1K | LOC110527134 | 110527134 | Methyltransferase-like protein 7A | 5 | 5 | 0/5 |
SEMA5A-like | 110489566 | Semaphorin-5A-like | 6 | 4 | 0/4 | |
LOC110493345 | 110493345 | Gastrula zinc finger protein XlCGF17.1-like, transcript variant X1 | 4 | 4 | 4/0 | |
LOC100135939 | 100135939 | Proteoglycan 4, transcript variant X2 | 4 | 4 | 1/3 | |
GRTP1a-like | 110527156 | Growth hormone-regulated TBC Protein 1-A-like | 4 | 4 | 0/4 | |
P6K | LOC110523211 | 110523211 | Oocyte zinc finger protein XlCOF6-like,transcript variant X2 | 8 | 8 | 8/0 |
MARVELD2-like | 110523471 | MARVEL domain-containing protein 2-like | 8 | 8 | 8/0 | |
MED12-like | 110488993 | Mediator of RNA polymerase II transcription subunit 12-like | 9 | 7 | 7/0 | |
LOC110522593 | 110522593 | F-box only protein 31-like, transcript variant X1 | 7 | 7 | 0/7 | |
LOC110505815 | 110505815 | Gamma-aminobutyric acid receptor subunit rho-2-like | 6 | 6 | 6/0 |
References
- Rayman, M.P. Selenium intake, status, and health: A complex relationship. Hormones 2020, 19, 9–14. [Google Scholar] [CrossRef] [PubMed]
- Mariotti, M.; Ridge, P.G.; Zhang, Y.; Lobanov, A.V.; Pringle, T.H.; Guigo, R.; Hatfield, D.L.; Gladyshev, V.N. Composition and evolution of the vertebrate and mammalian selenoproteomes. PLoS ONE 2012, 7, e33066. [Google Scholar] [CrossRef] [PubMed]
- Gatlin, D.M., III; Barrows, F.T.; Brown, P.; Dabrowski, K.; Gaylord, T.G.; Hardy, R.W.; Herman, E.; Hu, G.; Krogdahl, Å.; Nelson, R.; et al. Expanding the utilization of sustainable plant products in aquafeeds: A review. Aquac. Res. 2007, 38, 551–579. [Google Scholar] [CrossRef]
- Glencross, B.D.; Baily, J.; Berntssen, M.H.G.; Hardy, R.; MacKenzie, S.; Tocher, D.R. Risk assessment of the use of alternative animal and plant raw material resources in aquaculture feeds. Rev. Aquac. 2020, 12, 703–758. [Google Scholar] [CrossRef]
- Fontagné-Dicharry, S.; Godin, S.; Liu, H.; Prabhu, P.A.J.; Bouyssiere, B.; Bueno, M.; Tacon, P.; Médale, F.; Kaushik, S.J. Influence of the forms and levels of dietary selenium on antioxidant status and oxidative stress-related parameters in rainbow trout (Oncorhynchus mykiss) fry. Br. J. Nutr. 2015, 113, 1876–1887. [Google Scholar] [CrossRef] [PubMed]
- Wischhusen, P.; Parailloux, M.; Geraert, P.-A.; Briens, M.; Bueno, M.; Mounicou, S.; Bouyssiere, B.; Antony Jesu Prabhu, P.; Kaushik, S.J.; Fauconneau, B.; et al. Effect of dietary selenium in rainbow trout (Oncorhynchus mykiss) broodstock on antioxidant status, its parental transfer and oxidative status in the progeny. Aquaculture 2019, 507, 126–138. [Google Scholar] [CrossRef]
- Steinbrenner, H.; Speckmann, B.; Klotz, L.-O. Selenoproteins: Antioxidant selenoenzymes and beyond. Arch. Biochem. Biophys. 2016, 595, 113–119. [Google Scholar] [CrossRef] [PubMed]
- Hill, K.E.; Burk, R.F. Effect of selenium deficiency and vitamin E deficiency on glutathione metabolism in isolated rat hepatocytes. J. Biol. Chem. 1982, 257, 10668–10672. [Google Scholar] [PubMed]
- Hill, K.E.; Burk, R.F. Effect of selenium deficiency on the disposition of plasma glutathione. Arch. Biochem. Biophys. 1985, 240, 166–171. [Google Scholar] [CrossRef]
- Lu, S.C. Regulation of glutathione synthesis. Mol. Asp. Med. 2009, 30, 42–59. [Google Scholar] [CrossRef]
- Bunk, M.J.; Combs, G.F. Evidence for an impairment in the conversion of methionine to cysteine in the selenium-deficient chick. Proc. Soc. Exp. Biol. Med. 1981, 167, 87–93. [Google Scholar] [CrossRef] [PubMed]
- Halpin, K.M.; Baker, D.H. Selenium deficiency and transsulfuration in the chick. J. Nutr. 1984, 114, 606–612. [Google Scholar] [CrossRef] [PubMed]
- Dalto, D.; Matte, J.-J. Pyridoxine (vitamin B6) and the glutathione peroxidase system; a link between one-carbon metabolism and antioxidation. Nutrients 2017, 9, 189. [Google Scholar] [CrossRef] [PubMed]
- Uthus, E.O.; Ross, S.A. Dietary selenium affects homocysteine metabolism differently in Fisher-344 rats and CD-1 mice. J. Nutr. 2007, 137, 1132–1136. [Google Scholar] [CrossRef] [PubMed]
- Uthus, E.O.; Yokoi, K.; Davis, C.D. Selenium deficiency in Fisher-344 rats decreases plasma and tissue homocysteine concentrations and alters plasma homocysteine and cysteine redox status. J. Nutr. 2002, 132, 1122–1128. [Google Scholar] [CrossRef]
- Speckmann, B.; Schulz, S.; Hiller, F.; Hesse, D.; Schumacher, F.; Kleuser, B.; Geisel, J.; Obeid, R.; Grune, T.; Kipp, A.P. Selenium increases hepatic DNA methylation and modulates one-carbon metabolism in the liver of mice. J. Nutr. Biochem. 2017, 48, 112–119. [Google Scholar] [CrossRef] [PubMed]
- Jones, P.A.; Takai, D. The role of DNA methylation in mammalian epigenetics. Science 2001, 293, 1068–1070. [Google Scholar] [CrossRef] [PubMed]
- Razin, A.; Cedar, H. DNA methylation and gene expression. Microbiol. Mol. Biol. Rev. 1991, 55, 451–458. [Google Scholar] [CrossRef]
- Speckmann, B.; Grune, T. Epigenetic effects of selenium and their implications for health. Epigenetics 2015, 10, 179–190. [Google Scholar] [CrossRef]
- Martín, I.; Gibert, M.J.; Pintos, C.; Noguera, A.; Besalduch, A.; Obrador, A. Oxidative stress in mothers who have conceived fetus with neural tube defects: The role of aminothiols and selenium. Clin. Nutr. 2004, 23, 507–514. [Google Scholar] [CrossRef]
- Xu, J.; Sinclair, K.D. One-carbon metabolism and epigenetic regulation of embryo development. Reprod. Fertil. Dev. 2015, 27, 667–676. [Google Scholar] [CrossRef] [PubMed]
- Skjærven, K.H.; Jakt, L.M.; Dahl, J.A.; Espe, M.; Aanes, H.; Hamre, K.; Fernandes, J.M. Parental vitamin deficiency affects the embryonic gene expression of immune-, lipid transport-and apolipoprotein genes. Sci. Rep. 2016, 6, 34535. [Google Scholar] [CrossRef] [PubMed]
- Skjærven, K.H.; Jakt, L.M.; Fernandes, J.M.O.; Dahl, J.A.; Adam, A.-C.; Klughammer, J.; Bock, C.; Espe, M. Parental micronutrient deficiency distorts liver DNA methylation and expression of lipid genes associated with a fatty-liver-like phenotype in offspring. Sci. Rep. 2018, 8, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Antony Jesu Prabhu, P.; Schrama, J.W.; Kaushik, S.J. Mineral requirements of fish: A systematic review. Rev. Aquac. 2016, 8, 172–219. [Google Scholar] [CrossRef]
- Schrauzer, G.N. Nutritional selenium supplements: Product types, quality, and safety. J. Am. Coll. Nutr. 2001, 20, 1–4. [Google Scholar] [CrossRef]
- Burk, R.F.; Hill, K.E. Regulation of selenium metabolism and transport. Annu. Rev. Nutr. 2015, 35, 109–134. [Google Scholar] [CrossRef]
- Dalto, B.D.; Tsoi, S.; Audet, I.; Dyck, M.K.; Foxcroft, G.R.; Matte, J.J. Gene expression of porcine blastocysts from gilts fed organic or inorganic selenium and pyridoxine. Reproduction 2015, 149, 31–42. [Google Scholar] [CrossRef]
- Dalto, D.B.; Audet, I.; Lapointe, J.; Matte, J.J. The importance of pyridoxine for the impact of the dietary selenium sources on redox balance, embryo development, and reproductive performance in gilts. J. Trace Elem. Med. Biol. 2016, 34, 79–89. [Google Scholar] [CrossRef]
- Weekley, C.M.; Harris, H.H. Which form is that? The importance of selenium speciation and metabolism in the prevention and treatment of disease. Chem. Soc. Rev. 2013, 42, 8870. [Google Scholar] [CrossRef]
- Sbodio, J.I.; Snyder, S.H.; Paul, B.D. Regulators of the transsulfuration pathway. Br. J. Pharmacol. 2019, 176, 583–593. [Google Scholar] [CrossRef]
- Geillinger, K.E.; Rathmann, D.; Köhrle, J.; Fiamoncini, J.; Daniel, H.; Kipp, A.P. Hepatic metabolite profiles in mice with a suboptimal selenium status. J. Nutr. Biochem. 2014, 25, 914–922. [Google Scholar] [CrossRef] [PubMed]
- Wolf, N.M.; Mueller, K.; Hirche, F.; Most, E.; Pallauf, J.; Mueller, A.S. Study of molecular targets influencing homocysteine and cholesterol metabolism in growing rats by manipulation of dietary selenium and methionine concentrations. Br. J. Nutr. 2010, 104, 520–532. [Google Scholar] [CrossRef] [PubMed]
- Uthus, E.O.; Ross, S.A.; Davis, C.D. Differential effects of dietary selenium (Se) and folate on methyl metabolism in liver and colon of rats. Biol. Trace Elem. Res. 2006, 109, 201–214. [Google Scholar] [CrossRef]
- Bakke, A.M.; Tashjian, D.H.; Wang, C.F.; Lee, S.H.; Bai, S.C.; Hung, S.S.O. Competition between selenomethionine and methionine absorption in the intestinal tract of green sturgeon (Acipenser medirostris). Aquat. Toxicol. 2010, 96, 62–69. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, A.P.; Wallenberg, M.; Gandin, V.; Misra, S.; Tisato, F.; Marzano, C.; Rigobello, M.P.; Kumar, S.; Björnstedt, M. Methylselenol formed by spontaneous methylation of selenide is a superior selenium substrate to the thioredoxin and glutaredoxin systems. PLoS ONE 2012, 7, e50727. [Google Scholar] [CrossRef] [PubMed]
- Nakamuro, K.; Okuno, T.; Hasegawa, T. Metabolism of selenoamino acids and contribution of selenium methylation to their toxicity. J. Health Sci. 2000, 46, 418–421. [Google Scholar] [CrossRef]
- Davis, C.D.; Uthus, E.O.; Finley, J.W. Dietary selenium and arsenic affect DNA methylation in vitro in Caco-2 cells and in vivo in rat liver and colon. J. Nutr. 2000, 130, 2903–2909. [Google Scholar] [CrossRef]
- King, W.D.; Ho, V.; Dodds, L.; Perkins, S.L.; Casson, R.I.; Massey, T.E. Relationships among biomarkers of one-carbon metabolism. Mol. Biol. Rep. 2012, 39, 7805–7812. [Google Scholar] [CrossRef]
- Fiala, E.S.; Staretz, M.E.; Pandya, G.A.; El-Bayoumy, K.; Hamilton, S.R. Inhibition of DNA cytosine methyltransferase by chemopreventive selenium compounds, determined by an improved assay for DNA cytosine methyltransferase and DNA cytosine methylation. Carcinogenesis 1998, 19, 597–604. [Google Scholar] [CrossRef]
- Zeng, H.; Yan, L.; Cheng, W.-H.; Uthus, E.O. Dietary selenomethionine increases exon-specific DNA methylation of the p53 gene in rat liver and colon mucosa. J. Nutr. 2011, 141, 1464–1468. [Google Scholar] [CrossRef]
- Xiang, N.; Zhao, R.; Song, G.; Zhong, W. Selenite reactivates silenced genes by modifying DNA methylation and histones in prostate cancer cells. Carcinogenesis 2008, 29, 2175–2181. [Google Scholar] [CrossRef] [PubMed]
- Jabłońska, E.; Reszka, E. Chapter Eight—Selenium and Epigenetics in Cancer: Focus on DNA Methylation. In Advances in Cancer Research; Tew, K.D., Galli, F., Eds.; Selenium and Selenoproteins in Cancer; Academic Press: Cambridge, MA, USA, 2017; Volume 136, pp. 193–234. [Google Scholar]
- Ahmed, M.Y.; Al-Khayat, A.; Al-Murshedi, F.; Al-Futaisi, A.; Chioza, B.A.; Pedro Fernandez-Murray, J.; Self, J.E.; Salter, C.G.; Harlalka, G.V.; Rawlins, L.E.; et al. A mutation of EPT1 (SELENOI) underlies a new disorder of Kennedy pathway phospholipid biosynthesis. Brain 2017, 140, 547–554. [Google Scholar] [CrossRef] [PubMed]
- Horibata, Y.; Elpeleg, O.; Eran, A.; Hirabayashi, Y.; Savitzki, D.; Tal, G.; Mandel, H.; Sugimoto, H. EPT1 (selenoprotein I) is critical for the neural development and maintenance of plasmalogen in humans. J. Lipid Res. 2018, 59, 1015–1026. [Google Scholar] [CrossRef] [PubMed]
- Solovyev, N.D. Importance of selenium and selenoprotein for brain function: From antioxidant protection to neuronal signalling. J. Inorg. Biochem. 2015, 153, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Fanning, T.G.; Hu, W.S.; Cardiff, R.D. Analysis of tissue-specific methylation patterns of mouse mammary tumor virus DNA by two-dimensional Southern blotting. J. Virol. 1985, 54, 726–730. [Google Scholar] [CrossRef]
- Duque-Guimarães, D.E.; Ozanne, S.E. Nutritional programming of insulin resistance: Causes and consequences. Trends Endocrinol. Metab. 2013, 24, 525–535. [Google Scholar] [CrossRef] [PubMed]
- Pacitti, D.; Lawan, M.M.; Feldmann, J.; Sweetman, J.; Wang, T.; Martin, S.A.M.; Secombes, C.J. Impact of selenium supplementation on fish antiviral responses: A whole transcriptomic analysis in rainbow trout (Oncorhynchus mykiss) fed supranutritional levels of Sel-Plex®. BMC Genom. 2016, 17, 116. [Google Scholar] [CrossRef] [PubMed]
- Jesu, P.P.A.; Holen, E.; Espe, M.; Silva, M.S.; Holme, M.-H.; Hamre, K.; Lock, E.-J.; Waagbø, R. Dietary selenium required to achieve body homeostasis and attenuate pro-inflammatory responses in Atlantic salmon post-smolt exceeds the present EU legal limit. Aquaculture 2020, 526, 735413. [Google Scholar] [CrossRef]
- Elumalai, P.; Kurian, A.; Lakshmi, S.; Faggio, C.; Esteban, M.A.; Ringø, E. Herbal immunomodulators in aquaculture. Rev. Fish Sci. Aquac. 2020, 1–25. [Google Scholar] [CrossRef]
- Vacchina, V.; Dumont, J. Total selenium quantification in biological samples by inductively coupled plasma mass spectrometry (ICP-MS). In Selenoproteins; Springer: Berlin, Germany, 2018; pp. 145–152. [Google Scholar]
- ECP; INRAE. Ecology and Fish Population Biology Facility (ECP)—Catalogue des Infrastructures de Recherche; INRAE: Paris, France, 2018. [Google Scholar] [CrossRef]
- Espe, M.; Lemme, A.; Petri, A.; El-Mowafi, A. Can Atlantic salmon (Salmo salar) grow on diets devoid of fish meal? Aquaculture 2006, 255, 255–262. [Google Scholar] [CrossRef]
- Toyooka, T.; Imai, K. New fluorogenic reagent having halogenobenzofurazan structure for thiols: 4-(aminosulfonyl)-7-fluoro-2,1,3-benzoxadiazole. Anal. Chem. 1984, 56, 2461–2464. [Google Scholar] [CrossRef]
- She, Q.-B.; Nagao, I.; Hayakawa, T.; Tsuge, H. A simple HPLC method for the determination of S-adenosylmethionine and S-adenosylhomocysteine in rat tissues: The effect of vitamin B6 deficiency on these concentrations in rat liver. Biochem. Biophys. Res. Commun. 1994, 205, 1748–1754. [Google Scholar] [CrossRef][Green Version]
- Albrektsen, S.; Hagve, T.A.; Lie, Ø. The effect of dietary vitamin B6 on tissue fat contents and lipid composition in livers and gills of Atlantic salmon (Salmo salar). Comp. Biochem. Phys. A 1994, 109, 403–411. [Google Scholar] [CrossRef]
- Mæland, A.; Rønnestad, I.; Fyhn, H.J.; Berg, L.; Waagbø, R. Water-soluble vitamins in natural plankton (copepods) during two consecutive spring blooms compared to vitamins in Artemia franciscana nauplii and metanauplii. Mar. Biol. 2000, 136, 765–772. [Google Scholar] [CrossRef]
- Kassambara, A.; Mundt, F. Factoextra: Extract and Visualize the Results of Multivariate Data Analyses, R Package Version 1.0.6. Available online: https://CRAN.R-project.org/package=factoextra (accessed on 24 July 2020).
- National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA). Available online: https://www.ncbu.nlm.nih.gov/sra (accessed on 24 July 2020).
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The sequence alignment/map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed]
- Ewels, P.; Magnusson, M.; Lundin, S.; Käller, M. MultiQC: Summarize analysis results for multiple tools and samples in a single report. Bioinformatics 2016, 32, 3047–3048. [Google Scholar] [CrossRef] [PubMed]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Krueger, F.; Andrews, S.R. Bismark: A flexible aligner and methylation caller for Bisulfite-Seq applications. Bioinformatics 2011, 27, 1571–1572. [Google Scholar] [CrossRef] [PubMed]
- Langmead, B.; Trapnell, C.; Pop, M.; Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009, 10, R25. [Google Scholar] [CrossRef]
- Akalin, A.; Kormaksson, M.; Li, S.; Garrett-Bakelman, F.E.; Figueroa, M.E.; Melnick, A.; Mason, C.E. methylKit: A comprehensive R package for the analysis of genome-wide DNA methylation profiles. Genome Biol. 2012, 13, R87. [Google Scholar] [CrossRef]
- Krijthe, J. T-Distributed Stochastic Neighbor Embedding Using Barnes-Hut, R Package Version 0.15. Available online: https://CRAN.R-project.org/package=Rtsne (accessed on 24 July 2020).
- van der Maaten, L.; Hinton, G. Visualizing data using t-SNE. J. Mach. Learn. Res. 2008, 9, 2579–2605. [Google Scholar]
- Wang, H.-Q.; Tuominen, L.K.; Tsai, C.-J. SLIM: A sliding linear model for estimating the proportion of true null hypotheses in datasets with dependence structures. Bioinformatics 2011, 27, 225–231. [Google Scholar] [CrossRef] [PubMed]
- Köster, J.; Rahmann, S. Snakemake—A scalable bioinformatics workflow engine. Bioinformatics 2012, 28, 2520–2522. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M.; Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M.; Sato, Y.; Morishima, K. BlastKOALA and GhostKOALA: KEGG tools for functional characterization of genome and metagenome sequences. J. Mol. Biol. 2016, 428, 726–731. [Google Scholar] [CrossRef] [PubMed]
- Moriya, Y.; Itoh, M.; Okuda, S.; Yoshizawa, A.C.; Kanehisa, M. KAAS: An automatic genome annotation and pathway reconstruction server. Nucleic Acids Res. 2007, 35, W182–W185. [Google Scholar] [CrossRef]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T. Gene ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.-G.; Han, Y.; He, Q.-Y. clusterProfiler: An R package for comparing biological themes among gene clusters. Omics 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.-G.; Yan, G.-R.; He, Q.-Y. DOSE: An R/Bioconductor package for disease ontology semantic and enrichment analysis. Bioinformatics 2015, 31, 608–609. [Google Scholar] [CrossRef]
Homocysteine | Cysteine | Cysteinyl-Glycine | Glutathione | γ-Glutamyl-Cysteine | ||
---|---|---|---|---|---|---|
Oocyte | NC | 0.3 ± 0.0 | 6.7 ± 1.0 | 3.7 ± 0.4 | 16 ± 1 | 1.0 ± 0.1 |
SS | 0.3 ± 0.0 | 6.7 ± 0.6 | 4.1 ± 0.5 | 17 ± 1 | 1.0 ± 0.1 | |
SO | 0.2 ± 0.0 | 8.1 ± 1.1 | 3.1 ± 0.3 | 13 ± 1 | 1.0 ± 0.1 | |
p-value | 0.21 | 0.48 | 0.35 | 0.07 | 0.48 | |
Female liver | NC | 1.4 ± 0.1 b | 33 ± 4 a | 53 ± 4 a | 551 ± 32 | 30 ± 4 |
SS | 1.1 ± 0.1 b | 17 ± 2 b | 37 ± 3 b | 530 ± 32 | 23 ± 2 | |
SO | 3.2 ± 0.3 a | 38 ± 3 a | 48 ± 3 ab | 526 ± 47 | 28 ± 3 | |
p-value | <0.01 | <0.01 | 0.01 | 0.88 | 0.29 | |
Male liver | NC | 0.7 ± 0.1 | 21 ± 3 | 26 ± 3 | 511 ± 64 | 21 ± 2 |
SS | 1.0 ± 0.2 | 24 ± 5 | 23 ± 3 | 300 ± 66 | 10 ± 2 | |
SO | 1.1 ± 0.3 | 33 ± 8 | 27 ± 4 | 465 ± 30 | 16 ± 5 | |
p-value | 0.49 | 0.33 | 0.80 | 0.06 | 0.48 | |
Average | Female | 1.9 ± 0.2 a | 29 ± 2 | 46 ± 2 a | 536 ± 22 a | 27 ± 2 a |
Male | 0.9 ± 0.1 b | 26 ± 3 | 25 ± 2 b | 434 ± 39 b | 13 ± 2 b | |
p-value | <0.01 | 0.43 | <0.01 | 0.02 | <0.01 |
Dietary Group | NC | SS | SO | p-Value |
---|---|---|---|---|
Essential amino acids 1 | 1972 ± 79 a | 1737 ± 54 b | 1400 ± 65 c | <0.01 |
Non-essential amino acids 1 | 2415 ± 50 a | 2351 ± 41 a | 2109 ± 60 b | <0.01 |
Methionine 1 | 99 ± 5 a | 83 ± 3 b | 56 ± 4 c | <0.01 |
Homocysteine 1 | 1.2 ± 0.1 | 1.1 ± 0.1 | 1.2 ± 0.1 | 0.86 |
Cystathionine 1 | 9 ± 1 | 6 ± 1 | 7 ± 1 | 0.21 |
Cysteine 1 | 21 ± 1 a | 17 ± 1 b | 17 ± 0 b | 0.01 |
Cysteinyl-glycine 1 | 28 ± 1 a | 24 ± 1 b | 24 ± 1 b | 0.02 |
Glutathione 1 | 179 ± 7 | 159 ± 7 | 169 ± 13 | 0.35 |
γ-Glutamyl-cysteine 1 | 18 ± 1 | 17 ± 1 | 16 ± 1 | 0.25 |
Taurine 1 | 688 ± 17 | 751 ± 18 | 724 ± 16 | 0.05 |
Pyridoxamine 2 | 0.24 ± 0.01 a | 0.21 ± 0.02 b | 0.18 ± 0.01 b | 0.01 |
Pyridoxal 2 | 1.82 ± 0.08 | 1.65 ± 0.06 | 1.85 ± 0.10 | 0.17 |
Folate 2 | 0.36 ± 0.03 | 0.37 ± 0.02 | 0.28 ± 0.02 | 0.05 |
Cobalamine 2 | 0.04 ± 0.00 | 0.04 ± 0.00 | 0.03 ± 0.00 | 0.51 |
DMGs | Hyper-/Hypomethylated DMC | |||
---|---|---|---|---|
Gene ID | Gene name | SS:NC | SO:NC | SO:SS |
Methionine Cycle | ||||
110530927 | S-adenosylmethionine synthase | 0/1 | ||
110537066 | S-adenosylmethionine synthase-like | 0/1 | 0/2 | |
110502651 | S-adenosylmethionine synthase-like | 1/0 P | 0/2 | 1/0 |
110529528 | S-adenosylmethionine decarboxylase proenzyme-like | 0/1 | 0/1 | |
110538418 | DNA (cytosine-5)-methyltransferase 1-like, transcript variant X1 | 0/1 | ||
110505844 | DNA (cytosine-5)-methyltransferase 3A-like | 1/0 | ||
110532515 | DNA (cytosine-5)-methyltransferase 3A-like, transcript variant X2 | 1/0 | ||
110497603 | DNA (cytosine-5)-methyltransferase 3A-like, transcript variant X6 | 1/0 | ||
110492301 | DNA (cytosine-5)-methyltransferase 3B-like, transcript variant X1 | 1/0 | ||
110500231 | Putative adenosylhomocysteinase 3 | 0/1 P | ||
110494352 | S-adenosylhomocysteine hydrolase-like protein 1 transcript variant X1 | 1/0 | ||
110490243 | Adenosylhomocysteinase 3-like | 2/1 | 4/2 | 0/1 |
110522167 | Putative adenosylhomocysteinase 3, transcript variant X2 | 0/1 | ||
Glutathione Metabolism | ||||
110521555 | Glutamate—cysteine ligase regulatory subunit-like | 0/1 | ||
110502703 | Glutamate—cysteine ligase catalytic subunit-like, transcript variant X2 | 0/1 | ||
110532297 | Glutathione synthetase | 0/1 P | ||
110522620 | Glutathione-specific gamma-glutamylcyclotransferase 1-like | 2/0 | ||
110537206 | Gamma-glutamyltransferase 5-like,transcript variant X1 | 0/1 P | 1/0 P | 2/0 P |
100305229 | Glutathione S-transferase kappa 1, transcript variant X1 | 1/0 P | ||
110492369 | Glucose-6-phosphate 1-dehydrogenase-like, transcript variant X2 | 2/0 | 0/1 | |
100305228 | Peroxiredoxin 6, transcript variant X2 | 1/0 | ||
110532317 | Spermidine synthase | 0/1 P | ||
110535309 | 5-oxoprolinase (ATP-hydrolyzing) | 0/1 | 1/2 | |
110501851 | Isocitrate dehydrogenase [NADP] cytoplasmic-like | 1/0 P | 0/1 P | |
110520228 | Isocitrate dehydrogenase [NADP] cytoplasmic-like | 1/1 | ||
Selenoprotein Synthesis and Selenoproteins | ||||
110494778 | Methionyl-tRna synthetase 1 | 0/1 | 0/1 | |
110488988 | Methionyl-tRNA synthetase 2, mitochondrial | 1/0 | ||
110500323 | Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase | 1/0 P | ||
110512109 | tRNA selenocysteine 1-associated protein 1-like | 0/1 | ||
110528137 | Eukaryotic elongation factor, selenocysteine-tRNA specific | 1/0 | ||
110529243 | Selenoprotein I | 0/3 | 5/0 | 7/0 |
100499413 | Selenoprotein U | 0/1 P | 1/0 P | 1/0 P |
110532070 | Selenoprotein K, transcript variant X1 | 0/1 | ||
110497881 | Selenoprotein O-like | 1/0 | ||
110525853 | Thioredoxin reductase 2 | 0/1 |
Diet | NC | SS | SO |
---|---|---|---|
Ingredients | |||
Plant meals 1 | 74 | 74 | 74 |
Crystalline amino acids and attractant mixture 2 | 3.14 | 3.14 | 3.14 |
Soybean lecithin3 | 2 | 2 | 2 |
Fish oil 3 | 8 | 8 | 8 |
Vegetable oils 4 | 8 | 8 | 8 |
Astaxanthin (µg/g diet) 5 | 40 | 40 | 40 |
Vitamin and mineral mixture without Se 6 | 4.82 | 4.82 | 4.82 |
Sodium selenite (µg/g diet) 7 | – | 0.71 | – |
Hydroxy-selenomethione (µg/g diet) 7 | – | – | 0.75 |
Analytical composition | |||
Dry matter (DM, %) | 96 | 98 | 97 |
Crude protein (% DM) | 49 | 50 | 50 |
Total lipid (% DM) | 23 | 22 | 23 |
Gross energy (kJ/g DM) | 25 | 25 | 25 |
Ash (% DM) | 6 | 6 | 6 |
Phosphorus (% DM) | 1.2 | 1.1 | 1.2 |
Selenium (mg/kg dry feed) 8 | 0.3 | 0.8 | 0.7 |
Gene | Accession No. | Forward Primer | Reverse Primer | Amplification Size |
---|---|---|---|---|
amd1a | XM_021611778.1 | ccgtaccatcccaaggtttga | tcctgcttgtcggtctttgt | 87 |
amd1b | XM_021600287.1 | cagccagattttcccaaacgg | gcatgctcgttctcccagaa | 108 |
bhmt | FR908041.1 | cagagaagcacggtaactgg | ttctttgtgctgcatcaggt | 188 |
cbs | NM_001124686.1 | ccacctcaggcaatacaggt | aacatccaccttctccatgc | 107 |
cgl | EU315111.1 | caccaaccccaccatgaaag | gcgctggaagtaggctgaca | 118 |
dnmt1 | XM_021557911.1 | ttgccagaagaggagatgcc | cccaggtcagcttgccatta | 152 |
gnmt | XM_021585680.1 | ctcaagtacgcgctgaagga | cactctggtcccctttgaagt | 187 |
mtr | XM_021576690.1 | aatgcaggtctgcccaatac | ctgatgtgtgcaggagtcgt | 137 |
sahh | XM_021609053.1 | atcaaacgggccacagatgt | tcgtaccttccatggcagc | 167 |
β-actin | AJ438158.1 | gatgggccgaaagacagcta | tcgtcccgtggtgacgat | 105 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wischhusen, P.; Saito, T.; Heraud, C.; Kaushik, S.J.; Fauconneau, B.; Antony Jesu Prabhu, P.; Fontagné-Dicharry, S.; Skjærven, K.H. Parental Selenium Nutrition Affects the One-Carbon Metabolism and the Hepatic DNA Methylation Pattern of Rainbow Trout (Oncorhynchus mykiss) in the Progeny. Life 2020, 10, 121. https://doi.org/10.3390/life10080121
Wischhusen P, Saito T, Heraud C, Kaushik SJ, Fauconneau B, Antony Jesu Prabhu P, Fontagné-Dicharry S, Skjærven KH. Parental Selenium Nutrition Affects the One-Carbon Metabolism and the Hepatic DNA Methylation Pattern of Rainbow Trout (Oncorhynchus mykiss) in the Progeny. Life. 2020; 10(8):121. https://doi.org/10.3390/life10080121
Chicago/Turabian StyleWischhusen, Pauline, Takaya Saito, Cécile Heraud, Sadasivam J. Kaushik, Benoit Fauconneau, Philip Antony Jesu Prabhu, Stéphanie Fontagné-Dicharry, and Kaja H. Skjærven. 2020. "Parental Selenium Nutrition Affects the One-Carbon Metabolism and the Hepatic DNA Methylation Pattern of Rainbow Trout (Oncorhynchus mykiss) in the Progeny" Life 10, no. 8: 121. https://doi.org/10.3390/life10080121
APA StyleWischhusen, P., Saito, T., Heraud, C., Kaushik, S. J., Fauconneau, B., Antony Jesu Prabhu, P., Fontagné-Dicharry, S., & Skjærven, K. H. (2020). Parental Selenium Nutrition Affects the One-Carbon Metabolism and the Hepatic DNA Methylation Pattern of Rainbow Trout (Oncorhynchus mykiss) in the Progeny. Life, 10(8), 121. https://doi.org/10.3390/life10080121