Association among the Presence of Rotavirus Group A and Types of Sources Located in Rural Communities

Round 1

Reviewer 1 Report

the use of figures of Real-time PCR in the text could improve results and aid readres to understand in better way. And also I did not find any mention to standard virus or ATCC as control in real-time PCR.

Author Response

Review letter 
Association among the presence of Rotavirus group A and types of sources located 
in rural communities
Reviewer 1
Reviewer 1: the use of figures of Real-time PCR in the text could improve results and 
aid readres to understand in better way. 
Author’s answer: Figure 4 added
Reviewer 1: I did not find any mention to standard virus or ATCC as control in realtime PCR.
Author’s answer: The positive control for Rotavirus was synthesized in the laboratory 
by company Molecular Biotecnologia LTDA®, chosen and aligned through the Bank of 
Data from NCBI (GenBank), accession number HM348746 (Human Rotavirus A strain 
mani-265/07 of the VP6 gene structural protein). Line 211 to 214

Author Response File: Author Response.pdf

Reviewer 2 Report

This is an interesting paper but I think needs a large amount of work and revision before it can be published. The introduction is weak and I was surprised that the authors did not set out the scale of the global disease burden that can be attributed to rotavirus (it is the leading cause of death from diarrhoeal disease in the under-5s) which is widely available. I also expected some discussion of the relative importance of hand washing, disposal of faeces (usually termed sanitation) and water supply in controlling rotavirus. Most of the evidence points to the first of these being most important, but it would have been useful to discuss this and show why studying rotavirus presence in groundwater is important. The descriptions of water supply and sanitation are very limited and rather vague. There is a lot of information about genetic make-up of rotavirus but it is very unclear why this is relevant to the study.

The methods must be improved – how did you select water sources, is this a representative sample of supplies in this area and how did you arrive at the sample size? How many people in the area use different types of water supply? What are ‘quilombola communities’?

Much of the discussion contains material that would be better placed in the introduction and there is little or no discussion of the results and their implications. This section needs complete re-writing to be of value.

Author Response

Reviewer 2
Reviewer 2: The introduction is weak and I was surprised that the authors did not set out 
the scale of the global disease burden that can be attributed to rotavirus (it is the leading 
cause of death from diarrhoeal disease in the under-5s) which is widely available. 
Author’s answer: Complementary written text. line 29 to 98.
Reviewer 2: I also expected some discussion of the relative importance of hand washing, 
disposal of faeces (usually termed sanitation) and water supply in controlling rotavirus. 
Most of the evidence points to the first of these being most important, but it would have 
been useful to discuss this and show why studying rotavirus presence in groundwater is 
important. 
Author’s answer: Added in text: introduction > lines 36 to 55. discussion: 355 to 361.
Reviewer 2: The descriptions of water supply and sanitation are very limited and rather 
vague. There is a lot of information about genetic make-up of rotavirus but it is very 
unclear why this is relevant to the study.
Author’s answer: Complementary written text. line 29 to 98.
Reviewer 2: The methods must be improved – how did you select water sources, is this 
a representative sample of supplies in this area and how did you arrive at the sample size? 
How many people in the area use different types of water supply? What are ‘quilombola 
communities’?
Author’s answer: Added information about sampling and sample size in the topic of 
statistical analysis.
Reviewer 2: Much of the discussion contains material that would be better placed in the 
introduction and there is little or no discussion of the results and their implications. This 
section needs complete re-writing to be of value.
Author’s answer: Discussion and introduction were complemented

Author Response File: Author Response.pdf

Reviewer 3 Report

This paper provides the results of an interesting topic. Overall, I recommend a review of the English (especially in the discussion). I think that this paper misses a more detailed description of the sampling areas, I mean, it would be interesting to know if there are some aspects common to the samples where you detected the virus. Maybe you can also add a supplementary table where you list all 86 samples specifying the counties (coordinates?), the font type and presence/absence of the virus. Is there any difference between shallow pit dugs where you detected the virus and those where you did not detect it? Did you register any environmental parameter (water pH, temperature,…)?

L47: The first “resources” should be removed.

L74: Maybe there should be another “viruses” after “non-human animals”.

L79: The capital letter for “the” is missing.

L85: the last sentence should be rephrased. There should be an introduction to connect it to the previous one.

L91: I would specify, just to make it more clear, “the TOTAL samples size”

L115: the verb is missing in the sentence.

L117-118: What do you mean by saying that the containers were identified? Also, I think the verb is missing after “to” in the last part.

L121: “was performed adsorbed” should be adjusted (was performed by adsorption?).

L122-123: “The which” should be corrected. Did you mean “the sample”?

L123: “until the charge quantification processing viral”. I think the English should be adjusted.

L126: “was carried out” is missing, or something similar.

L129: You mean biological safety cabinet?

L142-143: Please, re-write the sentence.

L153: I think you should provide the concentration of the oligonucleotides.

L155: What is the purple mix?

L172-175: Please, re-write the sentence.

L180: WAS considered?

L234: Maybe a comma is missing.

L231: The discussion needs a strong revision of the English.

L286: Disinfection process: can you make some examples?

Author Response

Reviewer 3
Reviewer 3: I recommend a review of the English (especially in the discussion). 
Author’s answer: Revised
Reviewer 3: I think that this paper misses a more detailed description of the sampling 
areas, I mean, it would be interesting to know if there are some aspects common to the 
samples where you detected the virus. Maybe you can also add a supplementary table 
where you list all 86 samples specifying the counties (coordinates?), the font type and 
presence/absence of the virus. 
Author’s answer:
Added information about sampling and sample size in the topic of statistical analysis. 
Table with coordinates and table with positive samples by type of source have been 
added.
Reviewer 3: Is there any difference between shallow pit dugs where you detected the 
virus and those where you did not detect it? Did you register any environmental 
parameter (water pH, temperature,…)?
Author’s answer: With no statistically significant difference, since they are 
environmental samples, several factors contribute to the presence or absence of the 
virus. Boxplot graph was added in the article, viruses were detected both in alkaline 
samples, as well as in acidic and neutral samples. Room temperature in all samples 
(similar).
Reviewer 3: L47: The first “resources” should be removed.
Author’s answer: L47: adjusted.
Reviewer 3: L74: Maybe there should be another “viruses” after “non-human animals”.
Author’s answer: L74: adjusted.
Reviewer 3: L79: The capital letter for “the” is missing.
Author’s answer: adjusted..
Reviewer 3: L85: the last sentence should be rephrased. There should be an 
introduction to connect it to the previous one.
Author’s answer: L85: adjusted..
Reviewer 3: L91: I would specify, just to make it more clear, “the TOTAL samples 
size”
Author’s answer: L91: adjusted..
Reviewer 3: L115: the verb is missing in the sentence.
Author’s answer: L115: adjusted..
.
Reviewer 3: L117-118: What do you mean by saying that the containers were 
identified? Also, I think the verb is missing after “to” in the last part.
Author’s answer: adjusted..
Reviewer 3: L121: “was performed adsorbed” should be adjusted (was performed by 
adsorption?).
Author’s answer: : adjusted..
Reviewer 3: L122-123: “The which” should be corrected. Did you mean “the sample”?
Author’s answer: adjusted..
Reviewer 3: L123: “until the charge quantification processing viral”. I think the English 
should be adjusted.
Author’s answer: adjusted..
Reviewer 3: L126: “was carried out” is missing, or something similar.
Author’s answer: adjusted..
Reviewer 3: L129: You mean biological safety cabinet?
Author’s answer: adjusted..
Reviewer 3: L142-143: Please, re-write the sentence.
Author’s answer: adjusted.
Reviewer 3: L153: I think you should provide the concentration of the oligonucleotides.
Author’s answer: adjusted.
Reviewer 3: L155: What is the purple mix?
Author’s answer: adjusted
Reviewer 3: L172-175: Please, re-write the sentence.
Author’s answer: adjusted
Reviewer 3: L180: WAS considered?
Author’s answer: adjusted.
Reviewer 3: L234: Maybe a comma is missing.
Author’s answer: adjusted
Reviewer 3: L231: The discussion needs a strong revision of the English.
Author’s answer: adjusted
Reviewer 3: L286: Disinfection process: can you make some examples?
Author’s answer: adjusted.

Author Response File: Author Response.pdf

Round 2

Reviewer 3 Report

I appreciate the effort in improving the introduction, anyway I think the authors should put more effort in putting some order and fixing some problems.

L22: “to” should be removed

L57-61: I think you can remove this sentence about pollution.

L84: I think you should be more specific than “countries with little development”, I would specify the specific point where they are underdeveloped.

L85: I think it is “obtained” or “water source”.

L86: Please, rewrite this sentence.

L189: This sentence was not changed, I think the verb is still missing.

L190: I would remove containers and just say samples. Furthermore, I still don’t understand what you mean with “identified”.

L230: Concentration of oligonucleotides are still missing.

L231-233: I would remove this sentence and keep the previous one only. I think you have to ad only the nucleotides (with their concentration).

L254-256: Maybe they were supposed to be 2 sentences? In its form it has no sense.

L258: What do you mean with “but consumption is also consumed untreated by the population”? Is it that people drink also untreated water?

L291: Please translate the caption.

L303-304: The caption has no sense in its form. Furthermore, I would provide the legend of the colors (standard, negative control, samples).

L314: I don’t understand what is this caption about.

Author Response

Comments and Suggestions for Authors

I appreciate the effort in improving the introduction, anyway I think the authors should put more effort in putting some order and fixing some problems.

L22: “to” should be removed

Response: change made

L57-61: I think you can remove this sentence about pollution.

Response: change made

L84: I think you should be more specific than “countries with little development”, I would specify the specific point where they are underdeveloped.

Response: change made

L85: I think it is “obtained” or “water source”.

Response: change made

L86: Please, rewrite this sentence.

Response: change made

L189: This sentence was not changed, I think the verb is still missing.

Response: change made

L190: I would remove containers and just say samples. Furthermore, I still don’t understand what you mean with “identified”.

Response: change made

L230: Concentration of oligonucleotides are still missing.

The positive control for Rotavirus was synthesized in the laboratory by company Molecular Biotecnologia LTDA^®, chosen and aligned through the Bank of Data from NCBI (GenBank), accession number HM348746 (Human Rotavirus A strain mani-265/07 of the VP6 gene structural protein). The positive control concentration was 37 ng/µL, measured using the nanodrop. Subsequently, serial exponential dilutions were performed.

L231-233: I would remove this sentence and keep the previous one only. I think you have to ad only the nucleotides (with their concentration).

The positive control for Rotavirus was synthesized in the laboratory by company Molecular Biotecnologia LTDA^®, chosen and aligned through the Bank of Data from NCBI (GenBank), accession number HM348746 (Human Rotavirus A strain mani-265/07 of the VP6 gene structural protein). The positive control concentration was 37 ng/µL, measured using the nanodrop. Subsequently, serial exponential dilutions were performed.

L254-256: Maybe they were supposed to be 2 sentences? In its form it has no sense.

Response: change made

L258: What do you mean with “but consumption is also consumed untreated by the population”? Is it that people drink also untreated water?

Yes, people consume untreated water.

L291: Please translate the caption.

Response: change made

L303-304: The caption has no sense in its form. Furthermore, I would provide the legend of the colors (standard, negative control, samples).

Response: change made

L314: I don’t understand what is this caption about.

The test used is for association, so the caption is an association between the type of source and the presence of the virus.

Author Response File: Author Response.docx

Round 3

Reviewer 3 Report

L187: Ad "was used" after "negative charges".

I understand that "The positive control concentration was 37 ng/μL".

Is the positive control for Rotavirus the same thing as oligonucleotides?

When you explain how you prepare the PCR mix : "the reaction volume was considered of 20μL per sample, being 0.4μL of Oligonucleotide sense, 0.4μL of Antisense oligonucleotide, 4μL of 5x HOT FIRE Pol Eva Green qPCR mix Methods 23 plus (ROX), 10.2μL of water and 5μL of sample (cDNA)."

You have to specify the concentration of the sense and  Antisense oligonucleotides as well, 0.4 ul is not enough to repeat your experiment.

Author Response

Answer letter

Reviewer: L187: Ad "was used" after "negative charges".

Author answer: The information was added and the phrase was marked of blue.

Reviewer: I understand that "The positive control concentration was 37 ng/μL".

Author answer: The positive control concentration used was 5 ng/μL. The mistake was adjusted and the information was marked of blue.

Reviewer: Is the positive control for Rotavirus the same thing as oligonucleotides?

Author answer: The positive control was sintetized by Molecular Biotecnologia LTDA^®. A nucleotide fragment of 311 base pairs was synthesized. Positive control sequence at follow: GAAAATCATCAAGATGTACTTTTCCATTCGAAAGAACTACTCTTAAAATCTGTGTTGATAGCTATTGGTCAGTCAAAAGAAATCGAAACTACTGCTACTGCCGAAGGAGGAGAAATAGTATTTCAGAATGCAGCTTTTACTATGTGGAAATTGACGTATTTAGATCATAAATTAATGCCTATTTTGGATCAGAATTTCATTGAATATAAAATTACATTGAATGAAGATAAACCAATTTCAGATGTATGTGTTAAAGAACTTGTTGCTGAATTAAGATGGCAGTATAACAGATTTGCTATAATAACACATGG. The information was added and marked of blue.

Reviewer: When you explain how you prepare the PCR mix : "the reaction volume was considered of 20μL per sample, being 0.4μL of Oligonucleotide sense, 0.4μL of Antisense oligonucleotide, 4μL of 5x HOT FIRE Pol Eva Green qPCR mix Methods 23 plus (ROX), 10.2μL of water and 5μL of sample (cDNA)." You have to specify the concentration of the sense and  Antisense oligonucleotides as well, 0.4 ul is not enough to repeat your experiment.

Author answer: The oligonucletides concentrations were added on article and the information was marked of blue.

Author Response File: Author Response.docx