Thyroid-Disrupting Effects of Cadmium and Mercury in Zebrafish Embryos/Larvae
Abstract
:1. Introduction
2. Experimental Procedures
2.1. Embryo Culture and Exposure
2.2. RNA Extraction and Quantitative RT-PCR
2.3. Thyroid Hormone Assays
2.4. Statistical Analysis
3. Results
3.1. Developmental Toxicity Caused by Cd2+ and Hg2+
3.2. Effects of Cd2+ on the Thyroid Endocrine System
3.3. Effects of Hg2+ on the Thyroid Endocrine System
3.4. PCA and Correlation Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Raychaudhuri, S.S.; Pramanick, P.; Talukder, P.; Basak, A. Chapter 6—Polyamines, metallothioneins, and phytochelatins—Natural defense of plants to mitigate heavy metals. In Studies in Natural Products Chemistry; Attaur, R., Ed.; Elsevier: Amsterdam, The Netherlands, 2021; Volume 69, pp. 227–261. [Google Scholar]
- Ali, H.; Khan, E. What are heavy metals? Long-standing controversy over the scientific use of the term ‘heavy metals’—Proposal of a comprehensive definition. Toxicol. Environ. Chem. 2018, 100, 6–19. [Google Scholar] [CrossRef]
- Authman, M.M.; Zaki, M.S.; Khallaf, E.A.; Abbas, H.H. Use of fish as bio-indicator of the effects of heavy metals pollution. J. Aquac. Res. Dev. 2015, 6, 1–13. [Google Scholar] [CrossRef]
- Tchounwou, P.B.; Yedjou, C.G.; Patlolla, A.K.; Sutton, D.J. Heavy metal toxicity and the environment. Mol. Clin. Environ. Toxicol. 2012, 133–164. [Google Scholar]
- Peng, Z.; Liu, X.; Zhang, W.; Zeng, Z.; Liu, Z.; Zhang, C.; Liu, Y.; Shao, B.; Liang, Q.; Tang, W.; et al. Advances in the application, toxicity and degradation of carbon nanomaterials in environment: A review. Environ. Int. 2020, 134, 105298. [Google Scholar] [CrossRef]
- Morcillo, P.; Esteban, M.; Cuesta, A. Heavy metals produce toxicity, oxidative stress and apoptosis in the marine teleost fish SAF-1 cell line. Chemosphere 2016, 144, 225–233. [Google Scholar] [CrossRef]
- Thakare, M.; Sarma, H.; Datar, S.; Roy, A.; Pawar, P.; Gupta, K.; Pandit, S.; Prasad, R. Understanding the holistic approach to plant-microbe remediation technologies for removing heavy metals and radionuclides from soil. Curr. Res. Biotechnol. 2021, 3, 84–98. [Google Scholar] [CrossRef]
- He, B.; Yun, Z.; Shi, J.; Jiang, G. Research progress of heavy metal pollution in China: Sources, analytical methods, status, and toxicity. Chin. Sci. Bull. 2013, 58, 134–140. [Google Scholar] [CrossRef] [Green Version]
- Henson, M.C.; Chedrese, P.J. Endocrine disruption by cadmium, a common environmental toxicant with paradoxical effects on reproduction. Exp. Biol. Med. 2004, 229, 383–392. [Google Scholar] [CrossRef]
- Takiguchi, M.; Yoshihara, S. New aspects of cadmium as endocrine disruptor. Environ. Sci. Int. J. Environ. Physiol. Toxicol. 2006, 13, 107–116. [Google Scholar]
- Díaz, M.J.; Pino, J.D.; Frejo, M.T. Metals and thyroid toxicity. Thyroid. Toxic. 2016, 97–121. [Google Scholar]
- Pilat-Marcinkiewicz, B.; Brzoska, M.M.; Sawicki, B.; Moniuszko-Jakoniuk, J. Structure and function of thyroid follicular cells in female rats chronically exposed to cadmium. Bull.-Vet. Inst. Pulawy 2003, 47, 157–163. [Google Scholar]
- Piłat-Marcinkiewicz, B.; Sawicki, B.; Brzóska, M.M.; Moniuszko-Jakoniuk, J. Effect of chronic administration of cadmium on the rat thyroid: Radioimmunological and immunohistochemical studies. Folia Histochem. Cytobiol. 2002, 40, 189–190. [Google Scholar]
- Jancic, S.A.; Stosic, B.Z. Cadmium effects on the thyroid gland. Vitam. Horm. 2014, 94, 391–425. [Google Scholar] [CrossRef]
- Rosati, M.V.; Montuori, L.; Caciari, T.; Sacco, C.; Marrocco, M.; Tomei, G.; Scala, B.; Sancini, A.; Anzelmo, V.; Bonomi, S.; et al. Correlation between urinary cadmium and thyroid hormones in outdoor workers exposed to urban stressors. Toxicol. Ind. Health 2016, 32, 1978–1986. [Google Scholar] [CrossRef]
- Hammouda, F.; Messaoudi, I.; El Hani, J.; Baati, T.; Saïd, K.; Kerkeni, A. Reversal of cadmium-induced thyroid dysfunction by selenium, zinc, or their combination in rat. Biol. Trace Element Res. 2008, 126, 194–203. [Google Scholar] [CrossRef]
- Buha, A.; Antonijević, B.; Bulat, Z.; Jaćević, V.; Milovanović, V.; Matović, V. The impact of prolonged cadmium exposure and co-exposure with polychlorinated biphenyls on thyroid function in rats. Toxicol. Lett. 2013, 221, 83–90. [Google Scholar] [CrossRef]
- Curcic, M.; Janković, S.; Jacevic, V.; Stankovic, S.; Vucinic, S.; Durgo, K.; Bulat, Z.; Antonijevic, B. Combined effects of cadmium and decabrominated diphenyl ether on thyroid hormones in rats. Arch. Ind. Hyg. Toxicol. 2012, 63, 255–262. [Google Scholar] [CrossRef]
- Alice, H.; Claude, D.; Ricard, A.C. Effects of acute and subacute exposures to cadmium on the interrenal and thyroid function in rainbow trout, Oncorhynchus mykiss. Aquat. Toxicol. 1996, 35, 171–182. [Google Scholar]
- Ricard, A.C.; Daniel, C.; Anderson, P.; Hontela, A. Effects of subchronic exposure to cadmium chloride on endocrine and metabolic functions in rainbow trout Oncorhynchus mykiss. Arch. Environ. Contam. Toxicol. 1998, 34, 377–381. [Google Scholar] [CrossRef]
- Li, Z.-H.; Chen, L.; Wu, Y.-H.; Li, P.; Li, Y.-F.; Ni, Z.-H. Effects of waterborne cadmium on thyroid hormone levels and related gene expression in Chinese rare minnow larvae. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2014, 161, 53–57. [Google Scholar] [CrossRef]
- Ullrich, S.M.; Tanton, T.W.; Abdrashitova, S.A. Mercury in the aquatic environment: A review of factors affecting methylation. Crit. Rev. Environ. Sci. Technol. 2001, 31, 241–293. [Google Scholar] [CrossRef]
- Heaven, S.; Ilyushchenko, M.A.; Tanton, T.W.; Ullric, S.M.; Yanin, E.P. Mercury in the river nura and its floodplain, central kazakhstan: I. river sediments and water. Sci. Total Environ. 2000, 260, 35–44. [Google Scholar] [CrossRef]
- National Toxicology, P. Toxicology and carcinogenesis studies of mercuric chloride (CAS No. 7487-94-7) in F344 rats and B6C3F1 mice (gavage studies). Natl. Toxicol. Program Tech. Rep. Ser. 1993, 408, 1–260. [Google Scholar]
- Chen, A.; Kim, S.S.; Chung, E.; Dietrich, K.N. Thyroid hormones in relation to lead, mercury, and cadmium exposure in the national health and nutrition examination survey, 2007–2008. Environ. Health Perspect. 2013, 121, 181–186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kirubagaran, R.; Joy, K. Toxic effects of mercurials on thyroid function of the catfish, Clarias batrachus (L.). Ecotoxicol. Environ. Saf. 1989, 17, 265–271. [Google Scholar] [CrossRef]
- Bleau, H.; Daniel, C.; Chevalier, G.; Van Tra, H.; Hontela, A. Effects of acute exposure to mercury chloride and methylmercury on plasma cortisol, T3, T4, glucose and liver glycogen in rainbow trout (Oncorhynchus mykiss). Aquat. Toxicol. 1995, 34, 221–235. [Google Scholar] [CrossRef]
- Li, Z.-H.; Chen, L.; Wu, Y.-H.; Li, P.; Li, Y.-F.; Ni, Z.-H. Alteration of thyroid hormone levels and related gene expression in Chinese rare minnow larvae exposed to mercury chloride. Environ. Toxicol. Pharmacol. 2014, 38, 325–331. [Google Scholar] [CrossRef]
- Yen, P.M. Physiological and molecular basis of thyroid hormone action. Physiol. Rev. 2001, 81, 1097–1142. [Google Scholar] [CrossRef] [Green Version]
- Manchado, M.; Infante, C.; Asensio, E.; Planas, J.V.; Canavate, J.P. Thyroid hormones down-regulate thyrotropin beta subunit and thyroglobulin during metamorphosis in the flatfish senegalese sole (Solea senegalensis Kaup). Gen. Comp. Endocrinol. 2008, 155, 447–455. [Google Scholar] [CrossRef]
- Blanco, J.; Mulero, M.; Heredia, L.; Pujol, A.; Domingo, J.L.; Sanchez, D.J. Perinatal exposure to BDE-99 causes learning dis-orders and decreases serum thyroid hormone levels and BDNF gene expression in hippocampus in rat offspring. Toxicology 2013, 308, 122–128. [Google Scholar] [CrossRef]
- Carr, J.A.; Patino, R. The hypothalamus-pituitary-thyroid axis in teleosts and amphibians: Endocrine disruption and its con-sequences to natural populations. Gen. Comp. Endocrinol. 2011, 170, 299–312. [Google Scholar] [CrossRef]
- Sun, H.-J.; Li, H.-B.; Xiang, P.; Zhang, X.; Ma, L.Q. Short-term exposure of arsenite disrupted thyroid endocrine system and altered gene transcription in the HPT axis in zebrafish. Environ. Pollut. 2015, 205, 145–152. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Wu, L.; Zhong, L.; Ru, H.; Yao, F.; Ni, Z.; Li, Y. Thyroid disruption and growth inhibition of zebrafish embryos/larvae by phenanthrene treatment at environmentally relevant concentrations. Aquat. Toxicol. 2022, 243, 106053. [Google Scholar] [CrossRef]
- Wu, L.; Ru, H.; Ni, Z.; Zhang, X.; Xie, H.; Yao, F.; Zhang, H.; Li, Y.; Zhong, L. Comparative thyroid disruption by o,p’-DDT and p,p’-DDE in zebrafish embryos/larvae. Aquat. Toxicol. 2019, 216, 105280. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Jezierska, B.; Ługowska, K.; Witeska, M. The effects of heavy metals on embryonic development of fish (a review). Fish Physiol. Biochem. 2008, 35, 625–640. [Google Scholar] [CrossRef]
- Sfakianakis, D.; Renieri, E.; Kentouri, M.; Tsatsakis, A. Effect of heavy metals on fish larvae deformities: A review. Environ. Res. 2015, 137, 246–255. [Google Scholar] [CrossRef]
- MacKenzie, D.S.; Jones, R.A.; Miller, T.C. Thyrotropin in teleost fish. Gen. Comp. Endocrinol. 2009, 161, 83–89. [Google Scholar] [CrossRef]
- Porazzi, P.; Calebiro, D.; Benato, F.; Tiso, N.; Persani, L. Thyroid gland development and function in the zebrafish model. Mol. Cell Endocrinol. 2009, 312, 14–23. [Google Scholar] [CrossRef] [Green Version]
- Targovnik, H.M.; Citterio, C.E.; Rivolta, C.M. Iodide handling disorders (NIS, TPO, TG, IYD). Best Pract. Res. Clin. Endocrinol. Metab. 2017, 31, 195–212. [Google Scholar] [CrossRef] [PubMed]
- Dunn, J.T.; Dunn, A.D. Update on intrathyroidal iodine metabolism. Thyroid 2001, 11, 407–414. [Google Scholar] [CrossRef] [PubMed]
- Power, D.; Llewellyn, L.; Faustino, M.; Nowell, M.; Björnsson, B.; Einarsdottir, I.; Canario, A.; Sweeney, G. Thyroid hormones in growth and development of fish. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2001, 130, 447–459. [Google Scholar] [CrossRef] [PubMed]
- Du, J.; Wang, S.; You, H.; Liu, Z. Effects of ZnO nanoparticles on perfluorooctane sulfonate induced thyroid-disrupting on zebrafish larvae. J. Environ. Sci. 2016, 47, 153–164. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Ling, S.; Guan, K.; Luo, X.; Chen, L.; Han, J.; Zhang, W.; Mai, B.-X.; Zhou, B. Bioconcentration, biotransformation, and thyroid endocrine disruption of decabromodiphenyl ethane (Dbdpe), a novel brominated flame retardant, in zebrafish larvae. Environ. Sci. Technol. 2019, 53, 8437–8446. [Google Scholar] [CrossRef]
- Liu, M.; Yi, S.; Chen, P.; Chen, M.; Zhong, W.; Yang, J.; Sun, B.; Zhu, L. Thyroid endocrine disruption effects of perfluoroalkyl phosphinic acids on zebrafish at early development. Sci. Total. Environ. 2019, 676, 290–297. [Google Scholar] [CrossRef]
- Han, Z.; Li, Y.; Zhang, S.; Song, N.; Xu, H.; Dang, Y.; Liu, C.; Giesy, J.P.; Yu, H. Prenatal transfer of decabromodiphenyl ether (BDE-209) results in disruption of the thyroid system and developmental toxicity in zebrafish offspring. Aquat. Toxicol. 2017, 190, 46–52. [Google Scholar] [CrossRef]
- Gupta, P.; Kar, A. Cadmium induced thyroid dysfunction in chicken: Hepatic type I iodothyronine 5′-monodeiodinase activity and role of lipid peroxidation. Comp. Biochem. Physiol. Part C Pharmacol. Toxicol. Endocrinol. 1999, 123, 39–44. [Google Scholar] [CrossRef]
- Paier, B.; Hagmuller, K.; Noli, M.I.; Gonzalez Pondal, M.; Stiegler, C.; Zaninovich, A.A. Changes induced by cadmium ad-ministration on thyroxine deiodination and sulfhydryl groups in rat liver. J. Endocrinol. 1993, 138, 219–224. [Google Scholar] [CrossRef]
- Orozco, A.; Valverde, R.C. Thyroid hormone deiodination in fish. Thyroid 2005, 15, 799–813. [Google Scholar] [CrossRef]
- Wu, L.; Li, Y.; Ru, H.; Xie, H.; Yao, F.; Ni, Z.; Zhong, L. Parental exposure to 2,2',4,4'5-pentain polybrominated diphenyl ethers (BDE-99) causes thyroid disruption and developmental toxicity in zebrafish. Toxicol. Appl. Pharmacol. 2019, 372, 11–18. [Google Scholar] [CrossRef]
- Van Der Geyten, S.; Byamungu, N.; Reyns, G.E.; Kuhn, E.R.; Darras, V.M. Iodothyronine deiodinases and the control of plasma and tissue thyroid hormone levels in hyperthyroid tilapia (Oreochromis niloticus). J. Endocrinol. 2005, 184, 467–479. [Google Scholar] [CrossRef] [Green Version]
- Chen, Q.; Yu, L.; Yang, L.; Zhou, B. Bioconcentration and metabolism of decabromodiphenyl ether (BDE-209) result in thyroid endocrine disruption in zebrafish larvae. Aquat. Toxicol. 2012, 110–111, 141–148. [Google Scholar] [CrossRef]
Gene | Sequences of Primers 5′-3′ | Gene Bank | Efficiency (%) |
---|---|---|---|
tshβ-F | CCAGACAGACATCCTCATACAC | AY135147 | 94.92 |
tshβ-R | GCACGGCAACCTTCATTAAA | ||
tg-F | CTCTATCCTTTCGGCTGGTATG | XM_001335283 | 95.33 |
tg-R | GAAGGAGAGCGGAGACTAAATG | ||
nis-F | GGTGGCATGAAGGCTGTTGC | NM_0011089391 | 94.80 |
nis-R | GATACGGGATCCATTGTTGG | ||
tpo-F | GCGCTTGGAACACAGTATCA | EU267076 | 91.69 |
tpo-R | CTTCAGCACCAAACCCAAAT | ||
ttr-F | CTCCTGGTGTGTATCGGGTG | BC081488 | 94.29 |
ttr-R | AGGATGTCAGTCATGTGCCTT | ||
thrα-F | GGCTCGGAGTGGTTTCTGA | NM_131396 | 99.51 |
thrα-R | CTTGCGGTGGTTGATGTAGTG | ||
thrβ-F | CACATGCTGTGTTGCAGCTT | NM_131340 | 93.29 |
thrβ-R | TCATAAGAGCCAGAGCCCCT | ||
dio1-F | CTGGACCGACAGAAGACGAG | BC076008 | 100.90 |
dio1-R | TGCGACATTGCTGAAGTCCT | ||
dio2-F | CTCGGACACTTGGCTTGACT | NM_212789 | 106.50 |
dio2-R | TTGGATCAGGACGGAGAGGT | ||
ugt1ab-F | CCACCAAGTCTTTCCGTGTT | NM_213422 | 91.01 |
ugt1ab-R | GCAGTCCTTCACAGGCTTTC |
Cd2+ (μg/L) | 0 | 10 | 100 | 1000 |
Hatching (%) | 88.75 ± 2.14 | 87.25 ± 1.00 | 86.92 ± 1.51 | 85.00 ± 2.95 |
Malformation (%) | 1.00 ± 0.43 | 1.75 ± 0.66 | 3.00 ± 1.09 | 6.17 ± 1.38 ** |
Survival (%) | 88.08 ± 2.57 | 85.83 ± 0.95 | 85.58 ± 0.63 | 83.92 ± 2.40 |
Hg2+ (μg/L) | 0 | 0.1 | 1 | 10 |
Hatching (%) | 90.5 ± 0.75 | 90.08 ± 0.52 | 88.58 ± 2.01 | 87.67 ± 2.32 |
Malformation (%) | 0.92 ± 0.14 | 1.50 ± 0.66 | 2.50 ± 0.43 | 5.00 ± 0.50 ** |
Survival (%) | 89.42 ± 1.77 | 89.00 ± 0.50 | 87.67 ± 1.51 | 85.83 ± 2.08 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhong, L.; Zhang, H.; Wu, L.; Ru, H.; Wei, N.; Yao, F.; Ni, Z.; Duan, X.; Li, Y. Thyroid-Disrupting Effects of Cadmium and Mercury in Zebrafish Embryos/Larvae. Water 2023, 15, 135. https://doi.org/10.3390/w15010135
Zhong L, Zhang H, Wu L, Ru H, Wei N, Yao F, Ni Z, Duan X, Li Y. Thyroid-Disrupting Effects of Cadmium and Mercury in Zebrafish Embryos/Larvae. Water. 2023; 15(1):135. https://doi.org/10.3390/w15010135
Chicago/Turabian StyleZhong, Liqiao, He Zhang, Luyin Wu, Huijun Ru, Nian Wei, Fan Yao, Zhaohui Ni, Xinbin Duan, and Yunfeng Li. 2023. "Thyroid-Disrupting Effects of Cadmium and Mercury in Zebrafish Embryos/Larvae" Water 15, no. 1: 135. https://doi.org/10.3390/w15010135